731

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 416

Пикотехнология белков, ДНК, РНК - 2

https://img-fotki.yandex.ru/get/246231/158289418.3e0/0_176322_9bbcdbd1_orig.png

https://img-fotki.yandex.ru/get/198026/158289418.3e0/0_17632d_14564c0a_orig.gif

Все файлы в одной папке: https://cloud.mail.ru/public/9E4w/ePGYJ64ZS

732

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 423

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Таблица музыкального генетического кода

https://img-fotki.yandex.ru/get/233608/158289418.3e0/0_176362_76801e69_orig.png

Кушелев: Из таких музыкальных "кирпичиков" складывается музыка сборки белковых молекул. Каждая аминокислота - нота тонального или ударного инструмента.

А так выглядит музыкальная партия сборки молекулы коллагена (правый столбец):

https://img-fotki.yandex.ru/get/197213/158289418.3e0/0_176387_706c61cb_orig.png

733

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 425

Пикотехнология белков, ДНК, РНК - 2

https://img-fotki.yandex.ru/get/170627/158289418.3e0/0_1763ea_986f637e_XL.png
Полная структура коллагена: https://img-fotki.yandex.ru/get/197213/ … b_orig.png

https://img-fotki.yandex.ru/get/58784/158289418.3e0/0_1763f9_6e88eb6c_orig.gif

https://img-fotki.yandex.ru/get/195694/158289418.3e0/0_1763ec_54bddfc6_XL.jpg
Несколько разных ракурсов 4000*3000 пикс и другие файлы можно посмотреть в папке: https://cloud.mail.ru/public/n7AN/yRtSNfMHw

734

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 426

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Обнаружена корреляция между первичной, вторичной и музыкальной структурами белка коллагена.

https://img-fotki.yandex.ru/get/218038/158289418.3e0/0_1763fa_ab3b35c1_orig.png

Первичная структура: Каждый третий - Gly
Вторичная структура: Каждый третий -"5", два других "3"
Музыкальная структура: Каждый третий - сильная доля.

Обратите внимание, что вторичная структура сдвинута относительно первичной на один аминокислотный остаток. Интересно, какой в этом смысл?

735

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 437

Пикотехнология белков, ДНК, РНК - 2

Татьяна Рясина пишет:

Друзья, фиксируйте Ваше намерение (готовность, интерес) долевого участия в покупке лицензии NCBI  здесь https://picosoft.nethouse.ru/comment

Как сумма обозначится, начнём работу с юристом.

А пока набирается инвестиционный потенциал, рассылайте форму для определения структур белка потенциальным заказчикам (у кого есть прямые живые контакты)  и делайте репосты в комментах к видео Ютуба и во всех соцсетях где Вы присутствуете.

К сожалению, в настоящее время я могу надёжно установить только вторичную структуру белка. Третичная строится упрощённо, т.е. с некоторым процентом ошибок, который меняется от структуры к структуре и колеблется в интервали 0...30%. Я вижу большинство ошибок, но для их исправления в ручном режиме нужна новая версия программы. Для этого нужны программисты, которые быстро смогут написать новую версию. Программисты, которые делают новые версии сегодня, заняты на основной работе, поэтому создание новой версии может длиться годами...

https://img-fotki.yandex.ru/get/218038/158289418.3e0/0_1763fa_ab3b35c1_orig.png
В частности, распечатка нот музыки сборки белка стала возможной за счёт сменного набора графических элементов. Та же программа с новым набором элементов смогла показать ноты. По оценке программиста вывод музыки в стандарте MIDI можно сделать за один рабочий день, но свободного дня может не найтись и в течение месяца...

736

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 446

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Очень интересная структура. Бета-спираль длиной 47 аминокислотных остатков. Возможно, что это ещё и не предел.

https://img-fotki.yandex.ru/get/219501/158289418.3e0/0_176409_c4b61497_orig.png
Структура полностью: https://img-fotki.yandex.ru/get/172684/ … c98_XL.png

Обратите внимание на наличие аминокислотных остатков Pro. Это - суставы, т.е. структура, содержащая пролины может быть кинематическим механизмом. Однако смоделировать подобную пикомашины можно лишь с учётом физики процесса. Чисто геометрический алгоритм может дать подсказки, но их может оказаться недостаточными...

"Музыка" сборки этого участка белка соответсвтует "щёточкам" или "маракас" smile Это структурный участок белка, т.е. "немузыкальный"

737

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 447

Кушелев: Запустим поиск по аминокислотной последовательности: APAPAPAPA

https://www.ncbi.nlm.nih.gov/protein/11 … 1W0KT5J016

https://www.ncbi.nlm.nih.gov/nuccore/1110565308

FT    CDS             complement(13850..>13933)
                          /translation="APAPAPAPAPALKQKFPGIDIDAKVSR"
        1 ctgggcatcg agcacttcgt gttgtcgggg tatccgcacc tggaggaggc gtactggttc
       61 ggcgaggggg tccggccgga gctcgccgcg cgggggctgc tggatgctgg gtgctgagcg
      121 gagcgccagc cggaggtggg gccggggcgg gagatttcca cccgccgccg acaaccttgc
      181 acggtggggc gcgaatgaca cggcgcgagt ttgctgttgg gtacgccagg gggatatagc
      241 accgccacca cgaccactac ggcaggcgtg cacggtgacc ggagcgatct cgccaggccc
      301 gtccgcgcca cagagaagcg cgagccgcgg ggggtgctac atcccccgtg cccctcaccc
      361 atgccttcca cggtagtggg caattcggtc caaacacatg tcgaaggtcg cagtcccgca
      421 ccgctccgcg agcagccccg ccccactcgc ccaaccccaa cggctcacgc ggctgcaaca
      481 gctcgtcccc atctctacgc acagccgctc acccggatcg cccggctcac catcgacgat
      541 gtcctctaag aagacgggta ggtcctgatc cagctcagcg gcccaacctc gcccgtcctg
      601 gcccctttcg cgacaatgct gctgggctac ctgagccaac ggccgaacac catgatcgcg
      661 tccaacccag acgaccgatg gctcttcccc ggccgacgag caggacagcc catcaccaca
      721 gaggccctcg aactccgcct ccggcgcctg ggatttccca tccagctagg acgcgcggcc
      781 gcgatccacc gactcgactt tcagcccccg cccccatggt tcggtgggtg tggtgggtgg
      841 atggtcaggc cggtgtgggt gagggaggac catggcaggt gctggttgtg gttgatccgg
      901 tggatgcctt gttcggtggc gtcggcgagg tggtcgccgg cgaagttggc gagttcgcgc
      961 ttcttgagcg acgaccagag cagttccacc gggttcaggt ggggtgcgta tgcgggtaat
     1021 cgctcgagag tgagccagtc ctgctcggtg tcccaggctc gcatcgcccg gctccagtgg
     1081 gcggaaaggc cgtcccagac caggatcact ggctcgccac ggtagaacgc tttgtcctgt
     1141 tcaagggcct cgatgagggc ggtggtgtcg tagctgccag gtttgaggtg gaaacacagg
     1201 cgaggaccgc ggtcggagtc ggtggagtgg tagcccaggg ctgcagccat cgacgcacgc
     1261 ttccagttca gtcggtgccg cggaagcggc gtgcagccgc ggggtgcgta cgttgtcaac
     1321 ggacttccag aagtccgttg acaacccctt cctcccacac acgcctccat cgccgcatgc
     1381 tctcgggaca cactcccacc gcccaccctc cttgaacaac tcgaccgccc gaacacgacg
     1441 cgcctccgcc aactgcggcc gcgacaaagg aggaacggaa gaaccaggcg cagaggatga
     1501 aggtcaataa gacatcccga cagcctccca cccacaaggc caccacccca ccgaacttac
     1561 gaaaagtagt gcggaagatc ccggaagtgc agccgttcgg tggccaaggc gcgtccggtg
     1621 cacccgcggt gccgcgcttg gccgcgatga gtgtgggatg cgtcgcgagc actttcagcc
     1681 gtcgctgttc aggccggtgg acggcgaagg ctgtgtgcgg cgttccgcag cgagcaagca
     1741 gaggctgccg gtggcagccc gttccgcggc gacggactcc cgggggaacg tcagtgcagc
     1801 ggacttgagt tggttggtgt ctacctcaaa gccgtcgcca gccacgtctc cccctcggct
     1861 tcaggtctcg ttccccttgg cgagccgctg acgatcgttg cagctcgcgg tggtgaccat
     1921 gacatacggg actgacaaac gcccaggtgg cgacgcaatc cagccacacg gcagcccctt
     1981 ccgacggcag ccccagcacg gctgtagccc cttaccggcc gggggccagt aaggggctta
     2041 tgcgctgatg gcctgaaacg atcagacctg agtgttgtcg tcggggtcag ggatcttgtg
     2101 tgtcggcgtc acgcgttggt gagcgccgag gccgagccat acggacgcga gggcgactcc
     2161 ggcgccgatt acggtttcgt tgatggctat gtcggccagg gcgggtacga cggtcccgag
     2221 gagggacagc agggcgacga tgatggagcg gaccatcacc gggttgttgc ggaggaaatc
     2281 gcgcatgtcg gctccatgag tgtcgacttc atgagtgtcg gctccgtgag tggggttagg
     2341 gaagggcgcg aaggacttcg gcggctgctg tgctgggcgc tgtgagcggg gccaggcgta
     2401 gggcgtactt ccagcgctcc agcgcggagg cggtcttcgt ggtcggcgag ggtgccgcgc
     2461 atgctttcgg agttctgaac gacggaacgc acgtcttcgc ggagaccggc gacctcgtcg
     2521 taaatctcac gagcgccgat cgtgacaccc taccgaggtt gaactcgtgg tgtcgcaggg
     2581 gctgacaggt cgtggcttcc tgcgatatca cccaaccgag gcatgcggta tccacagggc
     2641 ggcgggctga cagtcgaacg tcagcagttt cgcgaggagt tacgactcca gacggccgag
     2701 cggttcgcca ggggcgaggc gagttcgttg atcgccaagg agttgcgcat ccggtcggtg
     2761 cagcgatggc ggcgggcgtg gggcgagggc ggtccacgtg ctctgcggtc gcaaggaccg
     2821 gcgtcgctgc ctaggctgag cgagaagcag ttcgcactgc tggaggcgga gctggccaag
     2881 gggcctgcgg cgcagagctg ggaggaccag cggtggacgc tggcgcggat caagacagtg
     2941 atcggccggc gcttccacct ggcctacacg atccagggcg taggcaagct gctggtctga
     3001 ggttcccccg agatgcggag gaagttgaca gggggtcaga tgggactcat gagaggaaca
     3061 tcgaccatgg ctgcccccag aaagtactcg ctggagttgc gtgagcgtgc ggttcggatg
     3121 tatcgcacca cggatccgaa gccgcagatc aagaagctcg ccgttgacct cggagtgcat
     3181 cccgaagccc tgcgcggctg gatccgccag gccgaggcgg acgccggcga acgcgacgac
     3241 cggctcacca cggacgagcg ggccgagctc gtggccctgc gcaaggagaa cgcccagctc
     3301 aagcgggcca acgacgtgct gcggacggcc tcggcttttt tcgcggccca gctcgacccg
     3361 acccggccca ggtgacggcg ctcatcgacg agcatccccg cctgggagtc gagcccgtac
     3421 tccgggaact gcacatcccc tcctccacct actaccgctg gcgccgggcc gagaaggagc
     3481 catgcgaacg catccgtcgc gacgccgagc tgaccgagaa gatccgggag atccatgccg
     3541 attccggcgg gatctacggc tcgccgcggg tgcacgccgc gctcaagcgc gagggtgttc
     3601 acgtcgggcg caagcgggtc gaacggctga tgcgcgagga cggcctggca ggtatcagcc
     3661 cgcgccgcaa gagcggtttc acgcgccgtg acccgaaggc caccctcgcc ccggacctgg
     3721 tgcaacggga cttcacagcc gaggagccga accggctgtg ggtcaccgac ctgacgatga
     3781 tctccaccga cgagggcccg ttgtggctct ccgcgatccg cgacgcgttc tcccggcgcg
     3841 tggtggcctg ggagacctct gcccacgcgg acgccgacct ggtgctgacc acgttggagt
     3901 acgcactcgc cagccgagag gtcgaacccg gaaagctcat tcatcacgcc gaccacggct
     3961 gtcaatacac atccatcaag ctcacaactc gattgatgag agcgggaatt gaggggtcca
     4021 tggggtcggt tgggaactcg tacgataacg ccctcgccga gaacctgtgg atgctgatca
     4081 agaccgaggg cctgcgcgga cgcgccttcg ccacgcgggc cgaggcgaac ctcgcgctct
     4141 tcgagtacat cgacggcttc tataacagtc ggcgcatcca ggaacggctc ggctggctca
     4201 gcccgatcga gttcgaggag aaccactaca ccaagcaggc gaccgccgaa ccaacgaacc
     4261 tgaacgcccg tcaacccctc ctgaccagct gatcagcgac gcccgcgcag cgggggaacc
     4321 tcagtccgca acggctggtc ctgccaggtc ccggcccgac gcccgatgga gccggacgac
     4381 gaggcggtgg ccgggtgggt caaaaaggtg tggccctgcg cggaagactc gcggcgaccc
     4441 gtggagcctg gctcgtctac gaggacgaag ccagcttctc catgacgccg ccgcaggcga
     4501 agacctggtc acaacgtggc cggactccag tggcgcgggt ccgcggccgt tcccgcagac
     4561 gagtgtccat cgcggcgctg acccgctgca aacctggcca ccgtcccgac tgatctacca
     4621 tccgcgcagg gacaacggcc gcaaaagctt ctcctgacgc gactaccggg acctgctgat
     4681 cgccgcgcat cagcagctcg agctatggat ggctgatgtt ccaccgccgc ctggcacgcg
     4741 actacgaagc ccatgacgct cggcatcaac agcatcgaca agctcctgca caacggcgtc
     4801 cgcgacaacg tctaccccgg tgccgtctgg gccatcggcg acgcggccgg aacgaaggcg
     4861 aatggcgccg tcggctgcct cgacccgatg caacccgacc atccgatgcg actcgacacg
     4921 atcttcgacg tcgccagcct cgccaagatc ctcgccgtgt gggcctccat cggcaccctc
     4981 gtcgaggacg gcaagctcca actcgatcag tcactcggcg gcttctggtc agaggttgaa
     5041 ggccgccctc tcggccaggt caccgcccac cacctcctga cccacaccgc atgtctcccc
     5101 ctccgcgcca acctcaagaa cctctacggc accgatgccc aggacatccg cgacggcgtc
     5161 ctccacgaag ccctgcaccg cccacccggc gaagtagtcg tcaaatacac cgaccgtgcc
     5221 gccctcatcc tcggctacct cgccgaacac atctccgggc agcggctcga ccagctcgcc
     5281 cgtacgcgga tctggcgctc tcttgggatg gccgaaacgt ccttcggccc ccttcccacc
     5341 cagcccgcga aacggtgccc gccgaccgag atgaacgaag ccaacggact ccatctcaag
     5401 ggcaccaccc acggcttctc cgcacgcctc ctcgacggca tctgcggaat cgccggcgtc
     5461 ttctccctcc ttcaaagcct cgcctccttc ctccgccgca tgctggatcc catggccgct
     5521 ccagagcagc cgggtttcag ccccgactgg gtaacggagt cgctccagat ccacaccggg
     5581 gaagaacgcc agagcggggc ctgttctggc acgcagcccc cggcacggat ccggcatcag
     5641 acgacatctg ggtgcactac ggcttcaccc gcactggcat gtggatctca ccggcgaaag
     5701 gccgctgggt gatcctgctc accaacaagc tctactacac acgcgaccgg gaacccgtga
     5761 ccgcactccg cagcaatgcg tttcgcaccg ccgcattcct gtagcagcgg caccagtcac
     5821 ctccgaaacc atgttcaccc cgtgtccgcc tcacccgccc cacagcaaag gcccgggcga
     5881 ggccgcgggc cttgcttact accaggtcct gccgggcgcg gcgggctcgg cagccccgcc
     5941 gggagcgtgc aggctgccgt accgttccat gcactgccaa cgcagccatg agcccgacac
     6001 ggcggtgaac acggactgga tgaccaccag gtacatcagt tgccggtaga cgaactgctg
     6061 tagtggcagg ctccacagcg ggccggggtg ttcgccgtcc aggcggaacg cgtacaggcc
     6121 catgaggagt tgcaccaggg tgaaggccag ccacaggccg acgatccgga ccgggtcgag
     6181 gaaagccagc ccgtagaggg cgaagatgtc cacgatgggc gcgaacagtg gtagcagcac
     6241 ctggaaaagg agcaggtaga ccaggccccg gcggcccagc tttcccgccg caccgcgctg
     6301 cgtgagcgcg ccgcggtgct tccacattgc ctggagtgtg ccgtaacacc agcggtagcg
     6361 ctggcgccac agggccttca gcgtggccgg tgcctctgtc catgcggcgg cgtcctctac
     6421 gtagacgacg cgccagccgg cacggcacag gcccatggtg aggtcggtgt cctcggcgag
     6481 ggtgacgtcg ctgacgccgc cgaggtccag cagcgcctgg cggcggaacg caccgaccgc
     6541 gcccggcacg gtcggcatgc actcggcgag gtcgaacagg cggcggtcga ggttgaagcc
     6601 gacgacgtac tcgatgtgct gccagcgccc cagcaggcca ccgcggttga cgaccttggc
     6661 gttccctgag actgcgccga cgcgggggtc ggcgaagggg tggacgagcg tgcggacggt
     6721 gccgggttcg aagaccgtgt cgccgtcgac catgaccacc aggtcgtgag aggcggcggc
     6781 gaggccggtg ttgagtgcgg cgggtttgcc ggcgttctgt tgccggatga cccgcaccgg
     6841 caggcccagg gactccacga ggtcggcggt gccatcggtg gatccatcgt ccaccacgat
     6901 gatttcgacc gggtggtccg aggcgagcag tgagcgcacg gccgcctcga ttcccgcgct
     6961 ctcgttgtag gcggggacga tgacgctgac cggctcggtc accggcggcc cccatgacct
     7021 gcccgtgcgc cggtccctgc cgcgtcggtg ccgacgggcc gcgaccagta ccgcgacggc
     7081 acgcagcacg ctgatcgccc cggccgcgta catcagcagg cccagcagcc acacgaggca
     7141 gtccccgtct tggagggccc agttgaacgc catgccctgg atgtggtcga gggtgccggc
     7201 ggactgaacg ggggcgggca tgccgaccgc gtcgctgacc ctcgtgaagt caaagccctg
     7261 gtccttgagt cgtggcaaca gggtgccgag tgcggcgacg gtctgcgccc ggtcgccgcc
     7321 ggcgtcgtgc atcagcagga tctgccccct gttgctgtgc ggtgtggcgt gggcgaggat
     7381 gtggtccgct ccgtggcgtt tccagaccgg gtcagggccg tcgtcgaagg tgagcgcgat
     7441 ggtgcgtggc ttcacttcgg cggtgcgagg ggaggcgttg gggttggtga tcaccggacc
     7501 gccgttggcg acgtccgcgg gcaccgcacc gctggggccc tgagcgccgg gcgttccgtc
     7561 cggtgtggtg ccgaacaagt ggtgggtgta gccctggagc agcagtgcca cggacagtgc
     7621 cgccgcgagc atggccaaca gcagccagtg ggtgcgaggc gtggtgtggc gagtgcgggc
     7681 gtggccatga cgggaggcgt tgcgctggtg agggtcggtc acggaagggc ctttggggtt
     7741 acgtccggcg tctgccggtc gcatcgggca cgtggtccct ggctgctggc gggggcacgg
     7801 tggtactggt cgctgctgtg ggcgtggacg ctgccgccgg agtcgcggca ggccccgtcc
     7861 gcgtggtggc cttccggcgc tgtggggcgg gccgtcggat ggtgtggggt cggctgtggg
     7921 acgggcgggg agccgagcgc ggggccgccc agcaccgtgc tggccagcag ggcgaggtag
     7981 ccgcaggtag cgatcgccaa cagcctggcg gctcgttgca cacggcgctg acgccgcccc
     8041 gatgagtcga cgaagacggg tcgcgccgcc ttgctgccgg gtatccgaga gccgggttcc
     8101 tcgtgatcgg gggcggcacg gtccgggggc gggagggtga gcacgcccgt atcaggagtg
     8161 ccccgtgtcg tgagggcgtc cgtcgtgtgg tcttcaggcg ggcgaaatcc atgagtcggc
     8221 acctttggga gtcgaatgcg cgaggggtct gtgaggactc cgccatggtc gacagggaag
     8281 atctccaacc ggccgtgatg gggtatcgcc ccctggtcgg cccggcatcg tccatgtatc
     8341 ggcggtgtat cgggactcgt cacgtcgcca tcgccgcgcc atccggccgg ttgccggagg
     8401 ttgtggaagc gggagccgcc cggcgcgtgc ccagggcctc ggtcgatagc tgtcttggag
     8461 gtccttctgc cctccgacgc cgttcgtacc gaggtcgttg acagtcgatg atcacggcgt
     8521 cgtcaagtgg gtgcttcttc ttgagtacct gtttctgagc tgggcacgac atggcaccag
     8581 tgatgttctg gtgtttgccc agctcagaat tcgaacggag gggtttgggt ggcgaggtcg
     8641 gctggtcgac ggctgacggc cggcctcgat tttgccggtt gcgccgatga agccgtcgtg
     8701 gtggtgcgag aattgggtgg cttgagggcc ggtgacctct tggtggcact gacgacggtc
     8761 agtgccgatc ggatcagtcg cggtgggctt cgcggggtgc cggctggccg cgtctgcggg
     8821 agcttcggcg ggtgatgcgc ttggtcataa gggtgatcgc ggcccaggtg atgagcgatt
     8881 ctgagtgctg gacgagccgt tcgtagtcgc gggcatgccg acgggcgtgc atgacccagg
     8941 catgtgagcg ttcgacgacc cagcgtcggg gcaaaacgac gaacccgacg gcgcccttcg
     9001 ggcggctgac ggtcttgatc gtcaggttca ggaaggtctt tgcccagtcg acgagctgtc
     9061 cagcgtaggc ggagtcggcc cagacgatgg tgatctcggg gtgcatcagt cgcagccgga
     9121 acagcacttc cttggccgcg tcccggtcgg tcatgtcggc cggggtgacc atgacgaaca
     9181 gcggcagtcc cttggtgtcc acgaccagat gcctcttgcg ctcgttcacc tttttcgcgg
     9241 cgtcgtagcc gcgtgagtct ttgccgacgg tctccgcggc cttgaccgac tgggagtcga
     9301 tgacggtggc gaccgcgccg ggcgcccgcc ccatctcccg gcggatgcgt ttgcggaact
     9361 ggtcacggat ctgcccgacg acgccgcatg cggcccaacg ggccatgaat ccgtagcaag
     9421 ttcgccaggg tgtaggaagt ccttgggaag tgccctccac ttgcagcccg tgtccacgac
     9481 atagcggatc gcgtccacga tctcccgccg tgggtgcttc tccggccgcc cgcccgacct
     9541 ggtctcgcag gccggtgtcg gcaacagcgg ttcgatcagc gcccactcgt cgtcgaaggt
     9601 gtcggagggg tagcagcgcc tgcgcggcat cgctgcctcc ttcctcaagg acgtggcggg
     9661 cccggccgcg aagcggccgg gcccgccggt caggcgtcgg cgtcggtgta gtcggcgatg
     9721 acgtcgagcg tggactcgac cgagttgagc tgggtgttga ggtgtttgat ccaccggcct
     9781 ttgggctgga ggacggcgtg cggggcgacg gttccggtga tgaaccggcg gatctcggtg
     9841 agcttgccgc ggatgatcgc gatctcgtat gcctggagtt cggcggggtc ggcgcagaat
     9901 ttgtagccgt ccttcttggt ccagatcagg ggcggccagc cgcgttcggt gatgatgtcc
     9961 cgcaggcagg caagccccgc gcgggcctgg tggggggaga gttcgctgga tctgaccagt
    10021 tggggaaagg tcagaccggc cggccgggct tcgaagagca cgaaccggac gctgtcggcg
    10081 tgccgctggg ccgccggcga cctgcgctcg gaggcacgtg gcatcggcta ttcaccctgc
    10141 aggagcttgg ccagttcgcc gtcgacgtcg accttgccgg tgtccacagc cgtctcgatc
    10201 cagtccaggg tcgcgcggac gcgggcgacg ttctcgtgca cgatcacgcg ttcgtcgtcg
    10261 ccgagctggc ggtcacgcat cccggggacg acccggccag ccgccgcgac gaacgcgtgg
    10321 caggcggtga ccaggtccaa gaactccacc gaccggtcga tgttgcggat cgcgggggcg
    10381 acggggctgg tctcctcgaa gtgctcgcgg gcctgccgac cctggtcgac ctgggcccgg
    10441 ttgacctggt ggcgggcggt gtcgtccgac atcgccttga aggcgacgtc cggcctgcgc
    10501 agcaggccgg tggtcacctc ggccgcgacg tgttcgtcgc gggtcagctc ctcgacgacc
    10561 ttcaccttgt ccgccttggc gacccgggcg acgaccgcgg ggcggcgcag gaagtccggg
    10621 gcgaccgcgg ccgcgacctg gtcctcgcgg gtcagttcct ccacgacccg gaccttgtcc
    10681 tcgtccctga cctgcgcgac cacctccggt cgccgcagca ggtcgccggt gacacgtccc
    10741 gcgacctcct cgtccttggc gagcgagtgg atcgcgctga ccttctcctg cggggtgacg
    10801 ggcttgacga cctggcgtcc gacccgccgg ttggcctcgt ccggcgtcca acgggacttg
    10861 ctctcaggcg ggttgaggat cgtggtgaac cgttcctcgt cgtcggcgat ggccgcgagg
    10921 atgttgtgga ccgtgaatga caccccggcg acccgccgga ccttcggcca cttcgacgcg
    10981 gtccaccggg ccttgtccac catcgcgtag gacaacccga tgtcctcggc caggcgaaac
    11041 aacgagtcct tgaccctgaa cagcgagtcg ctccgctcct ggccgccagc ctcgcgcatc
    11101 ggctcgactt cgagtgcgta gtcgccgatc gtgaactgga tccggctggc ggtctccacc
    11161 agtttccgca gctcggccac gatctccgcg taccggtccg cgctgacgct gccgaccttg
    11221 tcggcgctct cgacctcttc ggtcatgggc ttctcaccct caactacggg ccgtggcacg
    11281 gcacttggga ccgtgacaag acgcagcccg cctctcgacc gagagtcaga ccagaaatcc
    11341 taagatcaca acgatcgacc gaaagtgacc ggatctgatc gaagatgcga tccggatgcg
    11401 ttcgcgttgc ggtcaccgtg accgttcacc gaacgattcc tttcgggctc gccaggccct
    11461 cgtgacggtg cgagcagtag accgcgttcg aacggcgatc cacccccgcg acccaagtag
    11521 ccccgcactt ggggcactcg gcccggccgg cgccacccag ctcagccgcc acccgcttac
    11581 gcaaccgcag gtcacgacgc cactgcctgg cacgacacgc cgtagagcag aacctcgccc
    11641 gaggtggagc ctccggcctc agccgactcc cacacccctc acacgcacgc tccacagcct
    11701 gcccggcacc ctcggacacc cggccagcct agggcacaaa gctactcaaa acctgggatc
    11761 gaaaacaggc actgagcttg acatttaagg tccggcattt gacggcgcct cggtcttgac
    11821 caggctcgtt gcggttgccg gaactatggg cgcttgctcc acccggccgt tggccggatt
    11881 cgctggttga cgcgcctgac agcatggatg acatgcctgc ttacgtgatc tctgaggttg
    11941 aggtgctgga cgaggaactt gctgacgtct accggacatt ggcggaggct tccatccgtc
    12001 gctacggcgg tcgctatatc gtccgcggtg ctctgcccga agcggtggag ggtgcctggc
    12061 cctcttctca gcgggtggtc gtcgtcgagt tcccggatac ggatcgggtc aaggagtggt
    12121 acgcatcttc cgagtatgcg gaggcgcttg aggtccggaa gtcagccctg gaacggcggc
    12181 ttcttctcgt cgagggagtg tctgagtagc ggtcgctatc gtccggcgtc gaacgtgcat
    12241 cgaacttgat cagtgttttc gcagttcagc ggacgtgaag gcggccttcg tctgatcctt
    12301 tgcttcgtca caaggcacag gaagagtacg aaggccgcag tcatgagtgt gggggatcag
    12361 cgcgtcctgc gggatgcgtt cgcggaagtg tcacacttcc ggacggagtt gtacgcgtgt
    12421 ctgaccacat ggggcgacgc attgttcgag ttgtgcgatg ccgtgctgtg caccgacggt
    12481 cccgtccggt cgctcgtcga gcttgccctg gctcccgaac accgccgtgg tcacggctcg
    12541 ttgtatgccg gactcaacga cggtcacatc gacgtcggcc ggctccgccg agccctggca
    12601 ggggtgccgt tgcccagggc tgctgacggt cgcctggtcc tggcggtgga cgtctcaccc
    12661 tggctgcgac cggatgcggg gacctgcccg gaccgctcgt tctgccacac atatggccgc
    12721 ggcgaggcca agcaccagat gatgcccggc tggccctact cgattgtggc ggccctggag
    12781 acgggccgga cctcctggac ggcgatcctc gacgccatcc gtctggaacc aggtgccgac
    12841 gttgccgccg tcaccaccgt ccagatccga gaggtggtcc agcgcctggt ctccgccggt
    12901 cactggcagg agggcgacct ggagatcctg gtcgtcctgg atgcgggtta cgacgcgccc
    12961 cgcatcgcgc atctgctggc ggacctgccg gtgcagatcc tcggccggct ccgctcggac
    13021 cgggtcatgc ggcggccgac accgccccgg gtctacgccc ccaagggcgg ccgaccgccc
    13081 aagcacggtg gagaattcgt cttcggcgac ccggccacct ggggtgacga gcaggccgtc
    13141 accgtcaccg acacccgcct ctacggcacg gcgaccgcac gggcatggga ccggttgcac
    13201 ccgcggctga cccgccgagc cgcctggatc gaccacgacg gaccgttgcc catcatcgag
    13261 ggcaccgtca tccgcctggc cgtggagaga ctgccgtccg gcggggtgaa caagcccgtg
    13321 tggttgtggt ggtcgggcac cgacgccacc gcggccgacg tcgaccgctg ctggcagtcc
    13381 ttcctacgga gattcgacct ggagcacacg ttccggatgc tcaagcagac cctcggctgg
    13441 gcccggccac ggctccgcag ctcaaccgca gccgaccgct ggacctggct ggtgatcgcc
    13501 gcacataccc agctccggct cgcccgaccg ctgtccggcg acctccgccg gccgtgggag
    13561 aagcccgccc caccgaacaa gctcacaccg gcccgcgtca ggcgagggtt caggaacctc
    13621 cgtgcaagga cgggctcccc agccagtgca ccgaaacctt cccggcccgg ctccggacgg
    13681 cctccaggat cgaagaacca tcgcccagca cagcgttacg aggtgggaag agtgcttgcc
    13741 accggccagg cattcagccg cccgacccat cacaaggtcg gtacgaaacc acggcgcaca
    13801 gcttaaaaaa caagctgagg gcagcgatct cccttgaggc tgtggacagt tagcggctga
    13861 ccttggcgtc gatgtcgatg ccggggaact tctgcttcag ggccggggcc ggggccgggg
    13921 ccggggccgg ggc
//

***

                                                                                                t tagcggctga
    13861 ccttggcgtc gatgtcgatg ccggggaact tctgcttcag ggccggggcc ggggccgggg
    13921 ccggggccgg ggc

Последние 84 символа нужно прочесть в обратном порядке и заменить A на T (и обратно) и G на C (и обратно).

ttagcggctgaccttggcgtcgatgtcgatgccggggaacttctgcttcagggccggggccggggccggggccggggccggggc

Пока программист доделывает эту программу, обработаем код вручную.

Locus D1W0KT5J016
FT   CDS complement(1..84)
     ttagcggctg accttggcgt cgatgtcgat gccggggaac ttctgcttca gggccggggc
     cggggccggg gccggggccg gggc
//

Современная версия музыкальной программы 2D-Пикотех не может отработать опцию "complement", поэтому придётся сделать это вручную:

ttagcggctgaccttggcgtcgatgtcgatgccggggaacttctgcttcagggccggggccggggccggggccggggccggggc

Заменим t->a, a->t, c->g, g->c

aatcgccgactggaaccgcagctacagctacggccccttgaagacgaagtcccggccccggccccggccccggccccggccccg

Изменим порядок следования символов на обратный

gccccggccccggccccggccccggccccggccctgaagcagaagttccccggcatcgacatcgacgccaaggtcagccgctaa

Теперь снова сделаем файлы dne:

Locus D1W0KT5J016
FT CDS 1..84
     gccccggccc cggccccggc cccggccccg gccctgaagc agaagttccc cggcatcgac
     atcgacgcca aggtcagccg ctaa
//

и fasta:

>D1W0KT5J016
gccccggccccggccccggccccggccccggccctgaagcagaagttccccggcatcgac
atcgacgccaaggtcagccgctaa

Эта "нелёгкая" ручная работа привела к очередному научному открытию!

***

Формы, механизмы, энергия наномира. Сообщение 86 448

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Музыкальный генетический код помог обнаружить белки-антигомологи!

Кушелев: Одним из признаков антигомологов является разная длительность одинаковых нот. Дело в том, что кодоны альфа/310 спирали быстрые, кодоны пи-спирали медленные, а кодоны бета-спирали сверхмедленные.

https://img-fotki.yandex.ru/get/31690/158289418.3e0/0_176416_7e3e964e_orig.png
Музыка (упрощённая) сборки белка D1W0KT5J016 в стандарте MIDI: https://cloud.mail.ru/public/DvsU/x7SzcZBKF

Поэтому одни и те же ноты сборки антигомологов звучат по-разному.

https://img-fotki.yandex.ru/get/224193/158289418.3e0/0_176414_e56dceab_orig.png
Полные вторичные структуры белков:

https://img-fotki.yandex.ru/get/106972/ … 1_orig.png

https://img-fotki.yandex.ru/get/105284/ … 4_orig.png

3D модели белков-антигомологов:

https://img-fotki.yandex.ru/get/174613/158289418.3e0/0_176417_735824b9_M.gifhttps://img-fotki.yandex.ru/get/53145/158289418.3e0/0_17632a_231b13db_M.gif

Полный комплект файлов одного из антигомологов ( D1W0KT5J016 ) находится в папке: https://cloud.mail.ru/public/5YTM/hbAQNfXdM

Полный комплект файлов другого антигомолога ( CDJ31753 ) находится в папке: https://cloud.mail.ru/public/FEhS/N5F3AfPL5

738

Re: Пикотехнология белков, ДНК, РНК - 2

Формы, механизмы, энергия наномира. Сообщение 86 453

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Таблица композиционного и музыкального генетического кода.

Так выглядит тест программы Picotech:

https://img-fotki.yandex.ru/get/196365/158289418.3e1/0_176443_ec9f3989_orig.png

По существу это - таблица композиционного и музыкального генетического кода.

https://img-fotki.yandex.ru/get/28874/158289418.3e1/0_176445_c32b34bd_XL.png

https://img-fotki.yandex.ru/get/55918/158289418.3e1/0_176446_dec68aaa_XL.png

Комплект файлов: https://cloud.mail.ru/public/43ZC/w3cRWxiV7

739

Re: Пикотехнология белков, ДНК, РНК - 2

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/97 … 1W0KT5J016

FT   CDS complement(1..93)
     ctattctatt gaagcagcac caacagcagc aggagcagga gcaggagcag gagcaggagg
     cacaggcaga ggtaaaggca tccgagtaag cat
//

https://img-fotki.yandex.ru/get/246231/158289418.3e1/0_176463_ef1c111_orig.png

Третий анти-гомолог smile

Полный комплект файлов: https://cloud.mail.ru/public/Anvy/XeEVkdkMq

740

Re: Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/nuccore/697847900

>XM_009646027.1 PREDICTED: Egretta garzetta titin (TTN), mRNA
GAGCAGTCGTGCATTCCCCGCCTCGCCTCGGGTGTAGGGATTGCAAAAAAACAAAACTACACTGTCAAGA
CTGTGTAGTTTTGTTTTTATGATTAGAGGCTCTACAATTCTCATGCTGGGATTGTCTAAAAAAATCTTAC
TCTGGATAAGGACGTCGTTCAAGGAGATTTCGTTGGGCTTAGCCCACTCTTACAGGCACTTTGAGAGATC
AGAGTGCCTGTAAAGATGACGACAAAAGCACCAACATTTACACAGCCATTACAAAGTGTTGTGGCACTGG
AGGGTAGTGCCGCAACCTTTGAGGCTCACATTAGTGGTTTCCCAGTTCCTGAGGTGAGCTGGTATCGGGA
TGGCCAGGTTCTCTCTGCTGCAACTCTGCCCGGTGTGCAGATCTCGTTTAGTGATGGCCGCGCTAAACTG
GTGATCCCCTCCGTGACAGAAGCAAACAGTGGAAGATACACCGTACAAGCCACCAATGGATCTGGGCAAG
CAACTAGTACTGCTGAGCTACTTGTCACAGCTGGAACAGCACCACCCAACTTCTCACAACGACTACAGAG
CATGACTGCAAGACAGGGAAGTCAAGTTCGGCTTGACGTGAGAGTGACTGGAATCCCTACACCTGTGGTG
AAGTTCTATCGGGATGGAGTAGAAATCCAAAGCTCCCCCGATTTTCAAATTTTACATGAAGGAGACCTTT
ACAGCTTAATAATTGCAGAAGCATATCCTGAAGACTCCGGTACCTATTCAGTAAATGCGACAAATAATGT
GGGACGTGCTACTTCAACAGCTGAATTGCTAATTCAAGGTGAGGAAGAAGCCGTTCCTGCTAAAAAGACA
AAGACAATTGTTTCGACTGCTCAGATTTCACAAACAAGACAAGCCAGAATTGAAAAGAAGATTGAAACCC
ACTTTGATGCCAGATCACTTACAAGTGTTGAAATGGTCATGGAAGGTGCAACAGCCCAACAGCTCCCACA
CAAAGCACCTCCACGAATGCCTCCTAGACCTACATCAAAGTCACCAACCCCACCTATAATTGCTGCAAAA
GCACAAATGGCACGACAGCAATCACCATCACCTGTTAGACAATCACCATCACCTGTAAGACATGTCAGAG
CACCAACACCCTCACCAGTAAGGTCGGTTTCTCCTGCTGGAAGAATCTCCACCTCACCTATTAGACCAGT
GAAATCTCCATCTCCAATACGTAAAACACATGTAGTGACAGCAGCTGGGGCCGAAGTCCTTCCTCCTTGG
AAGCAGGAAGGATATGCTGCAACCACAGAAGCCCAGATGAAGGAAACAAGAGTATCTACAAGCGCTACCC
AAATAAGAACTGAAGAAAGATGGGAGGGGAGATATGGGGTCCAAGAACAAGTTACCATTAGTGGTGCTAC
TGCTGGTGAGGTGGCGGCTGGTGCTAGAGAGGTGAGAAAGGACAGTGAAAAAACAGCAGCTGTTGCTACG
GTTGTTGCTGCTGTGGATCAAGCCATGGTGAGAGAACCAGCTCCAGGTGTTGTAGAGCAAACTGCTAAAA
GGACAGCAATGACTGCAGTCCACGTTCAACCTGTTCAGGAGCAGATGAGAAAGGAGGCAACGGTAGTAGT
TACCAGTGATAAAGCCACAAAACAAACAGTAATATCGAGAACTAGAGAAGGAGTCGTTACTTCACAAGAA
CAAAGGCACATCTCTCATGAAAAGGTAAGAAAAGAACCAGAGAAAGTCCCAGTACCCACAGTAATAATTG
CCACAGACAAAGCCAAAGAACAAGAAAGAATATCAAGAGCTAGAGAAGAAATATCTACCAGACACGAGCA
AGTGCACATTGCTCATGAAAAGATAAGAAAGGAAGAGATGAAACCTTCTGTACCTAAGGTAGTAATTACC
ACTGATAAACCTAAACCACCGGTCATAGTACCAAAAAGTAAAGAAGAAATTGCTACCAAACAAGAACAAG
TGAGCATAACCCATGAAAAGATTAAAAAGGAAGCTAAGAAAACTACTGTAGTTCCGAAAATAATTGCCAC
TGATAAAACCAAAGCACCAGTCACAGTGTCCAGAACTAGAGAAGAAATTACAGCCAAGCAAGAACAAACT
CGTCTAGCTTATGATCAGACTGAAGCTGGAAAAAGGGCTGAAGCTGTAGCTACAGTTGTTGCAGCAGTTG
ATCAGGCACGTGGTCGATCGCCCTGGGAACCAGAACAAGCAGATGAAGCTTATGTAAAGCAGAAAACTTT
GGAATATGGCTATAAAGAGCACACTGTAACAGACCATGTTGCTGAGGCCCCAGCAGAACGTCATGTTGTC
ACTAAAGAAGTTAAAACTGTCTATGTTCCTCCTGAGAAACACATCTCAGCTGCTGAAAAGAAGGAAGTTC
ATGTATCGACAGAGATAAAACGAGCAACAGAAACTAAAACTGAGAAAACAATTCACGTTGAACACCCGCG
ACCCCGCACAGCAAGTCCTCACTTCACTGTCTCCAAAATTGCTGTTCCTAAACCTGATCATACATATGAG
GTTTCAATAGCTGGATCTGCCATGGCTACTCTGGAAAAAGAGTTATCAGCTACTTCTGCTGCGCAAAAGA
TCACCAAGCCTGTGAAACCACCCCAGCTAAAGCCACATGAAGTCAGGATAAAAGCAGAGCCAGTTGCCCC
GCCACAGTTTCCCTTTGGAGAGGCTGCTGAGACCTATAAAAAAGAGACGGGTGTGAGCATTAAAGGTGAA
GCAGTGCGGGAAGAACACTTGGTATTGCGGAAAGAAGGTGAAGCAAAGGTGACAGAAACTGCCAGAGTTC
CTGTGCCTGCAGAAATCCCTGCTACTCCGCCCACCTTAGTCTCAGGCCTCAAAAATAAGACAGTGACTGA
AGGTGAGTCTGTCACTCTGGAGTGCCATATCTCTGGTCACCCTCAGCCTACTGTGACATGGTACAGGGAA
GACTACAAGATTGAAAGCTCAATGGACTTCCAGATCACTTTCAAAGCAGGGCTTGCTCGCCTTGTGATTC
GTGAAGCCTTTGCAGAAGACAGTGGAAGATTTACCTGCACTGCTACCAATAAGGCTGGGAGTGTCAGCAC
ATCTTGCCACTTATATGTGAAAGTTTCAGAAGAAATTGAGACTCGAGAAACCATTTCTGAGAAGGCTGTT
ACAGAAGAGAAACGCTATGTGGAGACAAAGGACATTGTAATGGAAGATGTCTCTGCTGCAGCAGAAGAAG
TATCGGGAGAACCCATACCTCCTTTCTTCATAAGAAAACCCATAGTACATAAATTAATTGAAGGTGGGAG
CATTATTTTTGAATGCCAAGTAGGGGGCAACCCAAAGCCACACGTCTACTGGAAAAAAGGTGGAGTTCCT
CTAACGACTGGCTACAGATACAAAGTGAGTTACAAAAGAGAAACCGGGGAATGCAAACTTGAAATTTCCA
TGACTTTTGCCGATGATGCCGGAGAATACACTATTGTTGTTCGCAATAAATACGGAGAAGCTTCTGCAAC
GGTCTCCTTACTAGAAGAAGCTGATTATGAAGCCTATATAAAATCGCAACAAGAAATGATGTACCAAACT
CAAGTGACTGCATATGTCCAGGAACCTAAAGTGGCTGAGGTAGCCCCAGCTATTTCATACGGTGACTTTG
AAAAAGAATACGAAAAAGAACAAGCCCTAATTAGGAAGAAAATGGCGAAAGATACAGTGATGGTCAGAAC
TTTTGTAGAAGATGAGGAATTCCATATTTCTTCTTTTGAAGAAAGACTTATCAAGGAAATTGAACTCAGA
ATTATTAAGACCACCTTAGATGAGCTTCTTGAAGAAGACGGAGAGGAAATGATGGTTGATATTTCTGAAT
CTGAAGCTATAGAAGCAGGATTTGATTTAAGATTAAAGAATTACAGAACCTTTGAAGGGACAGGAGTTAC
TTTCCATTGCAAGACAACTGGATATCCATTGCCGAAGATTGCATGGTACAAAGATGGTAAACGCATAAGG
CATGGAGAACGCTACCACATGGAAGTTCTGCAAGATGGCAGTGCCAGTCTGCGTCTGCCTGTTGTTTTAC
CTGAAGATGAAGGAATTTATACTGTCTTTGCCAGTAATATGAAAGGAAATGCCATTTGCTCAGCAAAACT
CTACGTTGAGCCAGTTGCACCCACAGCAACTCCAGGTTATATGCCAGGACCAGAAGTTATGAGAAGATAT
AGGTCTATTTCTCCACGCTCTCCAAGTCGGTCTCCTGCCCGCAGTTCTCCTTCTCGTTCTCCTGCTCGCA
GATTAGAAGAAACTGATGAAGGACAACTAGAGAGACTATATAAGCCAGTTTTTGTGCTGAAACCTACGTC
ATTTAAATGTTCACAGGGGCAGACAGCAAGATTTGACTTAAAAGTTGTTGGCAGACCTATGCCAGAGACA
TACTGGTTCCATAATGGTCAACAAGTGGTTAATGACTACACCCATAAAATAGTGATTAAAGAAGATGGCA
CCCAGTCATTGATCATTGTTCCTGCCATGCCGGATGACTCCGGAGAATGGGCTGTAATTGCTCAGAATAG
GGCAGGCAAAGCTTCAGTCTCAATGACACTGACTGTGGAAGCTAAGGAAGACCTAGTCAGACCACACTTT
GTGGAAAGGCTGAAGAATGTTAGCGTAAAGGAGGGCTCTAGACTGCAGATGGCAGTGAAAGCTACTGGTA
ACCCTAATCCCGACATTGTATGGCTGAAGAACAGTGACATCATTGTACCTCATAAGTACCCCAAAATAAA
GATTGAGGGAACCAAAGGGGCAGCCGCCCTTAAAATTGAGTCTACTGCCCGGCAAGATGCTGCATGGTAC
ACTGCTACTGCTATCAATAAAGCTGGGCGGGACACTACTCGATGCAAAGTAAATGTTGAAATTGAACATG
CAGAACCTGAACCAGAAAGGAGATTAATCATTCCAAAAGGAACTTACAAAGCCAAGGAGATTGCAGCACC
GGAGTTAGAGCCTCTCCATTTGCGTTATGGTCAAGAGCAATGGGAGGAAGGAGATCTCTATGACAAAGAA
AAGCAGCAGAAACCATTTTTTAAGAAGAAGCTCACATCTTTAAGGCTCAAGCAATTTGGACCAGCACACT
TTGAGTGCAGGCTTACTCCAATTGGTGACCCAACCATGGTGGTGGAGTGGTTGCATGATGGCAAACCCTT
GGAAGCAGCTAACAGACTCCGCATGATCAATGAGTTTGGGTACTGTAGCCTGGACTATGGTGTAGCCTAT
TCCAGAGATAGTGGAGTGATCACTTGCAGGGCAACTAACAAATATGGTACAGACCATACATCCGCTACTC
TGATCGTGAAGGATGAGAAAAGCCTTGTGGAAGAATCCCAGTTGCCAGAAGGCAGAAGGGGACTGCAGCG
AATTGAAGAGTTAGAAAGAATGGCTCATGAGGGTGCTCTTCCTGCAGTTGCAGTGGACCAAAAGGAAAAA
CAAAAACCAGAAATTGTTTTGGTTCCTGAACCTGCAAGAGTCCTGGAAGGTGAAACAGCACGATTCCGCT
GCCGTGTGACTGGCTATCCTTTGCCCAAGGTCAACTGGTACCTCAATGGACAGCTCATCCGTAAGAGCAA
AAGGTTTAGACTCCGTTATGATGGAATCTACTACCTGGATATTGTGGACTGCAAATCGTATGACACAGGA
GAGGTGAAAGTCACTGCAGAGAATCCAGAAGGCTTTATTGAACATAAGGTGAGACTTGAGATCCAGCAGA
GGGAAGACTTCAGATCTGTTCTTCGTCGCGCTCCTGAACCCAAACATGAGCCTGTAGTGACAGAGCCTGG
GAAACTTCTCTTTGAGGTACAGAAGGTAGACAAACCTGCAGACGCAACAACCAAAGAAGTGGTGAAACTG
AAAAGGGCTGAAAGAATCACTCATGAGAAGCTTTCAGAGGAATCTGAAGAGCTGCGTAGTAAATTCAAGC
GTAGGACAGAAGAGGGCTATTATGAAGCCATCACTGCTGTGGAACTTAAGTCTCGCAAAAAAGATGAATC
ATATGAAGAAATGTTAAAAAAGACAAAAGAAGAACTTCTTCACTGGACCAAAGAGATCCCAGAGGAAGAG
AAGAAAGCACTTCCTCCTGAAGGCAAAATCACCATTCCAACATTCAAACCAGAGAAGGTTGAGCTTAGTC
CAAGCATGGAGGCTCCTAAGATATTTGAACGAATTCAAAGCCAGACTGTAGCCCAGGGGACAGATGCACA
CTTCCGTGTGAGAGTGGTGGGAAAACCAGATCCTGAGTGCCAGTGGTTCAAAAATGGTGTGCAGATTGAA
AGGACTGATCGTGTGTATTGGTACTGGCCTGAAGATAATGTTTGCGAATTAGTCATCAGAGATGTGACTT
CTGATGATTCTGCCAGCATCATGGTGAAAGCAGTCAATATAGCTGGTGAAACTTCTAGCCATGCTTTCCT
CTTAGTGCAAGCCAAGCAGTTAATCAGCTTCACCCAGAAGTTACAAGATATTGTTGCTAAAGAGAGAGAC
TCCATGGCAACATTTGAATGTGAGACATCAGAACCCTTTGTCAAAGTGAAGTGGTTTAAGGATGGAATTG
AGATTCATTCTGGAGACAAATACAGGATGCACTCAGACAGAAAGGCTCATTTTCTTTCTGTACTAGCAAT
TGAAATGTCTGATGCTGATGACTACAGCTGTGCACTGGTAGAAGACGAATCCATAAAAACTACTGCAAAG
CTTACTGTTGAAGGTGCTGTGGTTGAGTTTATTAAAGAACTTGAGGATGTTGAAGTACCAGAATCCTTCT
CAGGTGAACTTGAATGCGAAGTTTCACCTGAAGACGTGGAGGGGAAATGGTATCATGGCAATGTTGAACT
CACTTCTAATCATAAATATGTGATCGCATCCCGCCGTGGTCGCCAAATCCTCACTATTAAAGATGTAAAT
AAAGATGATCAAGGAGAGTATAGCTTTGTTGTTGATGGAAAAAGGACTCAATGCAAACTAAAGATGAAGC
CTCGTCCCATGGTTATTCTTCAAGGACTTACTGATCAAAAAGTCTGTGAGGGAGATATTGTACAACTTGA
AGTTAAAGTCTCCCTAGAAAATGTGGAAGGTGTCTGGATGAAAGATGGTCATGAAATTCAATCAAGTGAT
CGTATTCACATTGTGCTGGATAAACAGTCACACATGTTGCTGATAGAAGATGCAACAAAGGAAGATAGTG
GAACTTACTCTTTTAGTGTTCCTGGTCTTGGACTGTCAACCACTGGACGGATCACAGTATATAGTGTGGA
AATAGTGGTGCCTCTAAAAGATGTTCACGTAGTTGAAGGAACAAAAGCTATCCTCGAATGCAAAGTTTCA
GCACCTGATGTGTCTTCCTCCAAATGGTACCTAAATGATCATCAGATAAAGCCTGATGAACGTGTGCAAG
CTGTATGTAAAGGCACTAAACAGAGACTAGTGCTTACCAGAACCCATGCCTCAGATGAAGGACATTATAA
GCTAATGGTTGGCAAAGTTGAAACAAGTTGCAATGTCACAGTTGAAAAAATTCAGATTATTAGAGGTCTT
CATGACATCACCTGCACTGAAACACAGAATGTATCCTTTGAGGTCGAACTCTCCCATTCAGGGATTGATG
TCATTTGGCATTTCAAAGGCCAAGAGATCAAGGCTGGTCCTAAATATAAAATTGAAGCACGTGGCAAAAT
ATATAAATTGACAGTGGTGAAGATGATGAAAGATGATGAAGGAGAATATGTATTTTATGCTGGAGAGAAG
AAAACATCTGGAAAGCTTATAGTAGCAGGTGGTGCCATTTCAAAGCCTCTTACTGACCTGACTGTGGCTG
AGTCCCAGCCAGCTGTTTTTGAATGTCAGGTGGCAAATCCTGAATCAGATGGCCAGTGGCTGAAAAATGG
TAGACCATTACCTATGACAGATCAGTACCGTGCTGAATCTGATGGTGTAAAGAGAAGGCTCAATATCCCT
GCCACAAAACTGGATGATATGGGTGAATACAGCTATGAAATAGCAAGCTCAAAGACATCTGCCAAACTGA
AGGTTGAAGCTGTTAAGATAAAGAAGACACTAAAAAATTTGACTGTGACAGAAACACAGGAGGCAGTTTT
CAGTGTAGAACTGACCCACCCTGATGTGAAAGGAGCTCTGTGGATTAAAAATGGTGTTGAACTTGAATCA
AATGACAAATATGAAATTTCAGTGAAAGGAACTGTTCACACACTGAAAATCAAACACTGTGTTGTCACTG
ATGAGTCTGTTTATAGCTTCAAGCTTGGAAAGATAGGAGCAAATGCCAGACTTCATGTGGAAACTGTCAA
GATCATCAAAAAGCCAAAGGATGTGACTGCTTTGGAAAACGCTGTCGTCTCCTTTGAACTGAGTGTATCC
CATGACACTGTACCAGTCCGATGGTTCCACAAAAATGTTGAGCTTAAACAAAGTGATAAATACAAGATGA
TCTCTCAAAGGAAGGTTCACAAGCTTATGCTGCATAACATATCTCCTGCTGATGCTGGGGAATACACAGC
TCTTGTTGGGCAAATTGAGTGTAAAGCAAAACTGTTTGTGGAAACCATACACATCACAAAGACCATGAAA
AATATTGAGATCCCTGAGACCAAAACTGCCTCTTTTCAATGTGAAGTTTCTCATTTCAATGTGCCTGCTG
TCTGGTTGAAAAATGGTGTGGAGATTGAAATGAGTGAAAAGTTCAAAATAGTGGTCCAGGGGAAACTTCA
TCAGCTCAATATCATGAACACAAGCAGTGAAGATTCTGCAGAATACACGTTTGTCTGTGGAAATGACAGA
GTCAGTGCAACTCTGACAGTAAAACCCATTCTAATAACCTCCATGCTAAAAGACATCAATGCTGAAGAGA
AAGATACAATAACATTTGAAGTTACTGTTAACTATGAAGGTATCTCATATAAATGGCTAAAGAATGGGGT
AGAAATAAAATCGACTGATAAATGCCAGATACGAACAAAGAAGCTCACACACTCCCTCTCCATAAGGAAT
GTGCATTTTGGTGATGCTGCAGAATACACTTTTGTTGCTGGAAAAGCAGCTTCATCAGCCACTTTGTATG
TGGAAGCTCGTCACATTGAATTTAGGAAGCATATTAAAGACATCAAGGTTGTGGAGAAGAAAAGAGCTAT
TTTTGAATGTGAAATTTCAGAACCTGACGTTCAGGTCCAGTGGATGAAGGATGGGCAAGAACTCCAGATT
GGTGACAGGATGAAAATTCAGAGAGAGAAATATGTCCATCGTCTCATCATTCCTTCTACAAGAATGTCTG
ATGCTGGTCAGTACACTGTAGTAGCAGGTGGAAACACATCCAGTGCCAATTTGATTGTGGAAGGTCGTGA
CATTCGTATCAGAAGCATCCGTAAAGATATTCAGGTCATTCAGAGACAAAGAGCTGAAATTGAATTTGAA
GTCAATGAAGACGACATTGAACCACAGTGGTACAAGGACGGTATTGAGATCAACTTCCAATATGAGGAAA
GATACAGTTATGTGGTGGAAAGGAGAGTTCATCGAATGACCATCTTTGAAACCACTTACTCTGATGCTGG
AGAATATACTTTTGTTGCAGGACGGAATAGGAGTTCTGTTGTTCTCTATGTGAATGCTCCAGAGCCACCC
CAGATTATTCAGGAGCTAGAGCCAACCACTGTGGAGTCTGGCAAACCTGCCCGCTTCTGTGCTATGATAT
CAGGCAAACCCCAGCCCAAAATTTCCTGGTACAAAGATGATCAACAGCTTTCTCCAGGTTTCAAGTGCAA
ATTTCTTCATGATGCACAAGAATATACTCTATTGCTGATTGAAACTTTCCCTGAAGATGCAGCAGTGTAT
ACCTGTGAAGCAAAAAATGACTACGGAGTTGCTACAACTTCAGCTTCACTTTCAGTGGAAATCCCAGAAG
TTGTTTCTCCTGAGCTAGAAGTGCCAGTGTATCCACCTGCTGTCATAATGCCGCTACGTGATGCTGTTAC
ATCCGAGGGACAGTCTGCTCGTTTTCAGTGCAGAGTTACAGGGACAGATCTGAAAGTCTCTTGGTACAGC
AAAGAGAGAGAGATCAAGCCATCGCGGTTTTTTAGAATGACTCAGTTTGAAGACACTTACCAGCTGGAGA
TTGCTGAAGCTTATCCAGAGGATGAAGGAATCTATACCTTTGTGGCTAGTAATTCTGTAGGCCAAGTGAC
AAGCACTGCTACCTTGAAGTTAGAAGCTCCTGAAAAAATTATTCATGAGAAGCTAGAGGAAGAGATTGAA
ATGGAAATGAAAGACATCACTAGCTCTCTTATTGTGTCTTCTGAGGAAGGAAGAAGTGAAGGCTACAGCA
GCAGCCTTCAGCTGCCTGATAGAGAGAAAACACTTGAACTTGAGCCTGAAAAACCAGTTTATTCCAGCAA
AGCAAAGATGAAAATGGAGGAAGGGGGCAAAGCCCCTGTCTTCCTCAAAGAGGTCTCAAATGTTGAAGTC
TGGCAGGGAGATGTAGCTAGGCTCTCTGTTACTGTTACTGGCAGCCCCACACCCAAAATCCAGTGGTTTT
TCAATGGTATGAAGCTAACCTCATCCATGGACTGTAAGTTAGTGTTTGCTGGCAATGACCACAGCCTCAT
CCTCCCATATGTGGGTGTGCAGCATGAGGGTGAGTACATGTGCACGGCCAGCAACGCACACGGTGAGACC
ACATGTAGCGCCCACCTCCATGTGCAGCAGCGGATAGCAGGGGTACCTTGTTTTTCCAGGGAGCCAGACA
GTGTGCGGTGTGCACCGGGCTTCACCGCAATCTTTGAGTATTCTGTGTCTGGGGAGCCATGCCCCAATGT
GCAGTGGTTCAAGGGGAGTGAGCAGCTCTTCCCTGATGCACGTCATTCTGTTGCTCACCGCCCTGATGGC
TCAGGCTCACTGACCGTGTGGGAGTGCATGGAAGAGGACACTGGGCTCTACACGTGCAGGGCAGCGAGTG
CCCTGGGTGAGGCCACATGCTCTGCTGAACTCCTTGTGCTGCCTGAGGAGCATGCTGTGTGCAGGCAGAG
CCCGGCCTTGCAGCACTCTGCGGTGGCAGAGGACCAAAGTCCACTCTCCTACGAGGAGGCTGGCGAACTT
CCTGCCATGGATGGAGCGCTCAGCCTTGAGGCCACGAGGGAGCCCCCAACCCTCCTTCAGCTCCAGATGA
GCCAGGCAGAGCATGTGCTACCCAGGGAAGACATCTTGCCTGGCCTGCCACCGGCCTGCCTGGCTGCACA
GAATGTTGAAGAGATGCTCGCCCAGGTGGCCACAACACAAGAGAGCAGCAGACTTCTGGCAGAGCCACTG
CAAACTCTCCCTGCTGGCCCCCAGGGTGTTGTGCCTGCAGCAGCTATGGAGACACAGCTGCCAGGCTGCC
TTGGGACTGTAGCTGCACAGATACTCTTGCCCAAAGAGCAAGTCATTCCCAAGACGACAGAGCAAATGGC
TGCTCTGAAGAAGGAGGCTTCCCAAGCTGTTCTACAGGTATCAAGCACCACTGAGAGCTGTGCCATAGAT
GGTGACTGCATCCAGGTCCTTGAGGTCTTTCAGGCAACGCAAGGTGAGCTGAAGGCTGAACCCAGATTTC
CCTCTGAACTGCCCTTCACTGGGGGCCAAGCTGTCCCCCTGGAGAACATTTCTTCCCTGGAAGCAGCAGA
GGAAGATTTTGCTGCAAGAATCCATGAGGGACAGACTGTGAGATTTCCCTTGCTGCTAGAAGAAAACCAG
CCCCTGGAAGAGGAACATGTTGTCAGTCTTGCCAGCCCACTTAGGAAGCATCTAAGGGCAGGGAGGCAAC
CCCGTGAAACAATGTACACTCACCAGCTCCAGCCAAGCCAAGTCCTCAGCAAAGAGAGCCAGCTCACTGC
TCAGCTTCCCAAGAGCTGTAACTTAGACATAAAGTCTCAAATTAGAAATGCACTGAAAGCTGCAGTTGTA
AGTGAGCAAAACCTCCTGTTTTCAGAATGGTTGGCTGATAAAGAAAACATTGAAGTACCGACAATAAACA
TCACCAAGGAACATAAACGCACCCTATGCACCTACGTTGTGACCACAGGAGGACTCAGTGCCATAGAAAT
CCCAGTCTCCTTGGGAGAAATCAGCATTCAGACAGCTGATGAGAAAACGGTCTTGAAGGAGGTTTTCTGT
TCTCTTATTTGTGAAGAAAAACATCTCCTGACAGATGAAAAATCCAAAGCATTGCCAGTCCATCCTAGTC
TGCTTCTCTCAGGAAAATCCTGTGATGAAACCTCTGAGCTGGAGCCCCAGCAGGCTGAGAAGACTATAGA
GGCAGCAATACCCCTGGAGAAGCCTTTGTCTGCACAAGTAATCAACACTGTGACTGGGCATAGTCAAATC
AAGGATGTGGGTGCAGCTGCAGCCACTGCTGATGTAGCTTCCGCAGGTGTTCCCACTGAGACACTCACAG
AAACACTGAAAAGGAAAGAGAAAAGGGAAGAAATATGTGAGGAAGAGGGCAGAGAGGGTCTGGAAACTAG
AGTTGGAAAGCTAGAGGATAAGCTGGACAAAGAGACTTATCCCATTATATGCAGTAAACTGGTCGACACT
GTTGTGGAGGAAGGGGAGAGTGTCAATCTGGTGGCTGTCATAACAGATGTCAGAGAGGTGAACTGGTACT
TTGAGGGTAAACTGGTGTCTTCAGGCGACAAATTCAAGTGTTTGCAAGATCAGGACACGTACACACTAGT
AATAAGCAAAGTGTGTGGGGAGATTCACCAAGGAGAGTACACCTGTGAGGCGCAGAATCAAAGTGGAAAA
AGAGCAACAGCAGCAAAACTCACAGTTGTTAAAAGAGTTGCACCGATCCTGAGGAGGCGGCTTGAATCTC
TGGAGGTGGCTGTAAATCATGTGGCCAAGTTTACCTGTGAGGTAGAGACTGCTCCCAATGTCAAGTTCCA
GTGGTACAAAGCTGGCCGAGAGATATATGATGGGGACAAATACTCCATTCGCACCTCTAACTACCTCTCC
ACGCTGGAGATCCCGAGGCCTCAGGTTGTTGACTATGGAGAATATAGCTGTAAGGCTTCCAACCAGCATG
GCAGTGTAAGCTCTACAGCCCTTTTAACAGTAACTGAAGCACTTCCGCCAACGTTTCTTACCAGACCTGA
ATCTATCACTACTTTTGTGGGCAAAAGTGCCAAGTTCCTGTGTACTGTTTCGGGCACTCCAGTCATCGAC
ATCGTCTGGCAGAAAGATGGCACAACTATTTCACCTTCAGACCACCACAAGATCTCCAAAGTAGAAAATA
AACATGTGTTAGAAATTTCCCTTCTCACCACCAGTGACAGAGGGGTTTACACTTGCAAAGCTTCTAACAA
GTTTGGGGCTGACATTTGCCAGGCTGAAATGGTCATTATAGACAAGCCACACTTCATTAAGGTTTTACAG
TCAGTGCACTCAGCAGTCAATAAAAAAATACGTCTCGAATGTCAGGTAGATGAGGACAGGAAAGTAACAG
TAGGGTGGACAAAGGATGGAAACAAAATCCCTCCAGGCAAAGATTATAAGATTTACTTTGAAGACAAAAT
AGCCTCACTTGAGATTCCTCTGGCTAAGCTCAAAGATTCCGGCCATTATGTGTGCACTGCCTCAAATGAG
GCGGGAAGCAGCTCCTCTTCTGCCAGCGTCACAGTCAGAGAACCACCATCCTTTGTGAAGAAGGTCGATC
CATCTTATTTACTGACCCCAGGTGACTCTGCACGCCTTCAATGCAAAATCAAAGGGTCTCCTGAAATCCA
GGTTACTTGGTTCAAGAACAATAAGGAAATCCGTGAAAGCAACACACACAGGATGTCCTTTGTCAATTCT
GTGGCTGTGTTAGATATTTTGGAGATGAAAGTTGATGACAGTGGGAGCTACTCATGTGAAGCTATAAACG
AGGTTGGAAGTGACAGCTGCACCACCGAAGTAGTTGTTAAAGAGCCTCCGTCTTTCATCCGAACACTTGA
ACCAGCAGAGGTAGTCAAGGGAACAAACACCATTCTTCAGTGTGAGGTTGCTGGCACTGGACCGTTTGAG
ATTAGCTGGTACAAAGACAAGAAACAGATTCGCAGTAGTAAAAAATACAGGTTGACCTCTCAGAAAGCTG
TTATTTCTCTGGAGGTGTCTTCATTTAATAGTGCGGATGTCGGTGAATACGAGTGCGTTGTAGCTAATGA
AGTTGGGAAGTGCATATGCAGTGCAACGTACATCTTGAAAGAACCACCATCTTTTGTTAAGAAAATCGAA
AATGTGACAGCTCTGGCTGGGGATAGTATTACATTACAGGCTGTGGTGAAAGGGTCAGAGCCTATTTCTG
TGATGTGGATGAAGGGCAAAGACATTATTCAAGATGATAACAAAGTGAGAGTGACATTTGAACATGGTCT
AGCAACGCTGCAGATTACTGGTGTCCAGCTGAGCTCTGGTGGCAAATATACTTGCGTGGCTGAGAATGAT
GCAGGAAGTCAGTCCTGCTTTGGTGAACTAGTAGTGAAAGAACCTGCCAAAATCATTGAAAAATCCGAAA
TGATCCAGGTAACAGCAGGGGAACCAGCAATTTTGGAGTACACTGTCACAGGCACTCCAGAGCTAAAAAC
CAAATGGTTCAAAGATGGAAGGCCGCTACCTGCCAGCAAAAAATATAGGATCAGCTTTAAAAATAACATT
GCCCAGCTCAAGTTTTATGCCACTGAAATGCAGGACAGTGGCGAGTACACCTTTGAGATATCCAATGATG
TGGGCATCAGCTCTTGTACTACCAGCTTCACTGTGCTAGATCGCACTCTCCCTCCTTTCTTTACTAAACC
ACTGAAGAATATCGACAGCATCATTAACACCTCATGCCGCCTAGACTGCAAAATTTCAGGCTCTCTTCCA
ATGACCGTCTCTTGGTTTAAGCAGGACACTGAGATCACTTCAAGTGCCAAGTACACAGTACACTTTGCAG
AAGGCTCTGCGTCTTTGGAAATAAAACACCTAGATGCAAGTGACGCTGGGGTCTACATTTGCAGAGCCAC
AAACTCTGCTGGTAGCAAAGACAGCAGTAGCACTTTGTTTATAAAAGAGCCACCCAGTTTCACTGTAGAA
CCAGAGTCCCAAGATGTACTGCCTGCATCAACTGTACGTTTCAAAGGCACATTTAAAGGCACAACACCAC
TGACGGTGAAATGGTTTAAAGGTGATACTGAGCTGGTGACAGGAGGAGCCTGCTACATTATGACAGAAGC
ATTAGCAAGTTACTTGGAGCTTTACGCGGTCAAACCAACAGACTCAGGAAAATACACCTGCAAAGTCTCC
AATGTAGCTGGTTCAGTAACATGCAGTGCAAACTTGTTTGTAAAAGAACCTGCTGCCTTCAAGGAGAAGC
TAGAGCCAACCCATCTGGTAAAGAAAGGTGGATATGCTGAGCTGACCTGTGAAGTCACTGGTACTCCTGA
GATTAAAATCACGTGGTTCAAGGGTGATAGAGAGCTAAAGGAGAGTGACAAATACAGGATGTCTTTTGCA
AAATCCTTGGCAATACTCCGTCTTACAGAGGTCGAGACTGAAGACAGTGGGGAATATGTTTGCGAGGCCA
AAAATGATGCTGGAAAAGATATTTGCAGTAGCATTGTTACAATCAAAGAATCACCTTATTTTAGCAAGGA
GTTTCAATCCATGGAAGTCTTGAAGGATTCTGATGTGGTTTTGGAGTGTGAGGTGCTTGGCACACCTCCC
TTTGAAGTGTTTTGGGTGAAAGATGATAAACCCGTGCGGAGCAGTAAGAAGCACAGAATAAGCATTGAGA
AATCTTTGATTAGCCTCCACATTTTCAGGTTTGATGCATCTGATGTTGGCGAGTATCAATGTAGAGTAAC
AAACGATGTTGGGAGCTGCCTCTGCAGTTCGGAGGTCACACTGAAAGAGCCCCCACAGTTCTTGAAGAGG
ATAGAAAACATTAGTTCCCTTCGAGGGGGCACGGTTGTGTTTCAGGCTGCTATTAAAGGCTCCTTGCCCA
TCACTGTGTCCTGGCTGAAAGACAATGATGAAGTGATTGAAGACAACAATATCAAAATGACCTTTGTGAA
CAATATTGCCACTCTTCTGGTGAGATCTATTGAACTGAAACATGATGGGAAATATTTCTGTCAGGCTAAA
AATGAGGCGGGAATTCAGAGGTGTTCTGCTCTGCTGACTGTCAAAGAACCTGCTACAATCGTGGACAAGG
CTGTGTCAATAGATGTGACTGAGGGAGATCCAGCAACCTTGCAGTGTAAATTTTCAGGAACGAAAGATAT
TACAGCCAAATGGTTCAAAGACGGCAAGGAACTGACGTTAGGCCCAAAATATAAGATCAGTGTTACAGAC
ACTGTCTCAGTCCTAAAGGTCCTTCATACAGAAAAGAAAGATAGTGGGGAATACATTTTTGAGGTTCACA
ATGATGTTGGGAGCAGTAGCTGTTCTGCCAGCATTAACGTCCTAGATCTCATTATACCACCTAAATTCAC
CAAAAAGCTCAAGAAAATGGACAGCATTAAAGGGTCTTTTGTCCACCTGGAGTGCATAGTGTCTGGTTCA
CATCCTATAAGTATCCAGTGGTACAAGGATGGCCAAGAAATAACAGCAAGTGAAAAGCACAAATACTCTT
TCCATGATAATACTGCATTTCTAGAAATCAATAAACTGGAAGGCACAGACAGCGGCTCTTACACCTGTGA
AGCAACAAATAAAGCAGGAAGCAACCAATGCAGTGGATTCTTAACAGTCAAAGAACCACCATATTTTGTG
GAAAAACCCCAGTCCCAAGAGGTTGTGCCCAATGCTAGGGTTCAATTCAAAGCACTGGTGAAAGGCTCCA
CTCCTCTGCAGATCAAGTGGTTTAAAGACAGCCAGGAGCTCCTCTCTGGAGCCAATCGATCTGTCTGGAA
GGATGATACATCTAGTGTACTGGAGCTCTTCTCAGCTAGGACATCTGACTCCGGGAACTACACTTGTCAG
ATAAGCAATGATGTGGGGACTGCAACTTGTAAAGCAGCTCTGTTTGTAAAAGAACCCCCCAGATTTATTC
AGATGCCAACTTCTGTAATAGCTTTGCGTGAAGGGCAGTCCACCACTTTCGAGTGCCAGGTAGTAGGCAC
ACCAGAGATCCGCGTCACATGGTACCTGGATGGGAACGAAGTGACTGACCAAGCTAAGTACAGCATCTCC
TTCATAGACGGTTTAGCCACTTTGAAAGTCACTCAAGCCAGAGTGTCAGATAGTGGGATTTATGTTTGTG
AAGCCCACAATGACGCAGGTAGTGAGAGCTGCAGCGTCGAGCTGAAAGTAAAAGAGCCTCCAACATTTGT
TCGGGAGTTGAGACCCACCGAGGTAGTGAAGGGTTTGGAGGCCACACTCGAGTGTGAGGTAACTGGTACT
CCTCCATACGAGGTAAAGTGGCTGAAGAACAATAAGGAGATGTTCAGCAGCAAGAAATATGCCATGTCCA
CCAAAGAATCAGTATTTACTCTTAATGTGACTAACTGTGATGTCTCAGATGTTGGCGAATATCAGTGTAT
TATATCAAATGAAGGTGGGAGCTGTTCTTGCAGCACAAGGCTCAGCTTGAAAGAACCGCCATCCTTTGTC
AAGAAGCTGGAGAACGTCACTAGCATTTTGAAAGGTACTGCATTCTTCCAGTGCGTTGTAGCAGGTGCTC
AACCCTTATCTGTATCATGGATAAAAGATGAGAAAATACTAGAAGATGATGAGCACCACCATATTACCTT
CGAGAACAGCGTGGCCACGCTGAAACTTACCAATGTTGACCTCAGCCACAGAGGAAGATACACCTGCCAG
GCAAAGAACGAGTCTGGCGTGGAGAAGTGTTTTGCTTTGCTTTTTGTACAAGAGCCTGCACGGATCATAG
AAAAGGCTAAATCACTTAAAGTCACTGAAAGAGACCCCGTGACTTTGGAGTGTACTGTGGCTGGGACACC
AGAGCTCCGAATCAGATGGTACAAAGATGGCAAACAGCTCCTGCCCAGTAGATACTATACAATGAGCTTT
GAAAACAATGTGGCCAGTTTCAGGATTGAACCTGTCTCAAAGGAGGACGGTGGTACATACAGTTTTAAGG
TTGAAAATGACTTTGGAAGTAGCACCTGTGAAGCTGTTCTGACTGTGCTAGATCAATCAATTCCTCCTGC
ATTTATCAAAAAGCTAACCAAAAAGGATACCGTTCTGGGATCTTCTATCCAAATGGAGTGCAAAGTTTCT
GGGTCACTCCCCATTACTGCAAAATGGTTTAAGGATGGAAAAGAGATAACTGACAGTGCAAAATATAGAA
GCCTGTGCCATGAGAATACTGTGTCACTCGAGATCGCTAATCTAGAGCTGGCAGACAGTGCAAATTACAC
ATGCAGCGTCTCTAATGTTGCCGGGAACGATTCTTGCAGCGCTGTCCTGACTGTGAAAGAGCCACCAAGC
TTCTTAGTAAAACCTGAAAGCCAGCAAGCCATACCAGATTCCACAGTGGAGTTTAAGGCCACACTAAAAG
GAACACCACCCTTTGCAGTAAAGTGGTTCAAAGAAGATTTAGAACTTGTATCTGGTCCAACTTGTTTCAT
TGGGATTGAAGGGTCGACTGGGTTCTTAATCCTCTATTCAGTGGATACTTCTAGGAGTGGGCACTACACT
TGCCACGTTTCAAATGACGTTGGCAGTGACTCTTGCACTACAACGTTGATGGTAACAGAACCACCCAAGT
TTGCCAAGAAGCTAGAGGCGGCAAAAGTAGTCAAGCAGGGTGACTCAGCCCGGCTTGAGTGCAAAGTAAG
TGGATCTCCAGAGATGAAAGTAGTCTGGTTCAGGAATGACCATGAAATTGTTGCCAGTGAAAAATTCCGG
ACATCATTCATTGACTCTGTGGCCGTGCTTGAAATGAATCATCTCAGTACTGATGAAAGCGGTGACTACA
TCTGTGAAGCTCACAACCCTGCCGGCAAGGCCAGCTGTAGCACCAAAGTCACAGTGAAAGAACCTCCTGT
CTTTAGCAGGAAGCCCTCTCCAGTAGACATGCTCAAAGGAACTGAGGTTAGCCTGGAATGTGAGATTTCG
GGAACGCCACCATTTGATGTCACCTGGTACAAAGACAGGAGACAAATCCGCAGTAGTAAGAAGTATAAGG
TTACAGCCAAAAATTACCATACAAGTGTTCGCATTCTTAATGTTGAGGCTGCAGATGTTGGTGAATATCA
GTGCAAAGCACAGAACGACGTAGGAAGTGACACTTGTTTTTGCACCGTGAAGCTCAAAGAACCACCAAAA
TTCTTGACTAAAATAAACAGCATGACTGTTGTGGTTGGTGAACCAGTAGAGTTACAAGCAAGAGTGGAGG
GCTCCCAGCCGATTTCTGTGCAGTGGCTTAAAGACAAAGAGGAAATTATTAGAGAAAGTGAAAACACAAA
GATCACATTTATGGAAAATATTGCAACTTTACAATTTGTGCGCACAGAGACAAGCAATGCTGGAAAATAC
ATCTGTCAGATCAGAAATGATGCTGGAAGTCGCGAGTGCATGGCTACCTTAACTATTCTAGAGCCTGCAG
TCATTATAGAGAAAGCAGAGCCAATGAGAGTTACTATAGGAGACGCCTGTACTTTGGAGTGCAAAGTGGC
AGGCACACCAGAGCTTTCCACTGGCTGGTTCAAGGATGGCAAAGAGCTGATCAGCAGCCAAAAATACAGA
ATTACATTCCTCAATAAAGTGTCTACACTTAAAATTATGGATGCTGAAAAGGAAGATGCTGGATTATACA
CTTTTGCAGTGCAGAACGATGTGGGGAAAAGCAGTTGCACAGCATCTGTTGATGTTTTAGATCGAATCAT
TCCTCCTTCTTTCACAAGAAAACTAAAGGAAACCCCTTGTGTCCTGGGTTCCTCAGCATTGCTGGAATGC
AAAGTGTCAGGTTCACCTCCTATTTCCATTGCCTGGTTCCAAAATGGACTTAAATTAGTCAGTGGGGAAA
AACATCAAATCTCCTTTTCAGATAACCTATGTATTTTAGAAGTGAATTCACTGAGTAACTCAGATACTGG
AACCTACACCTGCAAAGCTACCAACGTAGCTGGTTCAGATGAATGCAGTGCTGTGTTAACTGTACAAGAA
CCACCGTCTTTTGAGAGGACACCAGAGCCTCTGGATATCTTGCCAGGCACAAGCATCACTCTTACATGTG
TTATCAGAGGAACCCCTCCTTTTAAGGTGAACTGGTTTAGAGGGGCCAATGAGCTTGTGCCAGGGGACAA
ATGCAATATCTACTTGGAGGATTCCATTGTGGAGCTTGAGTTGTTTGATGTAACTCCTCTCCAAAGTGGA
GAGTACACTTGTCTAGTGACTAATGATGCTGGCAGGGCAAATTGTACAACACATCTTACAGTAAAAGAGC
CGGCTGTCTTTGTGAAGAAACTGAGCGATCAGTATGTGGAGCCTGGCAAGCCCATCATCCTGGAAGGCAC
TTACACAGGCAGCCTGCCCATCTCTGTGACGTGGAAGAAGAATGGCCACACCATCACTCAATCTCAGAAG
TGCAGCATCACCACCACAGAGAAATCCTGCATCCTGGAAATACTTGACAGCACCAAAGAAGATGCAGGAG
AATACACTTGCCATGTTGAAAATGAGGCAGGGAGAGATGTTTGTGAGGCTGTAGTCTCTACCCTAGAGCC
TCCCTATTTTGTTACACACTTGGAACCTCTTGAGGTCTCAGTTGGGGATTACACAACGTTGCAATGCTGC
GTTGCTGGAACACCAGAGATCACCGTGTCTTGGTATAAAGGTGACACAAAACTCAGGTCTACTCCTGAAT
ACAAAGTGTTCTTTAAAGACAACGTTGCTACACTTATTTTCAACAAAGTGGTTAGCAACGACAGTGGAGA
ATATACCTGCAAGGCAGAAAACAGCGTAGGAACTGCATCTACAAAGGCTGTCTTAACAGTTCAAGAGCGC
AAACGTCCACCTTCCTTTGCAAGAAAATTAAAGGACATCGAGCACCCTGTTGGTTTGCCTCTTAAATTTA
TGTGTCGGCTCAATGGCTCAGAACCCATTACTGTGACTTGGCATAAAGATGGTGTGCTGCTAAGCGATGA
CCACAATGTGCACACATCCTTTGTAGATAATGTTGCAGTGCTGCAACTGGTGCGAACTGAGATGAATCAT
ACTGGGCAGTACTCCTGCACAGCCACCAATGCTGTGGGCACTGCCACCTCAAGTGCTAGGCTCACAGTGG
CAGAACCCAAGCAAGCACCTGTCTTTGACACCAAACCAGAATCTATTGATGTGCCTTTTGGAGAAAGTGC
TGACTTTGAATGCCACGTTACTGGAGCTCAGCCAATACACATCACCTGGTCCAAGGATGGTCGGGAGATC
CGAACTGGAGGAAACTTCAATATCACATTTGTAGCCAATACAGCTCACCTTCGAGTGCTCAGAGTGGGTA
AAGGAGACTCTGGCCAATATACTTGCCAAGCTAGTAATGAAGCTGGGAAAGACTTTTGCTCAGCCCAACT
CAGTGTAAAAGAACCTCCCAAGTTCATCAAGAAGCCTGAAGCTTTGCGGTTCATCAAGCAGGGGGACACA
GTTCAACTTGAATGTAAAATCAGTGGCACACCAGAGATCAGAACCACGTGGTACAAAAATGACCAGGCAC
TCCAGGCGAGCAACAGGCTCCACATGTCCTTTGTAGACTCCGTGGCGATGTTAACCATCCTGAGTGCTAA
CACTGAAGATGCTGGCGATTACATATGTGAAGCCCAAAACTCTGCCGGCACAGCCAGCTGCAGCACTTCA
GTTGCAGTGAAAGAACCACCTGTTTTTAGCAAGGTGCCAAGCCCTGTGGACACGCTTAAAGGCTCAGATG
TTATCCTCCAGTGTGAGATAGCAGGGACTCCACCCTTTGAGGTGGCTTGGTTCAAGGACCGGAGGCAGGT
CAGGAGCAGCAAGAAGTTCAAGGTGACAGCAAAGCACTCCATTGCCAGTCTTCATATTCTCAATCTGGAA
TCTCAAGATACTGGAGAATATCAATGCAAAGCTATGAATGAGGTGGGAAGCGACACTTGCACCTGTCCAG
TGAAATTCAAAGAACCCCCACGCTTTGCCAAGAAGCTGAGTGACACTGCAATCTTCGTCGGGGAGCCAAC
AGCCCTGCAGGCAGTGGTGGAAGGATCCCCACCGATTTCTGTTGTCTGGCTCAAGGACAAGGGTGAAGTT
ATTAGGGAGAGTGAAAATGTCCAAATGTGGTTTATGGACAACATTGCAACTCTTGAGATTGCCAGTGCAG
AGGGAGCTGATGTTGGGAAGTACATCTGCCAGATCAAAAATGATGCTGGCATGCGGGAGTGCTCTGCCTT
TTTACAAGTCCTAGAACCAGCAGTCATCTTAGAGAAGACGGAACCGATCACTGTAATGGCTGGCAATCCT
TTTACCTTGGAGTGCAAAGTAGGAGGAACACCTGAACTTATCCCCAAGTGGTACAAAGATGGCAGAGAAC
TAAGGAGTGACCGCAAATACCAAATTACCTTTTTCAACAATATATCCACTTTGAAAGTCTTTTCTGCAGA
CAGGGGAGACAGGGGCTTGTACACTTTTGAGGTGCACAATGAGGTGGGGGACAGCAGCTGCACTTCTTCA
GTTGATGTTTCAGATCGTCTTGTTCCTCCTTCATTCTCAAGAAAACTAAAGGAAACAAATGGGGTGCTGG
GATCTTCAGTGCTTCTGGAGTGCAAAGTGTCTGGCACTTCCCCCATATCTGTGGCCTGGTTTCAGGATGG
GAATGAGATTGTTAGTGGAGAAAAATATGAAATCTCATTCTTGGATAACGTTTGTGCTTTGAAGCTGAAT
GCCCTGGATGTCACTGATACAGGGCCATATACCTGTGTGGCAGCCAATGTGGCTGGATCTGATGAATGCA
GTGCCTTCTTGACTGTACAAGAACCGCCTTCTTTTGTGAAGATACCTGATCCCCAGGAAGTTTTGCCTGG
ATCAAGTGTAACATTCACCAGCTACATCAAGGGCAGCACTCCCTTCAAAGTGACCTGGTTCCGAGGCATC
AGGGAGCTGGTGCCAGACAGCAACTGCTCCATCTCTCTGGATGAGTCTGTGGCACAGCTGCAGCTGTACA
ATGTGGAGCCAGGCCACAGCGGGGACTATGCCTGTGTGGTCACAAATGATGCTGGCAGTGCCTCATGTAC
AACCCAACTCTTTGTGAAAGAGCCTGCAGTCTTTGTGAAGAAATTAAGTGATTTCAGTGTGGAGCAGGGG
AAGTCCATTGTGCTGGAAAGCAGCTACATAGGCACCCCTCCCATCTCTGTCACCTGGAAAAGAAATGGCA
TGCCTATTGCTCAGTCTCCACGCTGCAGTGTTACAACTACTGACAAATCTGGCATTCTTGAAATCTTCAA
CAGCACCAAGAGCGATGAAGGCGAATACACCTGTGAGGTGGCAAATGAGGCGGGTGGAGATGTTTGCCAC
AGCCTTGTATCTATCTTAGAACCACCCTATTTTGTCACACACCTGGACCGTGTGGATGTGAAGGTTGGCG
AGCCTTTGATCTTAAAATGCCAGATTGGTGGTGCACCGGAAATCAAGGTGTCCTGGTATAAAGATGACAC
CAAACTCAGATCAACACAGGCTTACAAAATGCACTTCAAGAATAATGTGGCAACGCTGGCATTCTCCACC
GTGGAGGATAGTGACATTGGAGAATATGTCTGCAAAGCGGAAAATAGCGTTGGCTTCGCCACCTCCACAG
CTTTGCTTGTTGTTAAAGAACGTCAACTTCCCCCTACATTTGCCAGAAAACTGAAAGATATTCAGGAGGT
GGTTGGTGCCCCAGTGACATTTGATTGCCGCATAAATGGCTCAGAACCTATCCAGGTGTCTTGGTACAAG
GATGGGGTCCTCTTAAGTGACAGTGATAACATGCAATCAGCCTTCTTAAATAATGTTGCGACTCTCCAGA
TCTTGGAAACTACTATGGCTTACTGTGGCCAGTATACTTGCTCAGCCCAAAATGCTCTTGGGACTGCATC
TTCCAGTGCCAAACTTCTCCTCACAGAACACCTACAACCTCCCTTCTTTGACATCAAGCCAGTATCTATT
GATGCGGCGCTAGGGGAAAGTGCAACCTTTAAGTGCCACGTGACTGGCTCGGCCCCCATGAGGATTCATT
GGACCAGGGACAACAGAGAGATCCGCCCAGGCGGCAACTACAAGATGACGCTGGTGGAAAACACAGCCAG
TTTGACAGTCCTAAAAGTCAGTAAAGGGGATGCTGGACTCTACACATGTACTGCCAGCAACAGCGTTGGA
AAGGACGCGTGCGCAGCTCAACTGGCTGTACAAGAACCACCAAGGTTTATTAAGAAACTAGACTCCTCAA
GACTTGTGAAACAGCATGATTCCACTAAGTATGAATGCAAAATAGGTGGATCTCCAGAAATCAAAGTCAC
CTGGTACAAAGGTGAAACCGAGATCCGCCCCAGTGAAAAATACAGAATGTCCTTTGTGGATTCAGTGGCA
GTCATTGAAATGCACAACCTCAGTGTGGAAGACAGCGGTGACTACACTTGTGAAGCTCAGAACCCAGCGG
GTAGTGCAAGCACCAGTACCTCACTGAAAGTAAAAGCACCCCCCATTTTTACCAAGAAGCCCCATCCAGT
CCAGACCTTGAAAGGGTCTGATATTCACCTGGAATGTGAGCTTCAGGGCACTCCCCCATTCCAGATTTCA
TGGTATAAAGACAAACGAGAAATTCGGAGCGGCAAGAAGTATAAGGTCATGTCCGAGAACTACCTGACTA
GTATTCACATTCTCAATGTGGATACTGCAGATGTGGGTGAATATCACTGTAAAGCTGTAAATGATGTGGG
AAGTGACTCCTGTATTGGCTCTGTAACACTAAGAGCACCACCAACCTTTGTGAAGAAGCTGAGTGATCTC
ACTGTCGTGGTTGGGGAGTCGATTGAACTGCAGGCTGCAGTAGAAGGATCACAGCCCATTTCTGTTCTAT
GGTTAAAAGACAAAGGGGAAATCATTAGAGAAAGTGATAATCTTTGGATCTCCTACTCAGAAAACATCGC
AACTCTTCAGATTGGAAATGTGGAGCCAGCCAATGCTGGGAAATACAGTTGTCAGATAAAAAATGATGCT
GGAGTTCAGGAATGCTTTGCCATGCTGAGAGTGCTAGAACCTGCAGTCATTGTAGAGAAGCCAGGTCCAG
TCAAAGTTACAGCTGGAGACTCTTGTACTCTGGAATGCACAGTAGACGGCACACCAGAGCTTACTGCTAG
GTGGTTTAAGGATGGGAATGAACTGTCCACTGACCATAAACATAAAATCAGTTTCTTCAACAAAGTATCT
GGGCTTAAGATCCTCAATGCAGGACTAGAAGACAGTGGAGAATATACTTTTGAGGTGAAAAACAGTGTTG
GTAAAAGCAGCTGCACAGCTTCAGTTCATGTTTCAGATCGTATTATACCTCCTTCTTTCACAAGAAAACT
GAAAGAGACATATGGTCAGCTGGGTTCTTCTGCTGTACTGGAGTGCAAAGTTTATGGGTCGCCACCTATT
CAGGTTTCCTGGTTTCATGATGGACAGGAGATTACCAGTGGAGAAAAGTATCAGGCTACTCTTACAGACA
ATACCTGTTCTCTGAAAGTGAATGGACTTCAGGAATCTGATATGGGAACTTATTTGTGCACAGCTACTAA
TGTAGCTGGGTCTGATGAATGCAGCGCATTTTTGAATGTTAGAGAACCACCGTCTTTTGTGAAGAAGCCT
GAACCACTGAATGTTTTATCTGGGGCAAACATAACCTTTACCAGTATCATAAAAGGCTCCTCTCCATTGG
AAGTTAAATGGTTTAGAGGTAGTGTTGAGCTAGTACCAGGACACAGATGCAATATCACCTTGCAAGATTC
AATTGCAGAACTGGAGCTGTTCGATGTAAATCCACTTCAGAGTGGAGACTACACCTGCCAGGTCTCTAAT
GAGGCAGGGAAGATTTCTTGCACAACACATCTTTTTGTCAAAGAACCAGCCAAATTTGTGAAGAAGGTGA
ACAATTTAAGTGTAGAGAAAGGGAAAAATTTAATCTTGGAATGCACATATACAGGTACTCCACCAATTTC
AGTGACATGGAAGAAAAATGGAGTAAAAATAATGCACTCTGAAAAGTGTAGCATCACCACTACAGAAACA
TCTGCCATACTGGAAATCCCTAGTAGCAAACTGGAAGATCAGGGGCAATATTCTTGTCATATTGAAAATG
ATTCTGGACAAGATAATTGTCATGGTGCTATCACAATACTAGAACCACCTTACTTCATTACACCCTTGGA
GCCGGTGCAGGTGACTGTTGGTGATTCTGCATCCTTACAGTGCCAGGTTGCTGGAACACCAGAAATGATT
GTGTCATGGTACAAGGGCGATACAAAGCTGAGAGGAACTGCTACGGTGAAGATGCACTTTAAGAACCAAG
TTGCCACTCTGGTTTTCAGCCAGGTAGACAGTAGTGACAGTGGGGAGTACATCTGCAAAGTAGAAAACAC
TGTTGGGGAGGCTGCTTCATCATCTTTGCTGACAGTTCAAGAGCGTAAACTTCCTCCTTCTTTTACACGA
AAATTAAGAGATGTTCATGAAACTGTTGGCTTACCAGTTACATTTGATTGCGGCATTGCTGGTTCAGAAC
CTATTGAAGTATCTTGGTTTAAAGACGGTGTACGTGTAAAAGAGGACTACAATGTCCACACATCCTTCGT
AGATAATGTAGCAACTCTCCAGATTTTGAAGACAGATAGGAGGCTTACTGGGCAATATACCTGCACAGCT
ACCAATGCAATTGGGACTGCTTCTTCTAGCGGCAGGCTTGTCCTTACAGAAGGGAAGACTCCTCCGTTCT
TTGACATCCCAATTACACCTGTGGATGGTATTATTGGAGAAAGTGCTGACTTTGAGTGTCATGTTTCTGG
AACACAGCCTATTAGAGTCACTTGGGCAAAAGATAACCAAGAGATTAGAACAGGAAGAAACTATCAGATC
AGTTATGTAGACAACACAGCCCACTTGACCATCTTGAGAGTTGACAGGGGAGATGTTGGAAAGTATACAT
GCTATGCTAGCAATGAAGTTGGAAAGGACTCTTGCACAGCTCAACTGTCTGTTAAAGAACGAAAAACACC
ACCAACTTTTACTAAGAAACTGTCTGAAGCAGTAGAAGAAACAGAAGGGAATGAACTTAGACTTGAGGGC
CGTGTTTCTGGCTCTCAGCCTTTGACTGTTGCTTGGTATAAAAACAATCAGGAAGTTCATTCAAGCCCTC
ATTGTGAAATATCTTTCAAAAACAATACCTTACTTTTGCATATAAGGAGTGTAGAGCAATCAGATGCTGG
TTTATATACCTGTAAAGTGTCCAATGAAGCAGGAAGCGTGTTGTGTACATCTTCTATTGTTATCGGAGAA
CCTAAACAGCCTCCAGTTTTTGACCATCCTCTTCAGCCAGCAGCAGTAGAGGAAGGTGATACCCTACAGC
TCAGCTGCCACGTCCAAGGATCACAGCCAATCCGGATTCAGTGGCTGAAGGCAGGGAGAGAAATAAGAGC
TTCAGACAGATGCAACTTCAGCTTTTCTAATGGAGTAGCTTTTCTGGAACTTGCTGCAGTTACCAAATCC
GATTCAGGAGAATATGTATGCAAAGCGTCAAATGCAGCTGGAACTGATACTTGCAAATCTAAAGTGACAG
TTAAAGAAAAACCAGCAGCTGCACCAGCAGCTAAGAAAGCAGAAGTGGAAGGAAAACTTTATTTTGTGTC
AGAGCCTCAGAGTATCAAAGTCATGGAAAAGACTGTTGCAACGTTTGTTGCAAAAGTTGGAGGAGACCCA
ATTCCAAATGTTAAATGGCTGAAGGGAAAATGGAGGCAACTCAACCAGGGTGGTCGTGTTATAATCCAGC
AGAGAGGAGATGAAGCCAAACTACAAATAAAGGATGCAATCAAAACTGATTCTGGCATGTACAAATGTGT
AGCTTTTAACCAGCATGGTGAAATTGAGAGGAGTGTAAACCTACAAGTTGAAGAAAGGAAGAAAGAAGTT
GTTGAAGGGGATTTCAGGGCAAAACTAAAAAGCACTCCAACAAAAAGGAAGGAAGAAGAGGAAGAGCAAC
CTATTGATATCTTGGAACTTCTCAAAAACGTAGATCCCAAAGAATATGAGAAATATGCTCGCATGTATGG
AATTACAGATTTCCGTGGCCTCCTGCAAGCCTTTGAGTTACTAAAGCAAACGCAAGCAGAAGAAAGCCAT
AGACTGGAAATTGAGCTCACAGAAAAAGCTCGAAGAGAAGATCAGGAGTTTGATGAACTTGTAGCTTTTA
TTCAGCAACGACTCTCACAGACGGAGCCTATTACTCTGATCAAAGACATTGAAAATCAGATGGTTTTAAC
AGATGAGGATGCTGTCTTTGAATGTGAGATTAAAATTAACTACCCAGAAATTAAACTTTCATGGTACAAG
GGAACCCAGAAACTGGACTCCAATGACAAATATGAAATTAGAATTGAAGGCGATCGCCATATACTGAGAA
TCAGGAACTGCCAACTTGAAGATCAGGGAAATTTCAGAATAGTGTGTGGACCACATATTGCCAGTGCCAG
GCTAACTGTGATCGAACCTGCAGTTGAACGGCATCTTCATGACACTACTTTCAAGGAAGGAAAAACTTGC
ACGCTGTCTTGTCAGTTCTCTATCCCAAATGCCAAGTCTCAGTGGTATAGAAATGGGAGACCCATTAAGA
TAGGAGGGCGATATTCAACACAAGTCTCTGACAAAGTACACAAACTCATCATCAAGGATCTTAGAACAGA
AGACCAGGGACAGTATACCTGCAAGCTTGACAATCTAGAAACAACTGCAGATCTGGCCATTGAAGCGGAA
CCAATTCAATTCACAAAGAGCATACAGAACATTGTAGTGAGTGAACACCAGTCTGCAACCTTTGAGTGTG
AGGTGTCTTTTGATGATGCAGTTGTGACATGGTATAAAGGCCCCAATGAACTGAGAGAGAGTCCCAAGTA
CAGCTTCAGAAGTGAAGGTCGTTGTCATTATATGACTATTCACAATGTTACTGCAGAAGATGAAGGTGTA
TATTCTGTAATTGCTCGTCTTGAACCAAGAGGAGAAGCAAGAAGCACTGCAGAGCTCTATCTAGTAACCA
AAGAAATCAAACTGGAGTTGAAGCCACCAGATGTTCCTGATGCCAAGGTTGCTGTTCCACCTCAAAAACC
AGCTGAAGCTGCCCCTATTCCTATTCTTCTGCCTCTTATTCCACCACCAGAGGAGAAAAAGCCAGCAGAA
AAAAAGGTTCCAGTGAAGAAAGTCTCCAAAAAGGTGGTTAAAAAAGTTCCTGAAGAAGTCCCACCACCTA
AAGTTCCTGAGGTGCTGCCAGAGAAGCCCAAAGAGGTCAAAATAACATCCATGGCAAGGAGAGAAGAAAT
TTATGAAGAAAAGAAGGAAATCTATGAAGAGCCCAAAGAAACTTATGAAGAATGGGAAGAAGATTATGGA
GAAGACCATGACTATTATGTCAAGGAAGAAGGCTATGATGAAGGAGAAGAGGAATGGGAAGAAGCTTATG
AGAAAAGAGAAGTGACTTATGAAGAAAAACGAGTCATTCATGAAGAAGAAGTGGTTGAAGTTCCTAAGAG
GCCTGTGCCTGAGCGAAAACCACCAGCAATTACAGCTGAAAAGAAGGAAAAGAAAGAAGTAACAGTTCGT
AAAGTTGTCAAGAAACCTGTTGATGAAAAAGTGGAGATAACCACTCAGAAGGTTGCAGAAGAAAAAGTCA
AACGGGCTGAGGTTACCAAGAGAGTTATACCACCAAAACCTACACCAACGATCATTGAGGAAAAAGTTAT
GAAAAAGGAAGTACCGACAGTAGAAACATGGACTGTTTCAGAAGAAAAGATGTCGGTTTCTGTCCACAGA
GAAGAAGAGTATTCATATGTCACAGAGCCAGCAGAGCATGAGAAAACAGTTGAAGAAAGATTCTTTGAAG
CTGTTTACCCAATTGAAGCACATGAGGAAGTTGAAGAGGAGGAAGAAGAAGAAGTCATTTCTACAGAATT
TGAGATCCCTCGTGTTGAAGTGCCTGAGATACCAAAGAGGCATGTTCCAGAAGAAAGAAAGCCCGTTCCT
GTCCCTAAAAAAGAAGCTCCATCAGTTAAAGTGCCTGAAGTCCCTAAGAAACCTGTTCCAGAAAAGAAAG
TCACTGCTGTTAAAAAGGAGGTGGCTCCCCCAGCAAAAGTTCCTGAAGTGCCTAAAAAACCTGTGCCTGA
AGAAAAAGTGCATGTTCCAGCTCCCAAAGAAGAACCTCCACGTGCCAAAGTGCCAGAGGTGCCTAAGAGA
GCTCCCCCAGAGAAAATTGCTGTTCCAAAAAGAGAGGAAGCTCCACCATCTAAAGTGCCAGAAATACCTA
AGAAACCAGTTCCAGAAGAAAAAATACCACATATTCCTAAAGTAGAAGCTCCACCTGCAAAAGTGCCTGC
AGTTCCTAAGAAACTTATCCCTAAAGAAAAAGTATCTCCTGCTGTTCCTAAAATAGTTGAGGCTCCTCCA
GCTAAAGTGCCTGAAGTGCAGAAGAAAGCCACTTTTGAAGAAAGAGTTCTTATTACAGAAGAAAGAATAT
CTGTTGCTGTTCCAGAGGAAATCCCACTACCTGAAGAACCAACTGTTGAAGAATGGCCTGAAGAAGAAAT
GGAGGAAGTGTCTATTTCTGTTCACAGAGAAGAGATTTCTGAAGTGACTGAAGAAGAGTCTTACTACATA
GAGGAGAGGGTAACTGTTCCTAAAAGAGAGGAAGCCCCACCCACTAAAGTGCCTGCGAAGCATAAGAGAG
TTGTCCCTGAACCAAAAGTTCCAGTTGCTCCTAAGGAAGCTCCAGTTAAAGTTCCTGAAGTTCATAAGAA
AGCAGTTCATAAAGAGAAAGTACCTGTCCCTGTGCCTAAAAAAATGGAGGCTCCACCAGAAAGAGAACCT
GCAGAAGAACGCGTGCCCACTTTTGAGATAGAAGTTGAAGAACCTCCATCAACCAAAGTGACTGAAGTGC
ACAGGAAAATTATCACAGAAGAAAAAGTTGCAGTTTCTAAAAAAGAGGAGGCTCCACCAAAAAGAGCAGT
GCCCAAGAAGCCTGTGCCAGAAGAGAAAGTAACTGTTCCAATTTCACGGAAAGTGGCAGCTCCACCAGCT
AAAGTGCCAGAAGCACCAAAGAAAACTGCCAGAGAAGAAAGAGTATCCATTGCTGTTCCAAAAAGAAAAG
TGTCTCCACCACCAGAAGTACCAACAGAAGAAGAACACTGGGCTATGTCAGAGGAAGTATCCATTTCTCT
TCACACAGAAAAGGAGATTTCATACACAGTGCCTGATATTCCAGAGAGGGCTATCGCTGAAGAAAGAGTA
CCAATTTATCCTCCTAAAAAAATGGCAAGACCACCAGCCAAAGTGCCTGAAGTACGCAAGACAGTTGTTC
GAAAAGAAAAAGTATATGTTGAAGTTCCTCAGTATGAAGAGGAAGTAGAGATTCCAAAATACGAAGAGGA
AGAAGCCACCAGATATGAGAAGGAAGTAATCCATTACAAAGAGGAAGTCCACCATTATGAAGAAGTTAGT
CACTATGAGGAGGAAGCTCCTCAGTATGAAGAAATTCCTCAATATGAAGAAGAAGTCACCACTTATGAAG
AAGAAGCCGCTTATTATGAAGAGGAAGTTCCTGAATATGAGGAGGAAGAGCCAGCAGTTCTCCAGTATGA
AGAGGAGGCTCCCCCACCTGTTAGAGTGCCTGAGGTTCCCAAGAAGCCTGTTCCAGAGGAAAAAATACCT
ATTCTGAAGAAAAAAGAAGCTCCTCCAGCAAAAGTGCCTGAGGTGCCAAAGAAACCCGTACCTGAAAAGA
AAGTCCAAGTGCTGAAGAAGGAAGCTCCCCCGGCTAAAGTTCCAGAAGTGCCGAAGAAACCTGTGCCAGA
AGAGAAGGTTCCTGTTCCTGTACCAAAAAAGAAGGAAGTTCCACCTGCCAAAGTGCCTGAAGTACCAAAG
AAACTGGTGCCAGAAGAGAAGGTACTTGTCCGGGTGCCTAAAAAAGTGGAAGAACCTCCACCAGCCAAAG
TGCCTGAAGTGCCCAAGAAAGTTCCGGAAAAGAAAGTACCTGTCCCTGTACATAAAAAGCCAGAACCTCC
GCCAGCCAAAGTGCCAGAAATACCAAGACCTCCCCCTGAAGAGGTACCTATTTTTGTACCTGAAGAAGAG
GAGGAAGAGGAAGAGGAAGCTGTTCCAGAGATACCAGCGAAAGTGCCAGAAGTGCCCAAGAGAGCTATCC
CAGAAGAAAAAGTACCTGTTGCAGTTCCTAAAGTAAAGAAAATTCCACCAGCTAAAGTGCCTGAGGTGGC
AAAGAAAGCTGTGCCTGAAGAAAAGGTTCCCATTTTTGTTCCTGAGGAAGAAGAGGAGGAAACTATTCCA
GAGGAAATTATACCAGCAAAAGAGCCAGAGATTCCTAAGAAACGTGTCCCAAAAGAAAAAATACTTGTAC
CCACTCCTGAGAAACTGGAGCCTCCTCCAGCAAAAGTGCCTGAGATGCCTAAGAAACCTGTTCCTGAAGA
GAAAGAACCTGTTCCTAAAAAGGTGCCAGCTCCACCAGCCAAAGTACCCAAGGTGCCTAAGAAGGTTGTT
CCTGAAGAGAAGGTACTTGTGGCCCCCCCTGAAAAAGTGGAGGTTCCATCTGCAAAAGTCCCTGAGGTGC
GTAAAAGACCTGTTGCAGAAAAGAAAGTTCCAGCTGTTGTGCCCAAACCCAAAGAACCAACACCAACTAA
AGTGACAGAAGTATCCAAGAAACTTGTCCAGAAAGAAAAAGTCCCTGCTCCTGCTCCAGCTCCTGCTCCT
GCAGCGGAGAAGTATGAGTATACATACGAAGAGTATGAGAAGTACGAGACATATGAAAGTATTGAAGAGT
TTGAGGAGCTTCAGGAAGCTGAAGAAATTGAGGCATATGAGGAACCTGAAGAACCTGAGAGATACAAGGA
GATTCAGGAACAGGAATATGAAGAGGAGGCTGAGGAGAAAGATGTCTATGAAAAGTATGAGTTCAAGGAG
AAGGAAGAGATCTATGAGAAATATGAGGAGGTGTATGAGGAGGCTTACGAAATCCAACCAGCTATAGTGC
CTGAGGTGCCTAGAAGACCTCTGCCAGAAGAAAAAGCACCTGTGCCTGTTCCTAAAAAAGAAGCTCCTCC
AGCTAAAGTGCCAGCAGTACCGAAGAAACCTGTTCCAAAAGAAAAAGTACTACCTGCTGTTCCTAAAAAG
GAAATTGCTCCTCCAGCTAAAGTGCCTGAAGTGCCCAAGATAACTATTCCTGAAGAGAAACCTGTTCCTT
TGCCTAAAAAGCCAGAAGCTCCACCTGCCAAAGTGCCAGAGCTGCCCAAGAAAATTCCAGAAGAGAAAGT
ACCCACTGCTGTGCCTAGAAAACCGGAACCACCACCAGCCAAAGTGCCAGAAGTGCCCAAGAAAGTCCCA
GATGAGAAAATATCCGTTGCAGAGCCTAAAAAACCAGCAGTTCCACCAGCTAAAGTCCCTGAGGTACCAA
AGAAAGTGGTCACAGAAGAGGTTTCAGTTAAAGTACCAAAGAAACCAGAACCCCCACCAACTAAAGTGCC
TGAGGTGCCCAAGAAAGTGATTTCAGAAGAAAAAGTGCATATTGAAGTTCCTAAAAAACCAGAACCTCCA
CCACCTAAAGAACCTGAGGTGCCGAAGAAAGTTGTTCCAGAAAAGAAAATACCTGTGCCTAAAATACCAG
AACCTGAGGTTGTGCCTAAAGAACAAGAACCTGTGGTTGTCCCAGAACCAGAGGCTGCAACTGAAGAACC
AGAACCCCTACCGGAGAAAGTGCCTGAGATGCCTGAGGCAGAGGTCTTGGAAGAGGAAGAGGAGGAGGAA
GCCCCAGAAGAAGTGGCACCAATTGCTGAGCCTGGAGAGCCAGAAGCTCCTCCAGCTGAAGTGCCTGAGG
TGGCCGAGGAGGAAGAGCCAGAAGAGGTGCCAGTGGTCGTTCCCCCAAAGCCTGTGGCTGTACCCAAGAA
ACCTGTGGCTGTGCCTAAGAAACCAGAAGTTCCACAAGCTAAAGTGCTTAAGGTGCCCAAGAAAGCTGTC
CTGCAAGAAAAAACGCCTGTTGCTGTACCCAAAAAACCAGAACTACCACCAGAGAAAGTGCCGGAACCTG
GAAAGAAGATCCCTGAGAAGCGAAAACCACCACCACCACCTCCACCAATTGAAGATATTAAAATGGCAAA
AGAACTACTTAAAGCTCCTGAATCAAGGAAGAAAGTTGTGACTGCAAAACCTGGTGAGCCTCCAAAACTG
GAACCCCCACCTGCTAAAGTGCCTGGACTTGTAAAGAAACCTCGCAGAGTAATTCCCGAAGTTACTCCTT
CACCAAAAGAAGAAGTGGTTTTGAAAAGAGTTCTTAAAAAGAAATCAGAAGAGGAAGAACCTAAACCAGA
AAAAGAACCTAAACCAGAAGTTAAACCAGTACCTACACCAGTAGAAAAAATTAAGAAACCTGAAGTCCCA
GAAGTTCCTAAGAAGAAAATTGAGATACCTGTCATTAAAAAAGAGGAGAAACATGTGCCTGAACCACCAA
AAGAACCTAAGCAAGCAGCTATCCCAGCTCCTGGGCTTGAACCTAAACCTGCAGTAGTTCTAAAATCTCC
AAAACCAGTAGCAGAACCAGCACCCGCTGTTACTACTCCAGTGACAGTCCCAGTGGTTGGAAAGAAAGCA
GAGGCCAAGACACCAAAAGAAGAAACTCCGAAGGGTATCAGTCCAGTCAAAGCCAAGAAGACACCTTCAC
CAGCAGATGCAGAAAGAAGGAAACTCAGGCCAGGCAGTGGTGGTGAAAAACCTCCTGAAGAGCCTCCATT
CACTTACCAACTCAAGGCTGTACCACTGAAGTTTGTCAAGGAGATGAAAGATATAGTGCTAACAGAAGCT
GAATCTGTTGGGTCTTCCGCAATCTTTGAAGTCCTTATTTCACCATCTACTGCAATTACCAGCTGGATGA
AAGATGGAAGTAACATCCGAGAGAGCCCAAAACACAAGTTTATTGCTGATGGCAAAGATAGGAAGCTGCA
TATTATTGATGTCCAGCTGTCAGATGCTGGTGAATATACTTGTGTATTGCGACTGGGAAACAAAGAGAAG
ACCTCTACAGCCAAACTCATTGTTGAAGCACTCCCAGTGCGGTTTGTGAAAACTCTTGAAGAAGAAGTCA
CTGTGGTTAAAAGTCAGCCACTGTACTTGACATGTGAGCTTAACAAAGAAAGAAATGTGATCTGGAGGAA
GGATGGGAAGATCATCAAAGACAAGCCTGGGAAATTTGCTCTGGGCATTATTGGTTTGTCACATTCCCTC
ACGATCATTGATTCAGATGATGCTGATGCTGGCACTTACAGTGTTACCGTGGAAGACACTGAGCTGTCAT
GCTCATCTTGTGTTAAGGTAGTAGAAGTGATAAGAGACTGGTTAGTAAAACCCATAAGAGACCAGCATGT
GAAACCAAAAGGGACAGCTACTTTCACCTGTGATATTGTCAAGGATACACAAAACTTTAAATGGTTTAAA
ATTTTCCTGAAAATCAAGAATGCTGGCCCTGATGATATTGGGGAATATTCAGTGGAGGTTGAAGGTCGCA
GATACCCAGCTAAACTGACCCTTGGTGACCGTGAGGTTGAACTTCTGAAGCCATTAGAGGATGTTACAGT
TTATGAGAAAGAAACAGCAAACTTTGATACAGAAATATCTGAGGATGATATTCCTGGTGAATGGAAGCTG
AAAGGAGAAATCCTGAGACCCTCACCTACATGTGAAATCAAAGCTGAAGGAGGAAAGCGTTTCCTAACCT
TGCATAAAGTCAAGTTAGAGCAAGCTGGTGAAGTCCTTTTCCAGGCACTTAATGCAGTTACTGCAGCTAT
CCTGACAGTGAAAGAAATTGAACTGGACTTTGCTGTGCCCCTAAAAGATGTTACTGTCCCTGAGAGGCGC
CAAGCAAGGTTCGAATGTGTCCTTACCAGAGAAGCCAATGTTATATGGTCTAAGGGCACTGATATAATCA
AGATTGGAGACAAATTTGACATCATTGCAGATGGAAAGAAGCATATTCTTATAATCAATGATTCTCAGTT
TGATGATGAGGGAGAATACACTGCTGAAGTTGATGGCAAGAAGAGCACAGCAAGACTGTTTGTGGAAGGT
GTGAGGTTGAAGTTCATCTCACCTCTTCAGGATCAAACAGTGAAAGAAGGGGAAACAGCTCACTTCCAGT
TTGAGGTTTCTCATGAAGACATGCCAGTGAAATGGTACAAAAATGACAAGAGACTGCACACAAGCAGAAC
GGTTTTTATGACTTCAGAAGGCAAAGTTCATAGACTAGAAATGAGAGAAGTAACACTTGATGATATCTCT
GAAATAAAGGCCGTAGTCAAGGATTTGAACACACAAGCAAACCTCAAAGTCCTAGAGGCCGATCCATATT
TCACTGTGAAATTACAAGACTACAGTGCTGTGGAGAAAGATGATATTATTCTGGAGTGTGAACTTAGCAA
AGATGTGCCAGTAAAATGGTACAAAGATGGTGAAGAATTAGTAGCTTCCAACAGAATTTCCATAAAAACA
GATGGCTTGCGCCGTATCCTGAAGATCAAGAAGGCTGCAGAGAGTGACAAGGGTGTTTATGAGTGTGACT
GTGGAACTGACAAGACAAGTGCTAATGTCAGCGTTGAGCCTCGCTTAATTAAAGTGGAACGCCCACTGTA
TGGAGTGGAAGTATTCGTAGGTGAAACAGCACGTTTTGAAATTGAAATTTCTGAGCCTGATGTCCATCCT
ATATGGAAGCTAAAGGGAGAAACCCTAACACCTTCGCCTGACTGTGAAATCATTGAAGACGGGAAGAAAC
ATGCTCTTGTCCTTCATAACTGCAAACTTGATATGACTGGAGAAGTGTCTTTCCAAGCTGCTAACGCTAA
AAGTGCTGCTAATCTGAAAGTGAAAGAATTGCCTCTCATCTTTATCACTCCACTGAGTGATGTGAAGGTC
TTCGAGAAGGATGAAGCCAAGTTTGAATGTGAGGTGTCCAGAGAACCCAAGACTTTCCGCTGGTTGAAAG
GAACACAAGAGATCACTTCTGATGAAAGATTTGAAGTTATTTCAGATGGAACAAAGCATTCTCTGATTAT
TAAATCTGTTGCATTTGAGGATGAAGCTAAATATATGTTTGAAGCTGAGGATAAGACAACAAGTGCCAAG
CTAATTATTGAAGGTATCCGCCTCAAATTCATTACTCCTCTCAAGGATGTAACCAAAAAGGAGCGAGAAA
CTGCAGTGTTCACTGTGGAACTCTCTCATGAAAATATCCCTGTTGTCTGGTTCAAGAATGACCAACGATT
ACATACCAGCAAAGTGGTTTCAATGACAGACGATGGCAAATTCCATACACTCACAATCAAAGATCTTACT
ATTGATGATACTTCTCAGATTAGAGTGGAAGCTATGGGCAAGTCCTCAGAAGCTAAACTCACTGTTCTTG
AGGGAGACCCTTACTTCACCGGGAAGCTGCAGGATTACACTGCTGTAGAGAAAGATGAAGTAATCTTACA
ATGTGAAATCAGTAAAGCAGATGCACCAGTGAAATGGATGAAGGATGGCAAACCAATTACTCCCTCAAAG
AATGTTGTTATTAAGGCTGATGGCAAAAAGAGAATCCTTATCCTCAAGAAAGCTTTGAAGAAAGACATTG
GACAGTACACTTGTGACTGTGGTACTGATCAAACATCTGCTAAACTCAATATTGAAGACCGGGATATTGA
GATTATACGTCCACTATACAGTGTGGAGGTGATTGAGACAGAGACTGCCCGTTTTGACATTGAAATCTCT
GAGGAAGGTGTCCATGGAAATTGGAAGCTAAAAGGAGAACCCCTGACTGAATCAGCTGAATGTGAAATCA
AGGAGGAAGGCAAAAAGCACTTCCTTACACTGTACAATGTACGCTTAGATCAAGCTGGCGGAGTAGATTT
CCAAGCAGCAAATGCCAAATCTGGTGCTCACCTTCGAGTGAAACCTCGAGTAATTGGCTTGCTGAGACCA
CTCAAGGATGTAACAGTGACAGCTGGGGAATCAGCAACCTTCGATTGTGAACTCTCGTATGAAGGAATCC
CAGTGGAGTGGTTCCTGCAAGGAAAGAAACTGGAGCCCAGTGATAAGGTTATGACACGTGCTGAAGGGAG
AGTTCACACACTTATTCTGAGAGACGTCAAGTTAACGGATGCGGGAGAGGTATCACTGACAGCAAAAGAT
TTCAGAACTCAAGCAAATCTTTTTGTGAAAGAACCCCCAGTTGAATTCACTAAACCACTTGAGGACCAGA
CTGTTGAAGAGGAGGCCACTGCAGTACTGGAATGTGAAGTTTCCAGGGAAAATGCAAAAGTTAAATGGTT
CAAAAATGGAGAAGAAATTCACAAAACGAAGAAGTACGATATCATTTCTGATGGCAGAGTCAGAAAACTC
ATTATCCATGGCTGCACACTGGATGATGCAAAAACATATACCTGTGATGCTAAGGATTTTAAGACATCAT
GTTTTCTCAATGTAGAACCGATTCGTGTTGAGTTCCTGAAACCCCTAACTGACCTTGAAGTTAAAGAAAA
AGAATCTGCTCGGTTTGAATGTGAAATTTCTCGTCCAGGTGTCAAGGTGAAGTGGTTTAAGGATGGCATT
GAAATTAGGAAAGGGAAAAAGTATGACATCATTTCCAAAGGTGCAGAACGCATTCTTGTTGTCAGTAAAT
GTGTCTTTGATGATGAAGCTGAATACGCCTGTGAAGCAAAAACAGCTCGAACTTCAGGCTTACTTACAGT
GATAGAGGAAGAGGCTGTTTTCACAAAAAATCTTCCTGATCTTGAAGTAAATGAAAATGACACTGTAAAA
TTCATCTGTGAAGTTTCAAAGCCTAATGCTGAAGTTGCTTGGTTTAAAGGAGATGAGGAGGTGCCTGATG
GTGGTAGATTTGAACACATTTCTGATGGCCGAAAGAGAATTCTTCTCATACGTAATGCTCATCCTGAAGA
TGCTGGCAAATATACTTGCAAGCTCCCAAGCTCTAGTACCTCAGGAAAACTTACTGTACATGAACTTGCA
GCAGAATTTCTTACCAGACCACAAAATCTTGAGGTGCTTGAAGGAGACAAAGCTGAATTTGTCTGTTCTG
TATCCAAAGAGGCAATTGCAGTACAGTGGCTGAGGGGTGACACAGTCCTGGAGGCTGGTGATAAGTACGA
CATCATTTCAGATGGCAAAAAGAGAACACTTGTGGTTAAAGACTCTATTCTAGGAGACGCGGGAAAGTAT
ACTGTCATGGTTGGTGAAGCTAAAGCTACGGCACGCTTAACAGTGATTGAAAAACTCAGGATTATAACTC
CCCTTAAGGACCAAGAAGTTAATGAGGGTCAAGAAATTATCTTCAACTGTGAAGTCAATAAAGAAGGTGC
CAAAGAGAAGTGGTACAAAAATGATGAGGCAATATTTGATAGTGCAAAATACATTATTGTCCAGAAGGAT
TTAGTCTACACTCTCAGAATCAGAGATGCACAGTTGAAAGATCAAGCAACCTATACCATTTCACTGTCAA
ACCAGAGGCATGAACATGTCAAAAGTTCTGCTGCCTTAACAGTATTAGAGGAGGATCTCAGAATAGTTGA
GCCTCTTGAAGACATTGAGACCATGGAAAAGAAAACTGTCACATTCTGGTGCAAAGTCAACCGCCTTAAT
GCAACCCTCAAATGGACAAAGAATGGTGAAGAGATCACATTCAACAAACGCATTTTGTACAAAATTGATA
AATACAAACACTCACTCATCATTAAAGACTGTGGGTTTATAGATGAAGGTGAATACACTGTTACTGCTGG
ACAAGACAAATCTGTCGCAGAGCTTCTCATCACAGAAGCACCAGCAGACTTCATTGAACATCTCCGGGAC
CAGACCGTCACTGAATTTGATGATGCTGTCTTTACATGCCAGCTTTCCAAAGAGAAAGCCAGTGTAAGAT
GGTACAGAAATGGAAGAGAAATCAAAGAAGGCAAAAAATACCAGTTTGAAAAGGATGGAAATCTGCACAG
ATTAATCATAAAAGACTGTAGACTAGATGATGAGTGTGAATATTCCTGTGGAGTGGATGACAGGAAATCT
AGGGCAAGACTTTTTGTTGAAGAAATCCCTGTTGAGATCATCCGACCACCACAAGATATTTATGAAGCTC
CTGGTGCAGATGTCATTTTCACGGCAGAGCTGAACAAAGATGGTGTGGAGGTCAAGTGGTTGAGAAACAA
CATGATTATTGTCCAAGGTGACAAACATCAGATGATGAGTGAAGGAAAGGTCCACAGGCTGCAGGTGTGT
GAGATAAAGCCACGGGACCAAGGGGAATACAGATTTATTGCCAAAGATAAGGAAGCTAGAGCTAAGCTTG
AATTAGCTGCTGCACCTAGAATCAAGACTGGTGATCAAAACCTTGTGGTTGATGTTGGGAAGCCTTTAAC
TATGACTGTTCCATATGATGCCTACCCAAGAGCAGAAGCTGAATGGTTGAAAGGGGAAGAAAGTCTGCCC
ACAACAACTGTTGATACAACAACTGACTGCACTACCTTCAAAATTTATGAAGCAAAGAAATCAGATAAGG
GAAGGTACAAGGTTATACTTCGAAACAAACATGGCCAGGCAGAAGCATTCATCAATGTAGAGGTCATTGA
TGTTCCGGGTCCAGTTAGAAACTTGGAAGTCACTGAAACTTATGATGGTGAAGTTGGCCTCGCCTGGCAA
GAACCAGAAACTGATGGTGGAAGTAAAATAATAGGCTACGTCATTGAAAGACGTGATATCAAGCGTAAAA
CCTGGATTATGGCCACTGATCGTGCTGAAAACTGTGAATACACTGTTACTGGACTTCAAAAAGGAGGAGT
TGAGTACCTCTTCCGAGTTAGTGCTCGGAACAGAGTGGGCACGGGTGAGCCAGTGGAAACAGAGAGACCT
GTGGAAGCTAGGAGCAAATTTGAAGTTCCTGGTCCTCCTCAAAATGTAGAAGTTACGGATGTGAACAGGT
TTGGAGCTACACTTACCTGGGAACCACCTGAGTATGATGGAGGATCTCCAATTACTGGCTATGTTGTTGA
ACTGCGTAACAGAGCGTCCATCAAATGGGAGCCAACTATGACCACCGGAGCTGATGAACTCTCAGCTGTC
CTGACTGATGTTGTGGAAAATGAAGAATATTTCTTCAGAGTAAGAGCTCAAAACATGGTTGGAGTTGGCA
AACCAAGTCCTGCTACACGTGCAGTAAAAATTATGGACCCAATTGAGAGACCAAGTCCTCCCATTAACCT
TGACCATTCAGATCAAACTAAGTCATCAGTGCAGCTCACATGGGAACCTCCTCTCAAAGATGGAGGAAGT
CCAGTCCTAGGCTATATTGTTGAAAGGCAAGAAGAAGGAACAGACAAGTGGATTCGCTGTAACCCCAAAC
TAGTACCTGCTCTTACTTTTAAGGTAACTGGATTGAAACCAGGATCCAGTTATTACTACAGAGTCTCAGC
AGAAAATGCAGCTGGTGTGTCTGACCCAGCAGAGGCTATTGGGCCATTAACTGCAGATGACACTTTTGTT
GGACCCACAATGGACCTAAGTGCTTTTAAAGATGGGCTGGAAGTTATTGTTCCTGAGCCAATCAAGATCC
GTGTTCCTATCACTGGATACCCTGTACCAACTGCCACATGGTCTTTTGGTGACCAAGTCTTAGAAGAGGG
TGGTCGTGTAACAATGAAGACCACTGCCTCCTTTGCAGAACTTGTAATTACTCCAAGTGAACGTCCAGAC
AAGGGAATTTATTCCTTAACATTAGAAAACCCTGTGTCATCTGTTTCTGGAGAAATTGATGTTAATGTCA
TTGCTCGTCCAAGTGCACCAAGAGAACTTAAAGTTTTAGACATAATTAAGAACACAGTACAGCTATCATG
GGAACCTCCAGAAGATGATGGTGGAAGTCCAGTTACTGGCTATATAATTGAAAAACGTGAAGTAAGCCGG
AAAACATGGAACAAAGTTATGGATCATGTTGTTGACCAAGAGTTCACTGTACCTGACCTCATCCAAGGAA
AAGAATATTTATTTAGAGTTTCTGCATGCAATAAATGTGGCCCAGGAGAACCTGCATATATTGATGAACC
TGTAAATATGTCAGCACCAGCAACGGTGCCCGATCCACCAGAGAATGTTAAATGGAGAAATCCAACATCA
AAAGGAATCTTCCTAACATGGGAGCCTCCCAAATATGATGGTGGTGCCCGCATTAAGGGTTATCTGGTAG
AAAAATCCCAGCGTGGCACAGACAAGTGGGAGATATGTGGGGAGCCCGTTGTTGAAACAAAAATGGAAGT
GACAAAACTCAAGGAAGGAGAGTGGTATTCATATCGGGTTAAGGCTTTGAACAGAATAGGAGCTAGCAAG
CCAAGTAAGCCAACAGATGATATCCAGGCCATTGATGCAAAAGAGGCTCCAGAAATTTTCTTAGATGTGA
AGCTTCTTGCTGGACTTACCGTGAAAGCTGGAACTAAAATTGAGTTGCCAGCTAAAGTAACTGGAAAACC
TGAGCCCCAGATTACTTGGACCAAGGCTGACAAAATTTTGAGACCTGATGACAGAATCACCATTGAAACC
AAACCTAATCATTCTACAGTCACTATTACAGACAGCAAGAGGAGTGACAGTGGAACCTATATTATAGAAG
CTGTAAATTCTAGTGGACGTGCTACTGCTGTTGTTGAAGTTAATGTTCTTGATAAACCTGGCCCGCCAGC
TGCATTTGATGTATCAGAAATCACAAATGAATCCTGCCTTCTGACATGGAATCCTCCACGAGATGATGGG
GGTTCTAAAATTACCAACTATGTCCTTGAGAAAAGAGCTACAGACAGTGAAATATGGCACAAGTTGTCAT
CAACTATTAAGGATACAAATTTCAGAGCCACCAATTTAACTCCTCATAAAGAATATGTGTTCCGAGTCAG
TGCTGAGAACATGTATGGTATTGGGGAGCCAGCACAGTGTAGCCCCATCATTGCAAAATATTCATTTGAT
CCACCAGGCCCTCCAACAGGTCTCAAACCTACAGAGATCACTAAAGATTCAGTCACCTTAACATGGAATG
AACCAGATGAAGATGGTGGCAGCCCCATAACTGGCTACTGGGTTGAAAGATATGATCCTGAGCAAGATAA
ATGGATAAAATGCAATAAAATGCCAGTAAAAGATACAACATTCAAGGTTAAAGGTCTTACAAATAAGAAG
AAATATAAGTTCCGTGTCTTGGCAGAGAATCTTGCAGGACCTGGAAAACCAAGCAAGGAAACAGAACCAA
TCTTAGTGAAAGACCCAATCGATCCACCATGGCCTCCTGGAAAGCCAACTGTGAAAGATGTTGGCAAGAC
ATCGTTATTCCTGAACTGGACAAAGCCAGAACATGATGGAGGGGCAAAGATCGAATCTTATGTCATTGAA
CTATTAAAGACTGGAACAGACGAGTGGGTGAGAGTAGCTGAAGGAGTTCCCACAACTGAACACTTCCTCA
AAGGGCTTATGGAGAAACAAGAATACTCATTCCGTGTAAGAGCTGTGAACAAGGCTGGCGAGAGTGAGCC
CAGTGAACCCAGTGATCCTGTGCTGTGCAAGGAGAGGCTTTATCCTCCTTCACCACCTCGGTGGCTTGAG
GTTATTAATATTACTAAAAACACAGCAGACCTTAAATGGACAGTACCAGAAAAAGATGGTGGTTCCCCAA
TTACCAACTATATTGTTGAAAAGAGAGATGTAAGGCGAAAAGGCTGGCAGACAGTTGATACAACAGTGAA
AGATACCAAGTACACAGTGAGCCCACTGACTGAAGGGTCATTGTATGTGTTCCGCGTGGCTGCAGAAAAT
GCCATTGGACAGAGTGACTATTGTGAAATTGAAGATTCAGTGCTTGCCAAAGATACTTTCACAACCCCTG
GGCCTCCATATGCTCTTACGATAGTTGAAGTGACAAAAGGTCATGTTGATTTGAAATGGGAACCACCTAA
AAATGATGGTGGCAGACCAATTCAAAGATATGTTATTGAAAAGAAAGAAAAACTAGCCACTCGCTGGGTA
AAAGCTGGCAAGACAGCTGGTCCAGACTGCAATTTCAGAGTGACTGATGTCATTGAAGGTACAGATGTAC
AGTTCCAGGTTCGTGCAGAAAATGAAGCTGGCTGTGGTCATCCCAGTGAACCAACAGACCTCATTCATAT
TGAGGATCCAACAAGCCCTCCTTCACCTCCTCAGGATTTACATGTCACAGATGCAGGTCGAAAGCACATT
TGCATTGCATGGAAACCTCCTGAGAAGAACGGTGGAAGCCCTATTATTGGGTATAATGTTGAGATGTGTG
AAGCAGGAACAGAAAAATGGATGAGAATCAATTCTCGTCCAATAAAAGACCTAAAATGTAAAGTGGAGGA
AGGTGTTGTTCCAGACAAGGAATATGTGCTGAGAGTCAGAGCTGTCAATGCTGTTGGAGCTAGTGAGCCA
TCAGACATCTCAGAAAAAGTTGTTGCCAAGGACCCAGACTGTAATCCAACCATTGATCTAAAAACTCGTG
ACATTGTTGTTGTTAAAGGACAGAAATTAAGTATCCCTATACCCTTCAGAGCTGTTCCATCCCCAACTAT
AACATGGCACAAAGATGGCAAAGAGTTGAAAGCTGGTGACAGAACAACAATGAAGAGTGACTACACCTCT
GCATTGCTCGAAGTCATAGACAGTGTTCATGCTGATGCTGGTGTTTATACTATCACATTGGAGAACAAGC
TGGCATCAACAACTGGCTCAGTCAACGTCAAAGTCATAGGTCCACCTGGACAGTGTAAAGACATTAAGGC
AAGCGAAATAACTAAGAATTCTTGCAAAGTATCCTGGGAACCTCCAGACTTTGATGGTGGTACTCCTATT
CTGCATTATGTTCTGGAACGCAGAGAAGCTGGTCGTAGAACATATATCCCAGTCATGTCTGGTGAAAATA
AGCTTTCATGGCAAGTCAAAGATCTTATCCCAAACAGTGAATATTACTTCCGTGTTAAAGCTGTCAATAA
GATTGGAGGAGGTGAATATCTTGAACTAAGAAACCCAATCATTGCAGAAGACCCAAAACAGCCTCCAGAT
CCTCCTGTTGACCTTGAGGTCCATAATCCAACATCAAAATCAGTAACACTTACATGGAAACCACCCCTGT
TTGATGGTGGAAGCAAGATTATGGGTTATATCATAGAAAAGCTTGCTAAGGGCAAGGAGAGGTGGGAGAG
ATGCAATGACTATCTGGTACCTCTATTAACATATCCGGTGAAAGGTCTTGAGGCAGGAAAGGAGTATCAA
TTCCGTGTTCGTGCTGAAAACGCTGCTGGCATCAGTGAGCCTTCTCGGATTACTCCTTTTGTGAAAGCTG
TGGATCCTACTGAGGCTCCAAAAGTCTTCCTTGCTGCAAACCTACAGTCTGGCCTTGAGGTGAAGAGAGG
TGATGAGATCATACTTGAAGCACATATTTCAGGGTCACCTTATCCATCTATCACTTGGCTGAGGAATGAT
GAAGTTGTCAGACCAGAGGAAATCAAAAAGAGAGTAACAACATATACAAGGAAGAAGAAGGGTGAAGCTG
AAGAAGAGGAACCTTTCCAGCTTTCACTACCAGAACGTACGAGTATTGACAACCATAAAGAAGGAGAGTC
TGTACTATCAGTTCGTGATTCCATCAGAGCTGACCATGGCACGTTTACAATTAAAGTGGAAAATGATCAT
GGTGTTGCAAAAGCCTCATGTGAAGTCAATGTGTTAGATACACCTGGGCCTCCAGTCAACTTTGTATTTG
AAGATGTGAGGAAAAATTCTGTCATTTGTAAGTGGGAGCCTCCCCTTGATGATGGTGGAAGTGAAATCCT
AAACTATGTACTGGAAAAGAAAGACAATACAAAAGCTGAAATGGGCTGGGTCACTGTCAGCTCAACACTC
AGGCACTGCAAATTCCATGTAACAAAACTGATTGAAGGAAAAGAATATCTCTTCCGTGTATTTGCTGAAA
ATAGAGTTGGAGCAGGACCACCATGTGTTTCAAAACCAATGACAGCCAAAGATCCTTTCTCTCCACCAGA
TCCACCTAATAAGCCTGATGTGCAAGATGTTACCAGCAACAGTATGTTGGTTAAATGGAATGAACCGAAA
GACAATGGCAGCCCAATCATAGGATATTGGATTGAAAAACGTGAAATTAATAGTACTCATTGGGCTCGGG
TCAACAGGAACCTTGTGAATGCTCTGGAAATAAAAGTTGAAGGACTGTTGGAAGGATTAACTTACATCTT
TAGAGTATGTGCTGAAAATGCAGCTGGCCCTGGTAAATTTAGTCCGCCATCAGATCCAAAAACTGCACAA
GACCCGATAATGCCACCTGGTCCACCAATTCCAAGAGTTGCTGATACAAGCTCAACTTCTATTGAATTAG
AATGGGAACCTCCTGCATATAATGGTGGTGGAGATATCACTGGTTACCATGTATACAAACAACTGGTGGG
AGTAAAAGAGTGGTCACGTTGCACAGAGAAACCCATTAAAGTTCGACAGTATACTGTTAAAGAAGTTAGA
GAAGGTGCAGACTATAAACTCCGTGTTACTGCACTTAATGCGGCTGGTGAAGGACCACCTGGTGAAACTG
AACCCGTAACGGTTGCTGAACCTAAAGAGCCTCCCACTGTTGAGCTGGATATTTCTGTCAAAGCAGGCAT
TCAGATCATGGCTGGGCAAACTATTAGAATTCCTGCTACTGTGACAGGGCGTCCTACTCCCACCATTGCA
TGGACCGTGGAGGAGGGGGAATTAGACAAAGATCGAGTTGTTATTGAAAATGTTGGCACAAAATCTGAGT
TAACCATTAAGAATGCATTGAGAAAAGACCATGGAAGATATGTAATTACTGCTACCAATAGCAGTGGTTC
CAAATCTGCAGGAACCAGAGTAGAAGTATTTGATGTTCCTGGGCCAGTCCTTGACCTAAAGCCAGTGGTC
ACAAACAGAAAGATGTGTTTGCTTAACTGGTCTGATCCTGAAGATGACGGTGGCAGTGATATCATAGGCT
TCATTGTCGAACGGAAGGATGCCAAAATGCATACATGGAGACTAGCTATAGATACAGAGAGATCTAAATG
CGATATTACAGGTCTAGTTGAAGGGCAGGAATACAAATTCCGTGTTAGCGCCAAGAACAAGTTTGGTACT
GGCCCACCGGTTGAAATAGGACCCATTCTTGCAGTTGATCCATTAGGTCCCCCAACAGCGCCTGAGAGGT
TCATGTACACAGAGAGGACAAAGTCAACCATTACACTTGACTGGAAGCCTCCACGTAGTGATGGTGGCAG
TCCTGTCTTAGGATATATTGTTGAGAAGAGGAGACATGATTCAAAAGACTATGAAAGAGTTAATGCAAGG
CTCTGTCCAAAAACATCTCTTCTTGTTGAAAACCTTGATGAACTTCATATGTATGAATTCCGTGTCAAAG
CTGTCAATGCTATTGGAGAAAGTGAACCATCACTGCCCCTCAATGTCGTTATACAAGATGATGAAGTACC
TCCAACTGTTACATTACGCCTGGCTGTGAGAGGAGATACTATCAAAGTGAAGGCAAAAAAGAATGAAGTT
TTAATTGACCAAACATCCAGTGCACTTAAGATAACCAAGGAAGAAGTGTCTAGAAGTGAGGCAAAAACTG
AACTTATCCTGCCTGCAGCACTGAGGGATGATAAAGGCACTTACACTGTGAGAGCTTCCAATCGTCTTGG
CACTGCATTTCGCAATGTGCATGTTGAAGTGTATGATCGTCCTTCTCCACCAAGAAATCTTGCTGTTTCT
GATATTAAAGCGGAATCATGCTATTTAACGTGGGATGTGCCTCTTGATAATGGTGGTAGTGAAATTACCC
ATTACATTATTGAGAAACGTGATGCTAGTAGGAAGAAATCTGAGTGGGAAGAAGTCTCCAAAAGCGCTGT
TGAGAGAAGATTTGGGGTATGGAATCTTGCAACAAATGAAAAATATCAATTTAGAGTCCGGGCTGTAAAC
AAATATGGAATAAGTGATGAATGCCTCTCAGAAAAAGTTGTTATTAAGGATCCCTATGGCCTTCCTGGAC
CTCCTGGAAAGCCAAAAATTTTAGATCGCACCAGATCATCAATGCTGGTGACTTGGGAGCCTCCTCTGAG
CAATGGTGGCAGCCCAATAACTGGCTATTGGTTGGAGAAGAGAGAGGTAGGAGGTGTCTACTGGTCACGT
GTGAACAGGGCTCCAGTAACAAAACCGTCAGTAAAAGGTCTAGAATACAACGTGCTTCGTTTGGCTGAAG
GTGTTGAATACCAGTTCAGAGTTATGGCAGAAAATCTTGCTGGAATTGGCCCTCCCAGTGAACCATCAGA
TCCTGCCTTAGCAGCAGATCCCATATTTGTACCTGGTCCACCATCTTGCCCAGAGGTCAAAGACAAAACC
AAATCATCAGTAGCTCTTGCATGGAAGCCTCCACAAAAGGATGGTGGCAGTCCTATCAAAGGATATATTG
TTGAAATGCAAGACGAAGGTAGTACTGACTGGAAGAAGGTGAATGAAGGAGACAAACTCTTTCCAACTTG
TGAATGTGTTATTCCCAACTTGAAAGAGCTCAGAAAATACCGATTTAGGGTGAAAGCTGTAAATGCTGCT
GGAGAATCAGAACCAAGTCCTGCAACATCAGAAATACCTATCCAGGATATTCTTGAGGAACCAGAAATCT
TCCTTGATATTGGAGCACAGGATTTCCTCTCTTGTCGTGCTGGCACAACAATTAAAATCCCAGCTGTTAT
CAAAGGTCGTCCAGTTCCAAAAACATTCTGGGAGTTTGAAGGAAAAGCAAAGACAACAGCAAAGGAGGGA
GGTCATAATGTACCCGAAGAAGCTCAGGTGGAAGCAACTGATACACGTTCAGTGATTACCATCCCTGAGT
GCAACAGAAGTCATTCTGGACGATACAGTATTACAGCAAAGAACAAAGCAGGACAAAAAACCGTGCATGT
CAGAGTCAATGTGCTTGATGTCCCAGGTCCACCAAAAGACCTAAAAGTAAGTGATATCACAAGAGGCAGT
TGTAAACTTTCATGGAAGATGCCAGACGATGATGGTGGAGATAGAATCAGAGGCTATGTTATAGAGAAAA
GAACTATTGATGGGAAGGCCTGGACTAAAGTCAATGCAAACTGTGGAAGTACTTCCTTTGTTGTACCTGA
TCTCATATCTGGGCAAGAATATTTCTTCCGTGTACGTGCAGAAAACCGTTTCGGTGTTGGGCCTCCTGCA
GAAACCATCCAACGGACCACAGCCAGGGATCCAATCCATCCTCCTGATCCACCTATTAAACTAAAGATTG
GCCTTGTAACCAAGAACACAGTGAGCTTGACATGGAAACCACCAAAGAATGACGGTGGCGCTCCTGTTAC
ACATTATAATGTTGAATGCCTCCGCTGGGATCGCACTGGAGAAGTGAAAGAGACTTGGAAGCAATGCAAC
AGACGTGACGTGGAGGAAACAAAGTTTACTGTTGAGGATCTTGTAGAAGGTGGAGAATATGAATTCAGAG
TCAAAGCTGTAAATATAGCAGGTCCTAGTAGGCCTTCAGCCACTGTTGGCCCACTTGTTGTCAAAGACCA
GACATGCCCACCATCTATTGAACTCAGAGAATTTATGGAGGTTGAAGAAGGAACAGATGTTAACATTGTG
GCCAAGATAAAGGGTGTACCCTTCCCCACATTAACATGGCTAAAAGCTTCTCCAAAGAAACCAGATGACA
AAACACCAGTGCTGTATGATCAACATGTCAACAAGATCATTGATGAAGATACTTGCACTTTATTGATTCA
ACAGTCGCGCAGAAATGATACAGGCTTATATACTATAACGGCTGTAAATAATCTGGGAACTGCTTCAAAA
GAGATGAGACTAAATGTTCTGGGTCGTCCGGGACCTCCAGTGGGACCTATTAAATTTGAATCCATTTTGG
CTGATAAAATGACAATATCATGGCTTCCTCCATTAGATGATGGTGGTTCTAAGATTACAAACTATGTTAT
AGAGAAAAAAGAAGCAAATAGGAGGACTTGGGTACCCGTTACTAATGAGCCTAAAGAATGCTTATTCACT
GTTCCCAAGTTGATGGAAGGCCATGAATATGTGTTCCGCATTATGGCACAAAACAAGTATGGCATTGGAG
AACCATTGGACAGTGAACCAGAAACAGCACGAAACCTTTTCACTGTTCCTGGACCTTGTGAGAAGCCAAC
AGTTAGCAGTATAACACGTGACTCAATGACTGTAAACTGGGAAGAACCAGAACATGATGGTGGCTCTCCT
ATTACTGGTTACTGGTTGGAGCGCAAAGAGACTACGGGAAAAAGATGGACCAGGGTTAACCGTGATCCTA
TCAAACCTATGACACTGGGGGTTTCATACAAAGTTACAGGTCTTATTGAAGGCTCTGAATATCAGTTCCG
TGTTTCAGCTATCAATGCAGCTGGTGTTGGTCCACCAAGCATGCCATCTGATCCAGCAATTGCTAGAGAT
CCTATTGCCCCACCTGGCCCTCCTATTCCAAAAGTTACTGATTGGACAAAGTCTTCTGTAGACTTGGAGT
GGACTCCGCCACTAAAGGATGGTGGTTCTAGGGTCACTGGCTACATTGTTGAGTATAAAGAGGAAGGAAA
GGAAGAATGGGAACGGGTGAAAGACAGAGAAATTAGAGGAACCAAGTTCGTTGTGGCAGGATTAAAAGAA
GGATGTTTTTACAAATTTAGAGTTAGAGCAGTGAACGCTGCTGGCATCGGAGAGCCTGGAGAAGTTACAG
ACATTATTGAAATGAAGGACAGAATTGTGGCTCCTGATATTAATTTGGATGCAAGCGTCAGGGACAGAAT
TGTTGTTCATGCTGGAGGAGTAATTCGAATCATAGCATATGTTTCAGGAAAACCAGCTCCAACAGTGACT
TGGAGCAGGGATGACCGAGCCTTACCAGAAGAAGCCAAAATTGAAGAAACAGCTATTAGTTCTTCTTTGG
TCATCAAGAATTGCAAAAGGAGCCATCAGGGTGTATACACCCTTCTTGCTAAAAATGCCGGTGGTGAGCG
GAAGAAGACTATTATTGTTGATGTGCTAGATGTGCCAGGCCCAGTTGGAATGCCATTCCTTACTGAGAAC
CTAACCAATGACTCTTGTAAATTGACATGGTTTACTCCAGAAGACGATGGTGGTTCTCCTATTACCAACT
ATATAATAGAAAAACGTGAATCTGACCATAGAGCTTGGACTCCAGTAAGCTGCACAGTTACAAGACAGAA
TGCTACTGTTCAGGGACTCATTGAAGGGAAAGCCTACTTTTTCCGAATTGCAGCTGAGAATATAATTGGC
ATGGGTCCATTCACAGAGACAACAAAAGAGATTGTCATTAGAGATCCAATAACTGTTCCTGACCGTCCAG
AAGACCTGGAAGTAAAAGCAGTTACCAAGAACTCTGTTACATTAACTTGGAACCCGCCAAAATATAACGG
AGGCTCAGATATCACCATGTATGTTCTAGAGAGCCGTCTCATTGGAAAAGAGAAATTCCACAAAGTTACA
AAGGAGAAAATGCTTGACAGGAAATACACTGTAGAAGGCTTGAAAGAGGGTGACACTTATGAATATCGTG
TGAGTGCTTGCAATATTGTGGGGCAAGGCAAGCCATCATTTTGCACAAAACCAATCACATGCAAGGATGA
AATTGCTCCTCCAACACTTGACCTTGACTTTAGAGATAAGCTTATTGTTCGGGTTGGTGAAGCTTTCAGC
CTGACTGGACGTTACTCAGGCAAGCCTGCACCAAAGGTTACTTGGCTAAAGGATGATATTGTTGTGAAAG
AAGATGACCGTACAAAGATCAAGACAACTCCTACAACTCTTTGCTTGGGGATACTAAAATCTGTCCGTGA
AGACTCAGGCAAATACTGTGTTACTGTAGAGAACAGCACAGGATCGAGAAAAGGATTTTGCCAAGTTAAT
GTTGTTGATCGCCCGTCACCTCCAGTAGGCCCAGTTATATTTGATGAAGTTCATAAAGATCATATGGTAG
TTTCCTGGAAACCTCCATTAGATGATGGAGGCAGTGAAATTACAAACTACATTATTGAGAAGAAGGATGC
ACACAGAGACCTGTGGATGCCAGTTACATCTGCCACAGTTAAGACAACATGCAAAATTCCTAAGTTGCTT
GAAGGAAGAGAATATCAAATTCGAATTTATGCTGAAAATCTTTATGGCATAAGTGATCCTCTCATCTCTG
ATGAGATGAAAGCCAAGGACCGGTTCCGTGTTCCTGATGCACCTGAGCAACCAATCATTAAGGATGTCAC
CAAAGACTCTGCAGTAGTGGTTTGGAACAAACCATATGATGGAGGCAAGCCAATAACAAACTATATTGTA
GAAAAGAAGGAAACAATGGCTACAAGATGGGTCAGAGTTACCAAAGAACCTATTTTCCCCAGTACTCAGT
TCAAAGTACCTGACCTCCTTGAAGGCTGTCAATATGAATTCCGTGTTTCAGCAGAAAATGAAATTGGTGT
TGGTGATCCTAGTCCACCATCAAAGCCAATTTTCGCTAGAGATCCAATCGCAAAACCAAGTCCACCTGTT
AATCCAGAAGCAGTAGATAAAACTAAAAATTCAGTTGATTTATCTTGGCAACCACCACGCCATGATGGTA
ATGGCAAGATAATTGGCTACCTTGTTGAATATCAGAAAGTTGGAGATGAAGAATGGAAAAAGGCCAATCT
TATGGCAGATTCTTGTCCTGAAACAAAATATAAAGTCACTGGCCTTACTGAGGGTTTGACCTATAAGTTC
AGGGTCAAGGCAGTCAATGCAGCAGGTGAATCTGAACCAGCCTATGTTCCTGATCCAGTAGAAGTAAAGG
ACAGACTTGAACCTCCTGAGCTGATACTTGATGCTAATATGGCCCGAGAACAGCATGTAAAAGCTGGAGA
TACCTTGAGACTTAGTGCTGTTATTAAAGGTGTTCCATTCCCAAAAGTTTCTTGGAAGAAAGAAGATCGT
GAGGTCTCACCCAAAGCTGATATTGAGGTTACAGGAGTTGGCAGTAAGCTTGAAATTCGTAACACTGTCC
ATGAAGACGGTGGAATTTACTCCCTGACAGTTGAAAATCCAGCTGGTTCAAAGACTGTTTCAGTCAAAGT
TGTTGTCTTAGATAAGCCTGGTCCACCCAGAAACCTGCAGGTCAGTGAAGTTAGAAGCGATTCTTGCTAT
CTCACTTGGATGGAACCAGAAGATGATGGTGGTTCTGTCATTACCAACTACGTAGTGGAGAGGAAAGATG
TAGCTTCTGCACAGTGGGTAGCCGTCTCATCATCCTCCAAGAAACGCAGTCACATGGCTAAATATCTGAT
GGAAGGCACTCAGTATGTCTTCCGAGTTGCAGCTGAGAATCAGTTTGGTAGAGGTCCATATGTGGAAACA