871

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-13_006: ailklailklailklailklailklailklailklailklailklailkl

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/bK9Q9IKHEXfXdA
Развернуть: https://yadi.sk/i/Pc2JoQBkN7bJnA
Слушать музыку сборки (MIDI): https://yadi.sk/d/IST8ufg-ewLoPA

Программная 57777-спираль строится в 5-дольном музыкальном размере.
Далее она переходит в 27575-спираль в том же 5-дольном размере.

3D модель должна показать, может ли одна из этих программных спиралей находиться внутри другой?

Музыка сборки занимательная на всех трех участках белковой молекулы.

872

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-13_007: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

https://blast.ncbi.nlm.nih.gov/

>KL670891.1:13795-13980 Manacus vitellinus isolate BGI_N305 unplaced genomic scaffold scaffold755, whole genome shotgun sequence
CTGGGTAAAGCAGAGCTGGGTAAAGGAGAGATGGGTAAAGCAGAGCTGGGTAAAGCAGAGCTGGGTAAAG
CAGAGCTGGGTAAAGCAGAGCTGGGTAAAGCAGAGCTGGGTAAAGCAGAGCTGGGTAAAGCAGAGCTGGG
TAAAGCAGAGCTGGGTAAAGCAGAGCTGGGTAAAGCAGAGCTGGGT

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/bHeAO_kEB8KNYg

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/0mzo_KICpUJdkQ

Слушать музыку сборки (MIDI): https://yadi.sk/d/i0tK38wgA5Lqww

Программная 25577-спираль

Прямо скажем, музыка странновата...

873

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-13_008: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/enAwJFDh6RMCRw
Развернуть: https://yadi.sk/i/3hURtZSWMqtNJA
Слушать(MIDI): https://yadi.sk/d/iZcZjnUID1pLIQ

Программная 25575-спираль собирается под музыку с 5-дольным размером.

Кстати, музыка местами даже очень интересная...

874

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_001: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/o5DBV7wg26RREw
Развернуть: https://yadi.sk/i/DadTWshsxXg31Q
Слушать(MIDI): https://yadi.sk/d/4sozKrutXGzmyA

Программная 57777-спираль...

Невероятно ритмичная и жезнеутверждающая музыка, которую вполне можно аранжировать.

875

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_002: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

https://www.ncbi.nlm.nih.gov/protein/XP … PPXXDB9014

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/gaeg99Td_-0iZQ
Развернуть: https://yadi.sk/i/Rtou7JK6OjD9PA
Слушать(MIDI): https://yadi.sk/d/oSr9ix-H3eP2jw

Программная 27575557-спираль переходит в 2775572257-спираль, затем в 2111111-спираль и, наконец, в 21141-спираль. Это один из самых экзотических белков, которые мне попадались...

Интереснее всего звучит сборка самой длинной программной 2775572257-спирали в 10-дольном музыкальном размере. Над будет сделать аранжировку...

876

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_003: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>LGKD01598758.1:c428-1 Octopus bimaculoides isolate UCB-OBI-ISO-001 Scaffold202981_contig_1, whole genome shotgun sequence
AGTAGATGGATTTCAAATAGATGGATTGCAAGTTGATGGGTCACAAGTTGGTGAGTCTCAAGTTGGTGGG
TCGCAAGTTGGTGGGTCGCAAGTTGATGGGTCACAAGTTGGTGAGTTGCAAATTGATGGATCGCAAGTTG
ATGGATTGCAAGTTTATGGATCACAAATTGATGAGTCACAAGTTGAAGGATCACAAGTTGAAGGATCACA
AGTTGAAGGACCACAAGTAGATGAATCACAAGTTGATGGGTCTCAAATAGATAGATTGCAAGTTGATGGG
TCACAAGTTGGTGGGTCACAAGCTGGCGGGTCACAAGTTGAAGGATCACAAGCTGAAGGATCACAAGTTG
ATGAAAGACAAGTTGATGAAACACAAGTAGGTAGGTCACAGGTAGATGGATCACATAAAGATGAGCCACA
AGTGGATA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/M-tvlmRDC157yA

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/fdhyF8zRbmMJxQ

Слушать(MIDI): https://yadi.sk/d/-S2Ef2NWIx6-Xg

Программная 222727-спираль, 6-дольный музыкальный размер, ритм коллагена.

877

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_004: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>XM_001612896.1 Plasmodium vivax Phist protein (Pf-fam-b) (PVX_003535), partial mRNA
atggatggcaacttatgtggtcgtggatgctcccatggtggttcgggaaggagcagttcc
tccttagtagcgaataagagcaattttaaaaatcgttgcactcgttcattagagcagggg
agtaaaatcattacaggtagaatctgtacaaaggttgcaaggtctagaatatttattttg
ttttttctaacccttttgaatctctttttacaaaatacgtactacacaaatgaagagggg
aaatcattttccaaattagaattaagcatcggtggatgttccaggaaattagcattagct
gaaataagacaactgagggaaagtgccactttagctagactggctcttaaaaaagaagat
agtgatcatttgaggaagtacaaagaagatttttacaagagaatggaagaaaggttgaaa
caagtaggcccagacccgttacccaattgtttgaaaaagggggataaaattactacagta
aaaaaaaaaatgcagtttgtagagccggaagagataatccagaaagggaaaacttcgaac
aggacaatgctgaaagtgaaatttgaggagcaaaatgagatggagaaaaatgagatggag
aaaaatgaaatggggaaaaatgagaaggggaaaaatgagatggggaaaaatgagaagggg
aaaaatgagatggggaaaaatgagatggggaaaaatgggaaggggaaaaatgagatgggg
aaaaatgagatggggaaaaatgggaaggggaaaaaagggaaagaaaaagatgagaaagag
aaagaagaagctcccgtggacccaatgaagcatttgaggaatgaaaaaaataaaataatg
actacagcggagttgaaaaaaaaatatgatgacattttgtacaaacatataagcaaagaa
gaaatgaaggaaattatggattccattgaagccagtgattatgataatataaggcgaagt
aagaatgtcgtttataacgaggatgataatgaccaattgccatatgattgtacgatgaga
gagattagtgagaagattacagaagattttttaagtgagatgactgcagaactacggaag
gttgtaagcccaaaggacatgtttataatctggcattatgttcaggcttttggaagagat
aaatatttaaggatgaatggggatttgtggagattgtgtggacatgtgcagaaggaatat
aacataccagatgacattaaaaaaagagaatggcaagaaatcgctggctacatgtcaagt
gagttactggataaggaacacaaagattatttagattttaaagaattagctaataaggga
tcctgcaaaaaatccaagttttacgaatttatagattctaaaaggagttcgtggaaattc
ttaacggctataatgatggattcgtggaaggaggcattaattgagagactaaaaagttac
agcatagaagaggagtaa

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/E8ZoHvGwhaDMyQ
Развернуть: https://yadi.sk/i/z5UTNWTr7K7a2g
Слушать(MIDI): https://yadi.sk/d/ICq7Hn9NjR5Lsg

Программная 44477-спираль ...

878

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_005: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>KI635767.1:c593972-592932 Plasmodium yoelii 17X unplaced genomic scaffold supercont2.52, whole genome shotgun sequence
ATGCAAGATCATTTTTTTAATGGAAAATTTAACATTTTTAATGGAACTCTTTTTGGCAATCTGTGCAAAA
TAAATGCGAATCAATATAAAGGAAAAGATTCAGAATCTGTAGAATTAAAAGATGATATCCATCTTAGAAG
TAGAAATGATAAAAACAAAAGTACACAAAACTTGGCACTGGAAGAAACTGACTCAAATATATTAAGTTAT
GGTAATGCAGAAAAAATAAAAAAAAATTTAAATTCGCAACTCATTTATTCGTATTACAACAATTTTGCAA
CAAACAAATATATCGAATATGGCCCAGATCAAAAGGGTGTAAAAAATATGCACACGTATAGACACAATGA
TAGTGAATATGGCAAGAGTGAATATGGCAAGAGTGAATATGGCAAGAGTGAATATGGCAAGAGTGAATAT
GGCAAGAGTGGATATGGAAAGAATGGCTACGGCACGAATGAATGTGGCAAGAATACACATTTAAGGAACG
TAGACAGAATTAACAACTATAATCTAAATTTAAATAATAAAGCAATAAATAAGCAATCGAATTATGAACA
TATAAAAAATAATAATAAAAATGAATCATTATTTTTTAAAGAAGATAATACAATTTATAATGAATTTAAA
AATCTAAAAAATGATATATTAGAATTACAAATTATGAATGTAAATTTACAGAAACAATTTTTAACTAGCC
ATATTTTAAATAATTCAAATGCAATACCACAACATATAATAATAAATAATAAAACTGAAGTAGCTTCAAA
TTCTCTTACTCAACTTGAAAATAACAATAATAATAATAATAATAATAACAAAAAAAAAAAAGGTCTTATT
TATTTTTTATTAAAAAAAATACTAAGCAGTAAAATAAATCAAATGCTTATTGTATCATCTTTTTTTATTT
CAATTTATATTGCTCACAAACATTGGCAACGTGCACTAAAAATAGCGGAAATCCAATCTAAAGTAAATTC
TAATTTTATTTTAAAAACTGTCAAAACGATAGAGGAGATGGTAGGAATTCGAAATCGGTAG

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/E9-rI2DEtr3fbw
Развернуть: https://yadi.sk/i/QNPrmdtZfawt2w
Слушать(MIDI): https://yadi.sk/d/4B_XU7vVjhEcTg

Программная 55777-спираль ...

879

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_006: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>XM_018268919.1 PREDICTED: Xenopus laevis spermidine/spermine N(1)-acetyltransferase-like protein 1 (LOC108719761), mRNA
atgcgtagtaaacagacgagtctgtactccagccccatctatgtgtataggaagccaagt
aggaaacagccaagtaggaaacagccaagtaggaaacagccaagtaggaaacagccaagt
aggaaacagccaagtaggaaacagccaagtaggaaacagccaagtaggaaacagccaagt
aggaccagccaagtaggaaacagccaagtaggaaacagccaagtagaaaacagccaagga
ggaaacagccaaggaggaaacagccaaggaggaaacagccaaggaggaaacagccaagta
ggaaacagccaagtaggaaacagaaaacagccaagtaggaaacagccaaggaggaaacag
ccaaggaggaaacagccaaggaggaaacagccaagagggaaacagccaagagggaaacag
ctaagagggaaacagctaagagggaaacagccaaggaggaaacagccaagtaggaaacag
ccaagtaggaaacagccaagtaggaaacagccaagtaggaaacagctaagtaggaaacag
ccaagaaggaaacagccgagtaggaaacagccaagtaggaaacagccaagaaggaaacag
ccgagtaggaaacagctaagaaggaaacagccaagtgggaaacagctcagtaggaaatag

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/KMYvn2IbLSJzHw
Развернуть: https://yadi.sk/i/6zcvCXLYof5vuQ
Слушать(MIDI): https://yadi.sk/d/usejUVBsUd7ZGw

880

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_007: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>KOB71615.1
atggcattggacaagcaaatgatgttgagtgaactgggcagcgtgatgaataaactgcagagtgctgatt
ggctcggcaagcgtccacaagcgcaagcacgcagacgcgcgaattccgaagaatgcgcgcgtctttttat
aatctcagaagtaattggttgcatggaaaagctattctccaaccaaggtcactcaaacccaggagcccaa
ggcggtgcagtaacgggaagtcagctaccaacttgtggcggatgtcgccgcggatgttgccacggccatg
ggtatggcagccagagttatggatgtagcgctccatgcgctggtgagccctactccgcgaacagcccatg
catgggcaatatgggcatgcagtgcaaccctcccaaactgtacgcagacacttataattacttaagctca
aatcttatgaagccggttgttcaagaagtttacgaagatctgaaatccatcaaccctggcaatgcagttg
tgaacaatcccattgctagtcagatgggactgcaacagcaaggtggaggagctgctatgcaaggaaacat
gcccattactcaaaatcaaatgccaggaagtaacatgggtgatcaacaaatgggttatcaacaaatgggt
tatcagcaaataggtaatcaacaaatggtaaatccacaaatgggtactcaacagatgggtactcaacaaa
tgggtaatcaacaaatgggtaaacagcaaatgggttatcaacatatggataatcaacaaattggtactca
acaaatgggtaatcaacaaatgggtgatcaacaaatgggttatgaacaaatgggttatgaacaaatgggt
tatgaacaaatgggtaatcaacaaatgggttatcaacaaatggataatcaacaaattggtaagcaacaaa
cgggtaaacaacaaatgggaaatcaacaaatggcgcagatgatggatggcatggggccaaatatcgtgaa
catgatgctgaactattcaaaccctgctgctcaacaaatggcatcaaacaatggtcaaaaatacggccaa
cataccccaggattaacaaagttcaacgaaatgttcccaggcgtaatgggtggcatggatggaggcctcg
actttgatccaatggctatagctttgcaaatgaatccagccaatcagcaacaagctgctatgaatcaaat
gcaaaagataatgaatgggaatcgaacaacacagcctccaacgataggtactaatgctgctcaagctgcg
attaatcagccacctgttaatcaacagcatattcctccgtccaaccagcaaccgatgccagtccagcccg
tagcaacacaacaaaacctacaacaaggttatacaaatgtagcgaatcaaccttatcaatcacctgagca
agtttacgggcaagttccgcaacagcaaaaccagacaccccaacaatatcagcagcagcagaatgtggat
ccaaatgctcagcaatatcaacagcaacaacataatgtagatccaaatgcgcaagcgatggtggatccca
atctcccaactccttacggaggaatgagtacaggtcctaacacggaacattaccagatgccgccacagag
ctacagtgcacctccaccaggacaacaaatgaccaaagagccaatattgcctgcggacctttccaagaac
caacctcctcctcacatgaaatatcggaggaattacgaatacaatacgctcggacagccggtcgagatgc
atccagctagactgtaccgtccagagcccgatactcatactcaacaaacattatctccacaacctgtgac
gaaacttaggaatgaccacgctagattcggtgtgaaaaataccgtcagcaagacttcactgatgggaagt
aggcctgttgggagaactcctagcagaggtcaactgcagcaaatatacaaccaatacaaaggctcccaat
cttatactgagcaaaatatcagacctgctcaaggtgctactttctcggaaggaaagatcaacgtcgcttt
ggcgaacgcaaaccagcgccgccacgtgccggtagagagagttgcaggcgattctttagcgaataaccag
atggccaacagtcaagttccagtcaaaggtcaacctatggggcataccggtgacgtggctgtggataacc
agccacatggagatattccggagccagtgctcaaaaagtgccgtaatggacttcaagacatcgtgttcac
gtcgtatccatcttcagcggcgtggtcttttcatggtaataacaaccagccacggtttttacgtgctcga
tga

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/MeIkvs0fmhDqow
Развернуть: https://yadi.sk/i/NkCLavtxHc-U8A
Слушать(MIDI): https://yadi.sk/d/gUjR8_z7tjh6uQ

57777-спираль