21

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 021

Готовится 616-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

616 Цепи - фрактальные эталоны длины и угловых величин!
Двигатель-Emdrive "подошва Кришны" в скульптуре
Идол - это девайс/гаджет с фальшивой головой!
Открыта структура белка, содержащего прямой альфа-спиральный участок из 440 аминокислотных остатков Pro.
Качественная копия инопланетного девайса

https://img-fotki.yandex.ru/get/772910/158289418.46d/0_18143a_a139e40_XL.jpg

https://img-fotki.yandex.ru/get/231315/158289418.46d/0_18143f_22b87e6d_XL.jpg

https://img-fotki.yandex.ru/get/232875/158289418.46d/0_18143d_f7f25f0_XL.jpg

https://img-fotki.yandex.ru/get/468374/158289418.46d/0_181435_721fbc5e_XL.jpg

https://img-fotki.yandex.ru/get/370413/158289418.46c/0_1813fc_d49b7085_XL.jpg

https://img-fotki.yandex.ru/get/479589/158289418.46d/0_181449_2cb40ae_XL.jpg

https://img-fotki.yandex.ru/get/470815/158289418.46d/0_18144a_5e21fd3_XL.jpg

https://img-fotki.yandex.ru/get/235925/158289418.46d/0_18145d_7cb1f105_XL.jpg

https://img-fotki.yandex.ru/get/467315/158289418.46e/0_181488_504c5b35_XL.png

https://img-fotki.yandex.ru/get/237726/158289418.46f/0_1814dd_8bba739_orig.jpg

22

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 022

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ 20170905_008:

https://www.ncbi.nlm.nih.gov/protein/55 … WUX3PT1014

hypothetical protein, conserved [Eimeria brunetti]

Результат:

https://img-fotki.yandex.ru/get/372432/158289418.46f/0_1814c3_5b4b21be_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/9091/158289418.46f/0_1814c4_a2103937_XL.png
Оригинал: https://img-fotki.yandex.ru/get/9091/15 … 7_orig.png

https://img-fotki.yandex.ru/get/233044/158289418.46f/0_1814c5_c66e6705_XL.png
Аланиновая бета-спираль переходит в аланиновую пи-спираль

https://img-fotki.yandex.ru/get/206909/158289418.46f/0_1814c6_2d335ad7_XL.png

Последовательность (LQQ)*n образует программную 114-спираль

https://img-fotki.yandex.ru/get/206909/158289418.46f/0_1814c7_bc72169d_XL.png
Последовательность (PPGGPSPGG)*n образует программную 534111355-спираль

23

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 023

Online service of protein structures

Заказ 20170905_009:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

Scheffersomyces stipitis CBS 6054 hypothetical protein partial mRNA

Результат:

https://img-fotki.yandex.ru/get/371503/158289418.46f/0_1814c8_29c6c203_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/371503/158289418.46f/0_1814c9_bf8e1d8b_XL.png
Оригинал: https://img-fotki.yandex.ru/get/371503/ … b_orig.png

https://img-fotki.yandex.ru/get/467152/158289418.46f/0_1814ca_bfcede38_orig.png

Последовательность (APP)*n преимущественно образует программную 322-спираль

https://img-fotki.yandex.ru/get/249078/158289418.46f/0_1814cb_5ed82148_orig.png
Последовательность (HPPHHP)*n образует программную 322133-спираль

Эта схема вторичной структуры белка напоминает геодезическую шкалу:

https://img-fotki.yandex.ru/get/756497/158289418.437/0_17e237_4f6cd6af_XL.jpg
Подробнее: http://nanoworld.org.ru/topic/1743/

24

Re: Формы, механизмы, энергия наномира - 90

Заказ 20170905_010:

https://www.ncbi.nlm.nih.gov/nuccore/NA … port=fasta

>NAJO01000023.1 Rachicladosporium antarcticum strain CCFEE 5527 scaffold_23, OQO04034 2328 nucleotides
atgtgtttggattgtaaggatgagctgccgcagccgtcgttgccttctcactctggaggg
aacccgcatccttcacagcctgcaccgcctgcaccgcctgcaccgcctgcaccgcctgca
ccgcctgcaccgcctgcaccgcctgcaccgcctgcaccgcctgcaccgcctgcaccgcct
gcgccgcccgcaccgcccgcacagcttgcgtcgccagcactgcctgcacaatctgcatcg
cctgtactgcctgcatcgtctgccccgcctgcgttatctccccaacccgcagagcccgtt
caagagtcgaaagcggcccacaagcagtgcttgaggtgcggaaacaagaagcaggaagag
gagttcgcgccgttcgcaagaatttgcacggattgcaaaaagaatgaacatctgcagcaa
gcttctggaaaaaatgtgctacagtgcatagaagcaggtgcgccaccgaaggaaggtgat
aaagtttgccctggtccctgcggtcaagagaagcctctgggcgatttcgacaagcgaata
gacaatatagatgggcacaccagcaagtgcaaagcatgccgtggagacgcggccctcaag
tctactctcgcttcgattgtcgctgatatgggtactgcaggcatcagtattgcgaccgac
gacgacgacgacgagcaagacaacgtcgacttccagcagccttccctctctgataggcag
cgctttttcgccggcttgtactccgcgcctgcgagcgtggataagcgctacactcgcggt
cgcaattcctgggatctcaccaaggcggagattctggcacggtatgctgacccgaaagag
aagtattccagaaagcccggagacactctcatacacgcaatccaacgcgaggaagccgct
cgtggtatcatacccattccacgacccctacactcagaataccactacatgggttgtctc
gcacttgcaaaggtcgcacgcagtcgtggttgggctgctgtccgcactgcggagcagtca
cggctgagagcggagttcgacgaggatcgactgctggcgaatcgtggctatactgcgttc
aaagaggcagatgatggtgttgccggcatgctggacgtcgatgacgcccggttggaactg
gatacagctgcacttgatctcgatgaaatattggcgggcggcaacgaagcagtcccggga
tatacaaccgcatccaccattaaccctcgccgagccgcctcgcgcgaagacgagtacgag
aagctgatagatcgagtggtcaggttcttgttgacgcaagaccatggcagcgaagagggc
ttctggcaggtcatggacgaagagaagcagtcgactgttgcgagcctccttgtggacgac
ttgtcgctcagtcttggcttcaagcataatcacaggaaagcatatgcgcgttgccatcct
aatcacgacaagcccgcgcaccttcggcagatgcgacttggtcaattcgtcggcatcact
ggcacgcagaccgccttggactcgctatactacctgttgcacgacgggaggaccgtccca
cagcccacttccgcgcaaggtctgctatgtggtatttttgcacttgagcggtccctggag
ttcatgcaacgccgcatgtacacgctgctcttttcggactgggatccggataggcattac
tactctggcgatactgctactccgactctggcgtacgatgcctataatagacagcagtat
gggtccttacttatcgcaggtgacgatattttctttaatgatatgtatgcagaacttaca
caggtgatggatctggacgcgatgcagctgcaagctatcctcaccctactctataacaat
ggcaacgaccctgacgtgccagtgcactatcagctcggcgttgttcgcagtggatattgg
cgtcgtgtcgcaggtcaagagcaggccgtgtccgcctatgtgcgcttcgtcaacgagccc
gatcccgacctcacacaaaaccgccaggttgtgctcttcattcacaacagaaccgcacta
ggcggtggtgagtacaaccacttcaaggctatggaccacagcggaggggaagggtactac
gatctgtgccattgcagcggcgtcacgctggctcgagctgcgggcaagcgagatgaccat
gaagtgctggctctctgtaaccggagcgatatcagcaaggtgcctactgaattcgccttt
gaagcgcgtgttccatacctgcaagtactgctcacgctcttccggcgaagcggacggcgg
caactattgtactggtctcagatgatcatcccacctgtagcgaggtaa

Результат:

https://img-fotki.yandex.ru/get/202427/158289418.46f/0_1814ce_1521fe0e_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/233740/158289418.46f/0_1814cf_ef72cb82_XL.png

https://img-fotki.yandex.ru/get/373630/158289418.46f/0_1814d0_4083a555_XL.png

Последовательность (APP)*n образует программную 253-спираль

25

Re: Формы, механизмы, энергия наномира - 90

https://img-fotki.yandex.ru/get/233740/158289418.46f/0_1814d1_26cca6b8_XL.jpg
Кушелев: Будем дальше радовать друзей smile

26

Re: Формы, механизмы, энергия наномира - 90

Заказ 20170905_011:

https://www.ncbi.nlm.nih.gov/protein/76 … XBU142C016

>CP005169.1 Saccharomyces cerevisiae YJM1433 chromosome X complement 3429 nucleotides
atgagtgaacccgaggtgcccttcaaggtggtggctcagttcccatacaagtccgattac
gaggacgatttaaattttgaaaaagatcaagagattattgttacgtctgttgaagacgcc
gaatggtactttggtgaataccaggattcaaatggcgacgttattgagggtatcttcccg
aaaagttttgttgctgttcagggatctgaagttggaaaggaagccgaatcatctccgaat
accggttccactgagcaacgtacaatccagccggaagtagaacaaaaggacctaccagag
cccatttcccctgaaacgaagaaagaaactctgtccgggccagtgccagttccagccgct
acagtgccagttccagccgctacagtgccagttccagccgctacagcagtatcagcacag
gtccagcatgatagtagtagtggtaatggcgaaagaaaagttcccatggattctccaaaa
ttgaaggctcgcttatctatgtttaatcaagatataacggagcaagttcctttaccaaaa
tcaactcacttggatttagaaaacatacctgtgaaaaaaacaattgtggcagatgctcct
aaatactatgtcccccctggaattccaacaaatgatacgtccaatcttgaaaggaaaaag
tccctaaaggaaaacgaaaaaaagattgttcccgaaccaattaatcgtgcacaggtggaa
agtggaagaatagaaactgagaatgaccaattaaagaaggatctgccccagatgagcctt
aaagaaagaattgctcttttacaggagcaacaaagattacaggctgcaagagaagaagaa
ctcttgagaaaaaaggctaagctcgaacaagaacatgaacgtagtgcggttaacaagaat
gagccctatacggaaactgaagaagcagaagaaaatgaaaaaactgaaccgaaacctgaa
tttacgcctgaaactgagcacaacgaggaaccgcaaatggaattattggcacataaagag
attactaaaacctcacgcgaagcagatgaaggcacgaatgacatagagaaagaacaattt
ttagatgagtacacaaaggaaaatcagaaagttgaggagtcacaagcagacgaggcaaga
ggagaaaatgttgctgaggaaagcgaaataggttacggccatgaagacagagagggagat
aatgatgaggaaaaagaagaggaagatagtgaagagaatcgtagggccgcattgagagaa
agaatggctaaactatctggcgctagtagattcggtgctcctgttggttttaaccccttc
ggtatggcttctggagttggaaataaaccatcagaagagccgaaaaagaaacagcataag
gagaaggaggaggaggaacctgaacagctccaagaactacctcgtgccatacctgttatg
ccatttgttgacccaagttctaacccattttttaggaaatcaaatctaagtgagaagaat
caacccactgaaacaaagacgctagatcctcatgcaaccacagagcatgaacagaagcaa
gaacatggtacacacgcctatcacaatttagctgctgttgatgatgcacatcccgaatac
tctgaccatgattctgatgaagatactgacgaccacgagtttgaggatgcaaacgatggg
ttgagaaagcattcgatggtggagcaagcttttcagataggtaataatgagtcagagaat
gttaattccggagaaaaaatttaccctcaagaaccaccaatctcccaccgtactgcagaa
gtatcacatgatattgaaaattcatcacaaaacacaactggaaatgttttgcctgtctct
tccccacaaacaagagttgctcgcaacgggtcgataaattctttgactaaatctatttca
ggggaaaatcggcggaaatccataaacgagtatcatgatacagtttccactaattcatct
gcattaacagaaaccgctcaagatatttcgatggcagctccaccagctccagttctaagt
aaggtgtcacatcctgaggacaaggtgccacctcatccagtgccttctgcaccctctgca
ccaccagcaccctctgtacctccagcactctctgcacctccaacacctccagcacctcca
gcacctccagcacctccagcacctccagcacctccagcacctccagcacctccagcacct
ccagcacctccagcacctccagcacctcttgcgctgcctaaacacaatgaagtagaagaa
catgtcaagtcatctgctccccttccacctgtatccgaggaatatcatcctatgccaaat
actgctccgccacttccacgtgcaccaccagtaccaccggctacttgtgaatttgactct
gaaccaacagccactcattcacatacagctccttctcctccaccacatcaaaatgtcacg
gcctctacaccttcaatgatgagtacgcaacaacgtgtgccaacctcagtactatctggg
gcagaaaaagaatcacgaaccctaccgccccatgtgccttcattggcgaatcgtcctgtg
gattcattccatgagtcagatactacaccgaaggtggcctctataagaaggtcaacgacg
catgatgtaggcgagatttccaacaacgtcaagatagagtttaatgcacaagaaagatgg
tggattaataaaagcgcacctcctgctataagcaatctgaagttgaactttttgatggag
atcgatgatcatttcatttccaaaagattacatcaaaaatgggtggtaagggatttttac
ttcttgtttgaaaactattcgcaactaagattctccttgacctttaatagtacaagccca
gagaaaacggtaacgactcttcaagaacgctttccatcgccagtcgaaacacaatcagca
cgtattcttgatgaatacgctcaaaggtttaatgcaaaagttgtagagaaatctcattca
ttaataaattcacatattggggctaagaatttcgtgtcacaaattgtatccgaattcaaa
gacgaagttatacaacccataggagcaagaacgtttggcgcaactatattgagttataaa
cctgaagaaggaatcgaacagttgatgaagagcttacagaagattaaaccaggtgacatt
cttgtaattagaaaggccaaatttgaagctcataaaaagatcggaaaaaacgaaattatc
aacgttggaatggactccgccgctccgtattcgagtgttgttactgattatgattttaca
aagaataagtttagagttatcgaaaatcacgagggaaagattattcaaaacagctacaag
ctaagccacatgaaaagtgggaagttaaaggttttcagaattgttgcgagaggatacgta
ggttggtaa

Результат:

https://img-fotki.yandex.ru/get/233577/158289418.46f/0_1814d2_af5cd371_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/470815/158289418.46f/0_1814d3_7eba4049_XL.png
Оригинал: https://img-fotki.yandex.ru/get/470815/ … 9_orig.png

https://img-fotki.yandex.ru/get/243077/158289418.46f/0_1814d4_506785ab_XL.png

Последовательность (VPVPAAT)*n образует программную 5232532-спираль (семидольный размер)

https://img-fotki.yandex.ru/get/233044/158289418.46f/0_1814d5_2177ec3b_XL.png
Программная 5233-спираль

https://img-fotki.yandex.ru/get/756497/158289418.46f/0_1814d6_49ee9f59_XL.png

Последовательность (APP)*n образует программную 232-спираль

27

Re: Формы, механизмы, энергия наномира - 90

Заказ 20170905_012:

https://www.ncbi.nlm.nih.gov/protein/38 … XBU142C016

https://www.ncbi.nlm.nih.gov/nuccore/76152004#

>CH476735.1 Rhizopus oryzae RA 99-880 supercont3.4 genomic scaffold, complement 3621 nucleotides
atgtctgatttctttgggagctttagaaaaaagaaaaatcatggacaatcttcagcaact
tctccaagagcctctattgatagcggctcaaggcgtagtctggggccattcgatggcaaa
gtcgaggaaaacatgccaaattctgatgagcaaatagaagagttatttgatcagatgctt
gcacgaagaggtttagatgaagaaaagagaaaacctttaaaatcacagcttgacgtcaaa
accaaatgggcaatgatagttcaagatcgtaaagcagagttatctgtctcaggaagaaca
gttgtcgtagaagggcaagatgatcaaccacatcttattaatgttttgtctgatttggca
ggcgaaatgtggtcagctactaaagactcgactgtccgagctgttgagagacattcaaac
cggtacagccatttaggtccttctcagtctttgtcatcgtcgacacatacacattcaatc
tcatccagcgctcctaccgccataactgcttatgatggacctttgccttctgacaaaaat
acaccagagttttatattagaaagtttatggaggcagacttgagagctgttacaccagca
cttgccaataatctggaagttagtttaagaactcgaccagtagattgggttatacggttt
atagagcttaagggcttacgggttctttccaatggactatcttttttgaataaaaaatca
gaaagaaaagggcaaatattagaattggaaattgaactcgtaaaatgtatcaaagtattg
gtgaattctagatggggtgctcgtgatgccatcttaaacccagaatacatccattacttt
gttttttctattgtctgtcctcaatggcaaacaagaaaaataatatgtgatatgcttctg
tttatgtgccactgtgatgttccacttggtcatagatatgttatgcaaggatttgaattt
ctacgccaacataaaaacgatatcggcatttttgattcatggcttaaagatttcgaaaac
actttagatgggaagcgtaaaattagtaggagtgggtcagtggatgattatcaaaaacta
ggtgtttatgtgccaccagacaatcataccgttgaatatgctttggagaaacttgatgat
ccggcactttatgaccaaatggaaaaatatcgaagaagagcagaaagtgacttagatgaa
gcatttggcgatgaaatatcaatgtacaccgatgtttctcagccaaatgaattactagaa
cttattctggataatattgccgacgcaccgaatgcattacactatttgctacaaaccttt
agaagcatgcttttaattaaaggggatgcagataaaaaaacacactatcatcaagcaatt
agtgagattgtatcaaatattgttatggaccgcagaaatagtgttacagtcgaagagttg
ggagcatcggcttttggtatttctgtcaacaatatgattggaaagttcaatgaactcgat
cgccttcaggaaatagcaagatctgccgaagaggataaggaaaattcaataagattagct
gccgaaaatagggaactcagacaacaaattgagaacttgatgtcaaccaaaggctcagac
acaaggaattataagatagaaaacgttgctatacgagctttattgcaacaatcaaatagg
actatagtcatgttacaggaaaagcttcgtgaaaaatctgatatagatgaaaattacgag
gatgacaatcagataccacaagtttctgcacctattgtagtaggagacgaatggaagtgg
tctggaagaaaaccagataatatcacaccacttcgtcccatttctacgccttcagcggaa
agcaaaacaccggacgctactactaaagaaaccggtgatatccctcctgctccttctttt
aaggctggtcgagaaacatcagtagcaactgaaatccctatacctcctccaccagcacct
ccagctccaccagctccaccagctccaccagctccaccagctccaccagctccaccagct
ccaccagctccaccagctccaccagcacctccaccaccaccaggggccgctggtattcct
gctcctcctccgcctcctggtagcttcggtggtccgcctcctcctcctcctccgcctggt
gcacctaaaggacctatggcacctgctgttcctttggggccagttcgtaaagaacttcga
cactatccacaaatcaaactaaaaaacttacagtggcagaaactggatgctcgtggagtt
aacaacactgtttgggtattgaatggtgtcaatgaaaccgagattgaagacgatttggat
aaatttggtgtattcgaaaaaattgtaacactgtttccggctaaggcaaacaatttcttt
gagaagagaataaaggctaaagtagaagaaaaaaaagatgctattaaattcatgtccaaa
gacaagagtcgaaatattaatctagctatcttgcccaaatgtaaagcctttgaatctttt
gttgaagtacgcaaggcgattatgaaaatagacgatgctttatgtacggatacgttctta
gggaaccttataaactttcttcctaccaaagacgataatttaactttgatgcaaaaattt
ttggaaggaccacctgaagcctgtaacgagcttgatattcctgaacaattcactattgag
gtaacagttcagttttgggaaaggattgaccaactggaaaatcttatactcgttattggt
aattacatgaacgcacaaagtcttcaaggtggagcatttggtatgcgcatttcaagcatt
aataagcttgttgatacaaaggcatctaatacatcatctttgaatctcttgcatgttgtg
gtcggtgtgactagacgccaatttcctcacttgcttgaatttttggtagatctgaaatca
attgagcaagcttctagaattatggctagtattaatgacttaattcagcaatataccgaa
atgagaaaaggattaaaagatctagctttagaactaggaaccagatggcaacctgaagac
gtgaatcttgatgaagacgataaattccgtgacatcatgacgaaatacaatgaagatgct
agtatacgcttccaagttcttgagtcactctatgtaaacatggatgctaagtggaaagat
gctatggtttattatggtgaaaatccaaaggtgatgagacctgatgacttcttttcaact
tttgctcgatttgtagtatcttggaaggcatgttttaagcgagaagcatctattgccgaa
gaaaagatggctttgaagcaagaacgagaggagaagagaaagcgtgaagaagaagagaga
aaagaacgcatgagaattaagaaagaaaaggcagaagcagctctgaaagagaagagagca
cctgttgaaggcattgataccagcggcgaaggagaaaatgatagatgcatgatggatagt
ttattagataaattaagaaacggtgaagtagaggtccgcactaccagacgccgtagtaaa
aagcaaagagaagggcaagaagatgataatgacggcagtgtatctgccgctgacttacta
aagagtcttgagtcagtataa

Результат:

https://img-fotki.yandex.ru/get/237726/158289418.46f/0_1814d8_bfec78a2_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/237726/158289418.46f/0_1814d9_8661004b_XL.png
Оригинал: https://img-fotki.yandex.ru/get/237726/ … b_orig.png

https://img-fotki.yandex.ru/get/370155/158289418.46f/0_1814db_5c2676cf_XL.png
Последовательность (APP)*n образует программную 232-спираль

28

Re: Формы, механизмы, энергия наномира - 90

ПРОДОЛЖЕНИЕ, начало здесь http://nanoworld.org.ru/post/62290/#p62290

https://img-fotki.yandex.ru/get/484172/337362810.58/0_218e83_22d36044_L.jpg
https://youtu.be/IU815fOMwsc

https://img-fotki.yandex.ru/get/404236/337362810.58/0_218e84_eb9ec609_L.jpg
https://youtu.be/fbLW9FKVzWw

https://img-fotki.yandex.ru/get/241199/337362810.58/0_218e85_d5377e98_L.jpg
https://youtu.be/l-g86_jmfwE

https://img-fotki.yandex.ru/get/517809/337362810.58/0_218e86_98486181_L.jpg
https://youtu.be/M9uZjr2LMEU

29

Re: Формы, механизмы, энергия наномира - 90

Маршрут: из Туапсе до Сочи и обратно

https://img-fotki.yandex.ru/get/373630/337362810.5f/0_21958c_20fcfc1e_L.jpg
https://img-fotki.yandex.ru/get/373630/ … e_orig.jpg

https://img-fotki.yandex.ru/get/756497/337362810.5f/0_21958b_c8654b33_L.jpg
https://img-fotki.yandex.ru/get/756497/ … 3_orig.jpg

Туапсе: хачкар в церкви Алексия Митрополита Московского

https://img-fotki.yandex.ru/get/371487/337362810.59/0_218f27_aa731de0_L.jpg
https://img-fotki.yandex.ru/get/371487/ … 0_orig.jpg

и дольмен (настоящий) во дворе краеведческого музея

https://img-fotki.yandex.ru/get/361460/337362810.59/0_218f28_b59873f9_L.jpg
https://img-fotki.yandex.ru/get/361460/ … 9_orig.jpg

и все рядом на одной горе впритык с мемориалом "Горка героев"

http://wikimapia.org/#lang=ru&lat=4 … 0%B5%D0%B9
44°05'49,9"N 39°04'17,4"E

https://img-fotki.yandex.ru/get/470815/337362810.59/0_218f26_7d293f69_L.jpg
https://img-fotki.yandex.ru/get/470815/ … 9_orig.jpg

https://img-fotki.yandex.ru/get/766539/337362810.58/0_218eed_81b7b144_L.jpg

https://img-fotki.yandex.ru/get/477095/337362810.59/0_218f12_d524724c_L.jpg

https://img-fotki.yandex.ru/get/370155/337362810.59/0_218f14_31eb2218_XL.jpg

https://img-fotki.yandex.ru/get/369087/337362810.59/0_218f0f_500af43d_L.jpg

https://img-fotki.yandex.ru/get/370846/337362810.59/0_218f1d_4c3dd499_L.jpg

Оригинальные камни от выпаривателя

https://img-fotki.yandex.ru/get/769006/337362810.59/0_218f18_9a01dd33_XL.jpg

https://img-fotki.yandex.ru/get/225650/337362810.58/0_218eec_f0409e6f_L.jpg

https://img-fotki.yandex.ru/get/369087/337362810.58/0_218ef5_63ae7258_L.jpg
https://img-fotki.yandex.ru/get/369087/ … 8_orig.jpg

А что здесь делают каменные шары (конкреции)? Наверное музейные работники думают что ими пушки стреляли ...

https://img-fotki.yandex.ru/get/372788/337362810.58/0_218eef_5daf876c_L.jpg
https://img-fotki.yandex.ru/get/372788/ … c_orig.jpg

https://img-fotki.yandex.ru/get/517808/337362810.58/0_218ef8_8c3afa4_XL.jpg
https://img-fotki.yandex.ru/get/517808/ … 4_orig.jpg

https://img-fotki.yandex.ru/get/244821/337362810.58/0_218ef3_78a678a3_L.jpg
https://img-fotki.yandex.ru/get/244821/ … 3_orig.jpg

Дольмен похоже настоящий - не привезенный (перевезенный). Отсутствуют щели, которые всегда появляются когда люди разбирают перевозят и собирают.

https://img-fotki.yandex.ru/get/766539/337362810.58/0_218ef7_9b78532e_L.jpg
https://img-fotki.yandex.ru/get/766539/ … e_orig.jpg

https://img-fotki.yandex.ru/get/769006/337362810.58/0_218efe_ca784919_XL.jpg
https://img-fotki.yandex.ru/get/769006/ … 9_orig.jpg

https://img-fotki.yandex.ru/get/766539/337362810.58/0_218efc_5ec408c1_XL.jpg
https://img-fotki.yandex.ru/get/766539/ … 1_orig.jpg

https://img-fotki.yandex.ru/get/245409/337362810.58/0_218efa_504c83e1_XL.jpg
https://img-fotki.yandex.ru/get/245409/ … 1_orig.jpg

https://img-fotki.yandex.ru/get/237002/337362810.59/0_218f0d_8e1ba0d7_L.jpg
https://img-fotki.yandex.ru/get/237002/ … 7_orig.jpg

Уникальный дольмен - дырка и ложная дырка на соседних стенках, обычно они напротив друг друга. Жаль что не написано где такой находится. А мост на Индюке (см. ниже) я знаю где и скоро к нему поеду (в отчете будет пост про Туапсе, проба 94 и мост на станции Индюк).

https://img-fotki.yandex.ru/get/205820/337362810.59/0_218f0c_d5d8e252_XL.jpg
https://img-fotki.yandex.ru/get/205820/ … 2_orig.jpg

https://img-fotki.yandex.ru/get/470815/337362810.59/0_218f03_c3f40c16_L.jpg
https://img-fotki.yandex.ru/get/470815/ … 6_orig.jpg

Другие фотографии в альбоме https://fotki.yandex.ru/users/vyparivat … um/562796/

30

Re: Формы, механизмы, энергия наномира - 90

Анатолий Шестопалов пишет:

https://img-fotki.yandex.ru/get/232875/158289418.46f/0_1814dc_1cfe9371_XL.jpg

Кушелев: Очень качественная копия инопланетного девайса...

https://img-fotki.yandex.ru/get/237726/158289418.46f/0_1814dd_8bba739_orig.jpg