21

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Татьяна Рясина пишет:

Веротяно, персональные молекулы ближе их авторам.

Персональные имеет смысл обсудить на уровне 2D структуры. Уже на этом уровне видно, что РСА не отличает пи-спираль от альфа-спирали.

22

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Kushelev пишет:
Татьяна Рясина пишет:

Сведения
https://www.google.ru/search?q=%D0%92%D … p;ie=UTF-8



Нужно просто звонить в лаборатории, говорить что хотите назначить встречу и показать уточнённые структуры белков, которые они исследуют и обсудить публикации, и коммерческую реализацию.


Здесь Вы как разработчики лучше разговаривайте. Они тоже разработчики.  Поэтому диалог возможен.  Они будут задавать свои вопросы, на которые должны отвечать вы с Валентином.
Пообщайтесь с ними напрямую, что может быть проще.

Вы, как менеджер лаборатории Наномир, договоритесь о дискуссии. Лучше всего эту дискуссию начать в скайпе или сразу на форуме лаборатории Наномир, где специалисты могут увидеть и структуры своих белков и предысторию вопроса. Дайте им эту ссылку: http://nanoworld.org.ru/post/96315/#p96315

и эту: http://nanoworld.org.ru/topic/1699/

А начните с объяснения: http://nanoworld.org.ru/topic/1837/

Можно и доклад для лабораторий показать: http://nanoworld88.narod.ru/data/302.htm




Неа, ребята из МФТИ не будут на Форуме общаться.
Сразу точно не будут и позже тоже вряд ли.   
С публикацией могут помочь если захотят.



Заинтересоваться детализацией и точностью способны.



Чтобы они стали помогать,  с ними нужно персональные отношения отличные установить, оченьвежливые и интеллигентные.  Обвинитальная манера или простологическая критика им не понравится.  В этом стиле не надо.

23

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Татьяна Рясина пишет:

Чтобы они стали помогать,  с ними нужно персональные отношения отличные установить, оченьвежливые и интеллигентные.  Обвинитальная манера или простологическая критика им не понравится.  В этом стиле не надо.

Ну так объясните им вежливо, что создана новая технология на базе научного открытия. Открыт композиционный генетический код, который показал, что РСА не может отличить даже пи-спирали от альфа-спирали. Куда уж вежливее? Если это им неинтересно, значит будем искать тех, кому интересно smile

24

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Новый вариант на английском языке:

Picotechnology for managers and customers


PICOTEKHNOLOGY OF PROTEINES

We see the protein molecule in volume and in detail
100% 2D and 3D structure of the protein molecule to the accuracy of the picometer , all sections without exception

Unlike X-ray diffraction analysis, which "sees" only 3% of proteins and does not notice dozens of extreme amino acid residues - "tails", the new technology shows 100% of the structure of 100% proteins. Only 3% of proteins are subject to crystallization, i.e. X-ray diffraction analysis.

The order's organizer receives 80% of the payment from the customer



HOW TO READ DIAGRAMS OF PIECOTECHNOLOGY
REDUCED DIAGRAM


REDUCED DIAGRAM

Red is an alpha helix.
The orange is a 310-spiral.
Pink is a single alpha / 310 spiral code.
Blue is a py-helix.
Green is a beta helix.
Lilac - methionine spiral. It has a larger pitch of "thread" than the usual alpha-helix.
Black in abbreviated form and white in unfold means either an unknown code or the end of the broadcast.
Cyclic repetition of colors - software spiral.

https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae88_bcd23f89_orig.png


FULL DIAGRAM

1 - ordinal number of the amino acid residue in the protein molecule
2 - triplet code
3 - one-letter code of amino acid residue
4 - three-letter designation of amino acid residue
5 - simplified composition code
6 - graphical interpretation of a simplified composition code
7 - composition code
8 - graphic interpretation of the composition code
9 - a note that sounds when you install this amino acid in a growing protein chain
10 - graphic representation of a note (or percussion instrument)
New Version Сomposition сode 7
https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg


Program spirals are a repetition of a sequence of compositions. For example, one alpha-helix code, then one pi-helix code. n (35) specifies a program spiral, and n3 or n5 are simple spirals (a pi-helix and an alpha-310 helix).

111111111111111111111 - straight alpha helix
4444444444444444444 - straight 310-spiral
3333333333333333333 - straight pi-helix
2222222222222222222 - direct beta helix
232323 - software 23-spiral
141414 - software 14-spiral

TAST PICOTECH

https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae89_c89aa77e_orig.png


Pi-spiral is in official science and in Pikotekhnology. http://nanoworld.org.ru/post/94083/#p94083
In the official science it is considered that the beta-strands are flat, i.e. "The spiral with the rotation of each next amino acid by 180 degrees." The pico-technological models show that these are not strands, namely right-handed spirals (2.5 residues per turn) .The 310-spiral is right-handed. It has about 3 residues per turn, the alpha helix is also right. ~ 3.6 residues per turn.The pi-helix left has approximately 4.1 residues per turn: http://info-farm.ru/alphabet_index/p/pi-spiral.html.

Models of all types of simple spirals are shown here: http://nanoworld88.narod.ru/data/302.htm
Modeling of amino acid residues http://nanoworld88.narod.ru/data/279.htm


WHAT DOES A NOTE IN THE RIGHT SECTION OF THE PYCOTECHNOLOGY MEAN?

Each amino acid has a radical that "calls back" the note at a frequency that I calculated according to the formula of the spring and mathematical pendulums
This formula has the form: f = sqrt (1 / (Sum (ml))), where
f is the frequency
m is the mass of the atom in the radical
l - The distance of the atom to the anchoring point of the radical
The products of masses are summed up to the point of closure for one radical. From the reciprocal value, the square root is extracted.

It is clear that this is a rough estimate of the resonance frequencies, and therefore they were repeatedly refined, in particular, on the harmony of the melodies sounding in the zones of the active centers of protein molecules. This work is still far from complete. Obviously, there are errors in the frequencies. Therefore, there are "fake notes" http://nanoworld.org.ru/post/93998/#p93998


PICTOTECHNOLOGY INFORMATIVITY

https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae8a_dcd68537_orig.png

https://img-fotki.yandex.ru/get/872132/249950893.1/0_16ae8b_767d0d51_orig.png


THE ESSENCE OF THE METHOD

http://nanoworld88.narod.ru/data/302.htm

DNA triplets encode amino acids. According to the table of the usual genetic code:

https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae8c_c3da441d_orig.jpg


Kushelev: In a simplified presentation, the third (as if superfluous) letter controls the angle of rotation. This I understood when I made a 3D model of the amino acid residue. One amino acid residue can be rotated relative to the other at angles of 0, 120 and 240 degrees. When I was convinced of that, having constructed plastic models of several protein molecules, refinements began. After all, hydrogen bonds between adjacent turns of the spiral can slightly change the angles of rotation. Analysis of protein structures helped to make a table of the composite genetic code http://nanoworld.org.ru/post/94014/#p94014.

Kushelev: The official science "knows" the alpha helix, 310-spiral, pi-helix and beta-string (does not know what spiral). In the obsolete official science, spirals are not coded. In order to learn their code, you need to open a composite genetic code, which, in fact, I did in 1992. I compiled it on this data: http://www.nanoworld.org.ru/data/01/dat … 920204.htm

Kushelev: In the simplified model of picotechnology, a rotation around one axis at 3 different angles is taken into account. The variant "alpha" is further split into "Alpha-spiral", "310-spiral", "single alpha-code". http://nanoworld.org.ru/post/94009/#p94009

https://img-fotki.yandex.ru/get/772910/249950893.1/0_16ae8d_e4e5f162_orig.png


WHY PIKOTECHNOLOGY IS 100% PERFECT

Specialists in the SAR are simply not aware that the electron has a "skeleton" in the form of a ring with a diameter of 1.7 angstroms (for external envelopes of hydrogen, carbon, nitrogen, oxygen ... Ring "skeletons" of electrons form ring-shaped electronic shells and ring mechanisms of molecules. These mechanisms show how the alpha-helix, 310-helix, mixed alpha-310-helix, pi-helix and beta-helix, which turned out to be not 2 residues per turn, will help the SAR specialists to more accurately determine protein structures and not only.

By the way, pikotech can not determine the structures obtained not by the ribosome program. If after the assembly of protein it is processed by enzymes, for example, it is cut and reworked, the program "Pikotech" does not know about it. So completely disregard the SAR is not worth it. But in terms of additions, the PCA "weighs" several times less than the "Picotech". http://nanoworld.org.ru/post/94089/#p94089

In modern databases, the structure of the protein is depicted in the form of the identified sections of alpha and 310-spirals.

https://img-fotki.yandex.ru/get/772910/249950893.1/0_16ae8e_2c14cdcf_orig.png

https://img-fotki.yandex.ru/get/765007/249950893.1/0_16ae8f_20b1a768_orig.png


Here, the helical sections (alpha and 310-) are shown in red. The rest is an unidentified part. At present, it is believed that the protein in the unidentified part does not have a specific structure, but picotechnology has shown that this is not so. In the program "Picotech" the whole structure is defined. http://nanoworld.org.ru/post/93980/#p93980

https://img-fotki.yandex.ru/get/480022/249950893.1/0_16ae90_3b010940_orig.png

This protein consists of program spirals, but in the standard representation it will be shown either without any structure at all, or represented by pieces of alpha and 310-spirals. Both options are fundamentally wrong.

Another typical example of an error is the image of the collagen structure by a triple alpha helix. In fact, the structure of this collagen is a single, but software 335-spiral:

https://img-fotki.yandex.ru/get/480022/249950893.1/0_16ae90_3b010940_orig.png

Although specialists in X-ray diffraction analysis (X-ray structural analysis) say that the accuracy of the method achieves fractions of an angstrom (less than the size of one atom), but in reality they can not distinguish triple alpha helix from the program 335-helix of collagen for decades. This means that they can not achieve atomic precision even today. The actual error of the SAR is in the range of several atomic radii to hundreds of atomic radii. For example, the "tails" of protein molecules (up to 50 amino acid residues) of X-ray diffraction patterns may not be noticed at all. And this - hundreds of atomic radii in length.

X-ray structural analysis is often mistaken when recognizing spiral patches. Sometimes he does not notice at all or shows where there is no spiral. And to confuse the alpha-spiral with a 310-Pi or software spiral is elementary. http://nanoworld.org.ru/post/94010/#p94010

Instead of a triple helix of collagen, the Picotech program shows a single, but a three-pass program 335-spiral, in other words, the shape is similar, but the microstructure is different, and was obtained automatically, that is, according to a tabular function http://nanoworld.org. en / post / 94011 / # p94011

PICTOTECHNOLOGY  WORKING CAPACITY

Kushelev: The efficiency of picotechnology makes sense to demonstrate firstly at the level of the secondary structure of long spirals. Including software: http://nanoworld.org.ru/topic/1656/
For them, it's easy to get accurate 3D models.
Accent makes sense to do on the closure of cycles of lysozyme. It is impossible to get a cycle closure accidentally. Probability of the type 1/30 000 000 000. And for program spirals randomness has a probability of the type 4 ^ -3982 = 4e-2398 More: http://nanoworld.org.ru/topic/1656/page/5/
I already had a negative experience working with customers through intermediaries. Distorted and incomplete information about the new technology only discourages customers. They think that the results of the work of Picotech should completely coincide with the results of X-ray diffraction. This is not true. At the secondary structure level, Pikotech has 100% reliability, and SAR at 70%. 97% of proteins for PCA are not available at all, because they do not crystallize.
Overcoming the barrier of blind faith in the RSA is a delicate matter. With the help of a "spoiled phone" the task is not solved. So we are waiting for potential customers, for example, at the Nanomir laboratory forum or in Skype. In this case, there is a chance to inform them about the new technology without distortion.
http://nanoworld.org.ru/post/94006/#p94006

PUBLICATIONS
Monograph A.Kushelev, V.Sokolic, "Geometry of the living nanoworld. Protein picronotry »2016 https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2
Competition project for the Competition of the Ministry of Education and Science 1993 http://nanoworld.org.ru/post/93984/#p93984
Text   https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2
Tables in Chemistry, Russian Academy of Education, 2006 http://nanoworld88.narod.ru/data/250.htm
VDNKh medal for the pico-technological models of proteine molecules 1989
http://www.sciteclibrary.ru/cgi-bin/yab … 691890/113

EXAMPLES OF 2D AND 3D PROTEIN STRUCTURES

http://nanoworld.org.ru/post/94033/#p94033
http://nanoworld.org.ru/post/94044/#p94044
http://nanoworld.org.ru/post/94186/#p94186

SITE CONCEPT

http://picosoft.nethouse.ru

25

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

2D диаграммы Пикотех белковых структур, исследованных методом РСА.



********************************************************
СТРУКТУРА ДИАГРАММЫ ПИКОТЕХ  http://nanoworld.org.ru/post/94241/#p94241

СОКРАЩЁННАЯ ДИАГРАММА
Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.

ПОЛНАЯ ДИАГРАММА
Содержание столбцов
1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)
Для новой версии Пикотех 2018 разработан Композиционный код 7var
https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg
Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль

Пикотехнология. Резюме метода http://nanoworld.org.ru/post/96759/#p96759
*******************************************************










1.
https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V

https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

http://nanoworld.org.ru/post/96477/#p96477
Программа Пикотех показывает следующую детализированную структуру.
Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

https://img-fotki.yandex.ru/get/510105/249950893.1/0_16aff0_89b162aa_orig.png









2.
https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F

https://img-fotki.yandex.ru/get/896238/249950893.1/0_16afce_af6cf2b8_orig.png

http://www.rcsb.org/pdb/explore/explore … ureId=5V56
https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

>ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein
ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
GCGCATGACGTGAGGGGCGCCATCTAG

http://nanoworld.org.ru/post/96494/#p96494
Результаты программы Пикотех

4-8 - альфа-спираль
49-53 - альфа-спираль
57-60 - альфа-спираль
62-65 - альфа-спираль
67-71 - альфа-спираль
75-78 - альфа-спираль
80-95 - альфа-спираль
97-103 - альфа-спираль
105-108 - альфа-спираль
110-115 - альфа-спираль
115-121 - программная 35-спираль
120-127 - программная 3355-спираль
128-141 - альфа-спираль
143-148 - альфа-спираль

https://img-fotki.yandex.ru/get/877700/249950893.1/0_16afc9_75560fe6_orig.png

https://img-fotki.yandex.ru/get/477847/249950893.1/0_16afeb_a12b3edb_orig.png










3.
https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

Identification of Phosphorylation Codes for Arrestin Recruitment by G Protein-Coupled Receptors

Zhou XE, He Y, de Waal PW, Gao X, Kang Y, Van Eps N, Yin Y, Pal K, Goswami D, White TA, Barty A, Latorraca NR, Chapman HN, Hubbell WL, Dror RO, Stevens RC, Cherezov V, Gurevich VV, Griffin PR, Ernst OP, Melcher K, Xu HE

https://img-fotki.yandex.ru/get/476913/249950893.0/0_16a3b9_61f34840_orig.png

https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

>ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein
ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
GAGACGAGCCAGGTGGCCCCGGCCTAA

http://nanoworld.org.ru/post/96490/#p96490
Программа Пикотех показывает

8-14 - альфа-спираль.
21-26 - альфа-спираль.
28-31 - альфа-спираль.
35-44 - альфа-спираль.
46-70 - 310-альфа-спираль.
72-78 - альфа-спираль.
83-87 - альфа-спираль.
90-97 - альфа-спираль.
102-107 - альфа-спираль.
112-115 - альфа-спираль.
117-120 - альфа-спираль.
124-139 - альфа-спираль.
141-151 - альфа-спираль.
153-156 - альфа-спираль.
158-168 - альфа-спираль.
172-186 - альфа-спираль.
189-201 - альфа-спираль.
204-216 - альфа-спираль.
215-225 - программная 355-спираль.
224-233 - альфа-спираль.
235-239 - альфа-спираль.
238-248 - программная 255-спираль.
247-259 - альфа-спираль.
261-271 - альфа-спираль.
273-283 - альфа-спираль.
285-290 - альфа-спираль.
295-302 - альфа-спираль.
307-326 - альфа-спираль.
336-348 - альфа-спираль.

https://img-fotki.yandex.ru/get/516062/249950893.1/0_16afec_886d280e_orig.png

https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcc_519f9d05_orig.png













4.
https://www.ncbi.nlm.nih.gov/Structure/pdb/5XEZ

Structure of the full-length glucagon class B G-protein-coupled receptor

Zhang H, Qiao A, Yang D, Yang L, Dai A, de Graaf C, Reedtz-Runge S, Dharmarajan V, Zhang H, Han GW, Grant TD, Sierra RG, Weierstall U, Nelson G, Liu W, Wu Y, Ma L, Cai X, Lin G, Wu X, Geng Z, Dong Y, Song G, Griffin PR, Lau J, Cherezov V, Yang H, Hanson MA, Stevens RC, Zhao Q, Jiang H, Wang MW, Wu B

https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ
http://www.uniprot.org/uniprot/P47871
https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

>ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor
ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

http://nanoworld.org.ru/post/96505/#p96505
Программа Пикотех показывает

147-173 - наиболее протяженный участок альфа-310-спирали.
Весь белок представлен преимущественно участками альфа-310-спиралей.

https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png

https://img-fotki.yandex.ru/get/893904/249950893.1/0_16b0a1_6da31b90_orig.png










5.
https://www.ncbi.nlm.nih.gov/pubmed/17962520
https://www.ncbi.nlm.nih.gov/Structure/ … ;uid=60314

High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor.

Cherezov V1, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, Stevens RC.

https://img-fotki.yandex.ru/get/893240/249950893.0/0_16a3b1_d636e8c2_orig.png

https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

https://img-fotki.yandex.ru/get/6713/249950893.1/0_16afcf_be7ab3f6_orig.png

http://www.uniprot.org/uniprot/P00720
https://www.ebi.ac.uk/ena/data/view/CAA28212

>ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein
ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
TATAAAAATCTATAA

https://img-fotki.yandex.ru/get/517809/249950893.1/0_16afd8_c591449d_orig.png

https://img-fotki.yandex.ru/get/768139/249950893.1/0_16afd9_74627b67_orig.png

26

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Пикотехнология.
Резюме метода.




В настоящее время одним из популярных алгоритмов моделирования пространственной структуры белка, который исходит из его аминокислотной последовательности, является способ построение модели по гомологии на основе общего структурного шаблона.
Разработан новый способ моделирования структурного шаблона белка по детерминирующей его нуклеотидной последовательности, поскольку информация о топологии вторичной структуры белка и его индивидуальном  структурном шаблоне  содержится непосредственно в гене каждого белка. Эта информация может быть декодирована в соответствии с таблицей генетического кода структурного шаблона белка авторскими программами Пикотех (PT) и Молекулярный конструктор (МС) в виде координатного файла в pdb-формате.
Важным достоинством метода является то, что можно построить структурный шаблон индивидуально для любого неизвестного белка лишь “прочитав” детерминирующую его нуклеотидную последовательность. Такой шаблон служит единой матрицей для пространственной структуры всех молекул данного белка в ходе посттрансляционного фолдинга in vivo и виртуального фолдинга или докинга in silico.

Модели белковых молекул в Пикотехнологии  предполагают наличие "жестких" кольцеобразных структур в электронных оболочках атомов, соединяющихся в многогранники. Это позволяет нам типологизировать формы участков белковых молекул и точно описать их в трехмерном изображении, с точностью до пикометра.

Структура 2D диаграммы Пикотех

СОКРАЩЁННАЯ ДИАГРАММА
Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.

ПОЛНАЯ ДИАГРАММА
Содержание столбцов
1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)
Для новой версии Пикотех 2018 разработан Композиционный код 7var
https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg
Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль

Композиционный генетический код.

Триплеты ДНК кодируют аминокислоты. В упрощённом представлении третья буква триплета управляет углом поворота. Это показывают пикотехнологические 3D модели аминокислотного остатка. Один аминокислотный остаток можно повернуть относительно другого на углы 0, 120 и 240 градусов.  Для описания пространственных структур белковых молекул представлен

Согласно методу Пикотехнологии, электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода). Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток.

Композиционный генетический код 4var, 6var и 7var.
В Диграммах Пикотех применяются три вида композиционного генетического кода – коды 4var, 6var и 7var.
Код "2" (спираль - не спираль).
Код 4var более подробный (альфа-, бета-, пи-, 310-).
Код 6var ещё более подробный. В нём есть различие "одиночный альфа-код", "код альфа-спирали", "код 310-спирали", "Код метионина в составе спирали".
Код 7var  различает одиночный код пи-спирали от кода в составе пи-спирали .

В настоящее время считается, что белок в неопознанной части структур, полученных методом РСА, не имеет определенной структуры, но пикотехнология показала, что это не так. В программе "Пикотех" вся структура определена.

Пикотехнология не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не даёт информации.

Пример Пикотехнологической модели гистонного комплекса
http://nanoworld.org.ru/post/96354/#p96354

Пикотехнологические 2D и 3D модели длинных спиралей
http://nanoworld.org.ru/topic/1837/ ,
а также
http://nanoworld.org.ru/post/91815/#p91815
здесь
http://nanoworld.org.ru/topic/1656/page/5/

Три надежных метода проверки Пикотехнологии.

Первый - достоверная корреляция с данными РСА. Конечно, РСА не даёт высокой достоверности, но она часто выше 50%.

На таких белках, как инсулин, гемоглобин, окситоцин корреляция приближается к 100%, т.к. в окситоцине, например, есть замкнутые циклы через дисульфидные мостики. Это позволяет проверить и РСА, и Пикотех.

Второй - замкнутые через дисульфидные мостики циклы типа окситоциновых. Вероятность случайного замыкания шести циклов, насчитывающих десятки аминокислотных остатков из разных окситоцинов, порядка 1/30 000 000 000. Речь идёт о вероятности для каждого цикла - все шесть могут случайно замкнуться с вероятностью (1/30 000 000 000)^6.

Третий - самоповерка на примере сверхдлинных базовых и программных спиралей, где наблюдается 100%-ная корреляция между вторичной и первичной структурами.

Пикотех как дополнение к РСА

Программа Пикотех не может полностью заменить РСА. Однако она очень усиливает самые слабые стороны РСА, а именно достоверно показывает вторичную структуру и ближний порядок расположения атомов третичной структуры в момент сборки белковой молекулы рибосомой.

Чувствительность РСА такова, что он не замечает не только отдельных атомов, но и отдельных аминокислотных остатков. Более того, "хвосты" белковых молекул, которые не кристаллизуются, РСА вообще "не видит", а эти "хвосты" могут насчитывать до 50 аминокислотных остатков.

Особый класс образуют 97% белковых молекул, которые не кристаллизуются. Про них РСА просто ничего не знает, а программа Пикотех так же достоверно показывает их вторичную структуру и ближний порядок расположения атомов в третичной структуре.

Online servise "Protein picotech":
http://nanoworld.org.ru/topic/1699/

Литература

1.Монография А.Кушелев, В.Соколик "Геометрия живого наномира. Пикотехнология белков"  https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2 
Предисловие рецензентов и авторов http://nanoworld.org.ru/post/55717/#p55717
Ознакомиться с началом монографии можно по ссылке http://nanoworld.org.ru/post/54741/#p54741
2.    Кушелев А.Ю., Соколик В.В. Пикотехнология – новый подход в моделировании пространственной структуры белка / Заочная Международная научно-практическая конференция «Современная наука: тенденции развития» (24 января 2012), Краснодар: НИЦ Априори. – 2012. – С.203-207.
3.    Соколик В.В. Предсказание пространственной структуры белка insilico на основе информации генома и геометрического алгоритма – альтернатива  квантово-механическому подходу // Материалы Международной научной конференции «Математическое и компьютерное моделирование в биологии и химии. Перспективы развития» (28-30 мая 2012), Казань. – 2012. – С.155-158.
4.    Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration // The International Moscow Conference on Computational Molecular Biology, МССМВ-11, Moscow. – 2011. – P. 347–348.
5.    Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence // Fist International Conference “Fundamental medicine: From scalpel toward Genome, Proteome and Lipidome”, Pax Grid Virtual Conferences, Kazan. – 2011. – P. 117–119.
6.    Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences // VII Международная конференция по биоинформатике, регуляции структуры геномов и системной биологии. BGRS\SB-2010, Новосибирск. – 2010. – С. 275.
7.    Соколик В.В. Способ моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности // Биофизический вестник. – 2010. – Вып. 24 (1). – С. 31-45.

27

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Чистовой вариант текста
http://nanoworld.org.ru/post/96760/#p96760

2D диаграммы Пикотех белковых структур, исследованных методом РСА.

28

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Обращение к специалистам в области биоинформатики, молекулярной билологии, медицинской биофизики, биохимии, и других профильных и смежных областей.

Уважаемые господа!

В лаборатории Наномир создана новая технология точного определения структуры белка на базе научного открытия. Открыт Композиционный генетический код.
Пикотехнология белков. Резюме метода
http://nanoworld.org.ru/post/96761/#p96761
2D диаграммы Пикотех белковых структур, исследованных методом РСА.
http://nanoworld.org.ru/post/96760/#p96760
Пикотехнология белков. Презентация
http://nanoworld.org.ru/post/94241/#p94241
Пикотехнология белков. Сайт-концепт http://picosoft.nethouse.ru
Силами нескольких программистов создан Online service PROTEIN PICOTECHNOLOGY: http://nanoworld.org.ru/topic/1699/
Фактически запрограммирована табличная функция "код-структура". Пространственная структура белка на уровне геометрического алгоритма тоже получается в первом приближении. Однако для большинства белков кроме геометрии нужно учитывать и физико-химические взаимодействия, а это уже более сложная задача, чем "собрать по программе из конструктора". Учитывая, что экономический эффект от создания полноценной системы "Пикотехнология 3D" трудно переоценить, хочу предложить Вам рассмотреть возможность решения этой грандиозной проблемы.
Жду Вашего совета.
С уважением,
Александр Кушелев,
Руководитель Лаборатории Наномир.
+7 (903) 2003424
kushelev20120@yandex.ru

29

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

http://nanoworld.org.ru/post/96799/#p96799

Татьяна Рясина пишет:

Вы предположим, делаете изображение 3D - решение структуры.  А как оно получено, не объясняете.

Кушелев: Вот, плииз:https://www.youtube.com/watch?v=nVYnVZv6Qr8
1993 год.

30

Re: Пикотехнология для менеджеров и заказчиков (Татьяна Рясина)

Татьяна Рясина пишет:

Самая крутая фишка Пикотеха - именно 3D изображение.

Кушелев: Для тех, кто так считает, есть 3D-модели циклов лизоцима, модели фундаментальных спиралей, программной 335-спирали коллагена.

Другие модели могут быть неправильными, поэтому лучше опуститься на более простой уровень 2D моделей. Уже на этом уровне можно показать ошибочность данных в PDB. Зачем усложнять?