861

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-10_011: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/nuccore/194135600

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/mjOpijr8YEH9KQ

Развернуть: https://yadi.sk/i/vRBDDjb-qVaA_w

И снова 99-дольный музыкальный размер smile Интересно, что это за синтетический конструкт и из чего его делали?

Кстати, начинается с той же музыкальной фразы из 8 нот...

***
Заказ 2018-11-10_012: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/protein/XP … DT3PUA3015

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/QrH4-awLkbkGIQ
Развернуть: https://yadi.sk/i/7r9u0WNCszfauw

***
Заказ 2018-11-10_013: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/protein/XP … DT3PUA3015

И тут неожиданность...

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/KzWayoqVDhJv5A
Развернуть: https://yadi.sk/i/7trKgfyeONpgPg

Альфа-спиральный коллаген. Вот те на... А... просто в файле fasta сбита рамка считывания...

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/oSg7bHaG-_NUNQ
Развернуть: https://yadi.sk/i/lXkE4yx53fzujg

***
Заказ 2018-11-10_014: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/protein/EQ … DT3PUA3015

https://www.ncbi.nlm.nih.gov/nuccore/53 … nd-gaps=on

Collagen triple helix repeat protein [Ophiocordyceps sinensis CO18]

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/ecAV_bTZKy1NVQ
Развернуть: https://yadi.sk/i/2OuZ12HvzCxTAA

Теперь уже реально альфа-спиральный коллаген попался smile

***

Заказ 2018-11-10_015: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.uniprot.org/uniprot/P22576

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/78nJwfCtKIaqPA

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/9h6Y27ro14ElhQ

В этом белке присутствует 222727-спираль и длинная бета-спираль

***
Заказ 2018-11-10_016: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/protein/XP … DT3PUA3015

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/USP58ykcOpV4nA
Развернуть: https://yadi.sk/i/vZULX5f_P8_CBA
В этом белке мы видим пролиновую пи-спираль и длинный полипролиновый участок, который не является ни фундаментальной, ни программной спиралью...

***

Заказ 2018-11-10_016: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/nuccore/1434090338

***

Заказ 2018-11-10_017: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/nuccore/30 … nd-gaps=on

Caenorhabditis brenneri unplaced genomic scaffold Scfld02_64, whole genome shotgun sequence

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/DR2oXaAAGFTckw

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/-xTjZvMqNOIkog
Развернуть: https://yadi.sk/i/rpxYJQsnVlflaw

В первой половине схемы просматривается многоуровневая фрактальная квазиспираль. Очень интересно было бы сделать её 3D модель и посмотреть, что это за "монстр"...

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/yU3uxC9_A6Zbrg
При прослушивании музыки сборки (MIDI) в зоне фрактальной спирали прослушивается 15-дольный музыкальный размер.

На определенном этапе в эти ноты начинают встраиваться "инородные фрагменты":

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/vLJz7CB0zN2pjQ

И снова неожиданная вставочка:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/87tj-rG6b2HEzQ

***

Заказ 2018-11-10_018: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://www.ncbi.nlm.nih.gov/nuccore/1434081040

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/-Nc3tXo1jlVl6A
Развернуть: https://yadi.sk/i/IL4Cz0L0ujOwsw

***

Заказ 2018-11-10_019: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/QjcR7zqyygYFhA
Развернуть: https://yadi.sk/i/tPXWXjICjM-_SA

***

Заказ 2018-11-10_020: PPGPPGPPGPPGPPGPPGPPGPPGPPGPPG

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/Jb6midcgY_OgoA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/R2sV2-LGKT5WlA

862

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-11_001:

https://www.ncbi.nlm.nih.gov/nuccore/1121137565

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/QmGMohYJH9n36g
Развернуть: https://yadi.sk/i/ADbnYCTXUuaGnw
Слушать музыку сборки (MIDI): https://yadi.sk/d/oCgBgTdOl-A6VA

В структуру этого белка входят фундаментальные, программные и фрактальные спирали с разным числом фрактальных уровней. Очень интересно было бы исследовать все фрактальные уровне на 3D моделях...

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/sDsNkffXBzN2eg
Ноты, напоминающие мелодию детской песенки "Встаньте дети, встаньте в круг"

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/pAlmpcyUj-XpIw
Другой фрагмент тоже напоминает известную мелодию


***

Заказ 2018-11-11_002:

https://www.ncbi.nlm.nih.gov/nuccore/523901990

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/Buugjfttz0skZg
Развернуть: https://yadi.sk/i/tugYUm86aNYbkw
Слушать музыку сборки (MIDI): https://yadi.sk/d/sxw1ZFmY4qsoLg

Фрактальная программная 257575-спираль - основной мотив вторичной структуры этого белка.

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/-q3kGZl0MsH02A

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/dkkddUg7TwTMfg

Понятно, что здесь должны быть другими как минимум транспозиционные углы. Очевидно, что витки программной спирали должны взаимодействовать друг с другом, образуя более прочную фрактальную структуру. А дальний порядок восстановить ещё труднее. Видно, что полувитки программной 57-спирали поворачиваются на кодах "2" примерно на прямой угол, а значит участки программной спирали могут образовать реберный многогранник или аналогичную реберную конструкцию. Остатков Pro в структуре не встречается, поэтому скорее всего это - жесткая конструкция, хотя за счет транспозиционных связей может где-то и гнуться...

Файл dne: https://yadi.sk/d/-0Iz2pmQ7dylIA
Файл pdb: https://yadi.sk/d/Dg5DmqB_koZtbQ

***

Заказ 2018-11-11_003:

https://www.ncbi.nlm.nih.gov/nuccore/486856344

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/sgGxHc48w3XwsQ
Развернуть: https://yadi.sk/i/VpRJfrQ5Q79Cpw
Слушать музыку сборки (MIDI): https://yadi.sk/d/w-liOILQmNSBGg

Музыка не балует разнообразием (чередуются 2 ноты), зато вторичная структура меняется очень занимательно...

***

Заказ 2018-11-11_004:

https://www.ncbi.nlm.nih.gov/nuccore/120862586

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/LHqNxUCF4WaToQ
Развернуть: https://yadi.sk/i/AmhzQrGNq58-_w
Слушать музыку сборки (MIDI): https://yadi.sk/d/un_4y6J2v1aqMw

***

Заказ 2018-11-11_005:

https://www.ncbi.nlm.nih.gov/nuccore/94 … nd-gaps=on

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/m58m2fN9_dfvyA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/FpbbLOk7Fot4cA
Развернуть: https://yadi.sk/i/fl2w6RgiRjsSfQ
Слушать музыку сборки (MIDI): https://yadi.sk/d/zibFM2cLn0nKDQ

***

Заказ 2018-11-11_005...7:

https://www.ncbi.nlm.nih.gov/nuccore/486856007

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/-hGNVJNacb16PQ

Развёрнуто (фрагмент)

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/kXExHRQ7FkG91A

Любопытный переход альфа-спирали в пи-спираль и обратно. РСА покажет в этом месте сплошную альфа-спираль...

***

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/LsRBrkEGFtj_KA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/EiHJilsHPVFdnA

Аналогичные фрактальные 257575-спирали

863

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-11_008:

https://www.ncbi.nlm.nih.gov/nuccore

Halothiobacillus neapolitanus c2, complete genome
GenBank: CP001801.1

GenBank Graphics
>CP001801.1:c1856458-1856324 Halothiobacillus neapolitanus c2, complete genome
ATGAGCCATGAAATGAACCATGAAATGAACCATGAAATGAACCATGAAATGAACCATGAAATGAACCATG
AAATGAACCATGAAATGAACCATGAATTAAGCCAAGACAGAATTCACAAACCGGGCAGGGCATGA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/duXOk1cSiHG0Rw

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/bMaRLcypNyiECg

Слушать музыку сборки (MIDI): https://yadi.sk/d/vLfQVDpc4JKsQg

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/fMzqwFfODjDO5A
После музыки сборки программной 5577-спирали (минорный вариант "Петушок погромче пой") звучит вполне гармоничная мелодия 7 нот.

864

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-11_009:

https://www.ncbi.nlm.nih.gov/nuccore/1496281431

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/6R5eSZ2p8aMokw
Развернуть: https://yadi.sk/i/wG4i-n6441yITg

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/rghWG-W-C-RgdA
Любопытный переход от пи-спирали к альфа-спирали через метионин. Это позволяет изменить изгиб между пи- и альфа-спиральными участками.

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/0QumBZfSFHD3uQ
И музыка сборки местами неплохая...
Слушать (MIDI): https://yadi.sk/d/cwz08GJy7m_2_A

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/XEoL0Uj7prB0tg
А это вообще - "песня" smile

865

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-11_010:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/MERZgdZPnvP6Sg
Развернуть: https://yadi.sk/i/Wr2MHoivSToEUg
Слушать музыку сборки: https://yadi.sk/d/mriFo8tgCa8n2Q

Программная 11111117-спираль строится в 8-дольном музыкальном размере...

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/58sO7-iiOiEEBg
Можно сказать, готовая народная мелодия smile

866

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-11_010:

https://www.ncbi.nlm.nih.gov/nuccore/397588888

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/HIt5W2rO_zTbwg

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/VFj5ncjV4bKJ0g

Музыка сборки (MIDI): https://yadi.sk/d/ZBCLVa3v2_--zg

Программная 2575-спираль

867

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-13_001:

https://www.ncbi.nlm.nih.gov/nuccore/569436631

>ETO35202
atgggattctgggatgggacttgcgtcgggctttttgtggtcggagacgccgaggggaag
gccgtgagcgaggcaataggtaagcgagtaggccgtctgctgggatgtttcgtcgggggt
ttcgtcggggatttcgttggagatttcgttggagatttcgttggagatttcgttggagat
ttcgttggaaatttcgttggagatttcgtcggagatttcgttggcaattggcttggtagt
ttagtcggaggtttacttggtaatttggttggaggtttacttggcaatttggttggaggt
ttacttggcaatttggttgggggtttggttggagatttggtggttggtggcttagttgga
gatttagtggttggtggcttagttggaagtttagttggagatttggtggttggtggtttg
gttggtggtttggttggaagtttagttgggggtttagtggttggtggtttggttggtggt
ttggttggaagtttagttggaagtttagttggttgtttgctcgggggtttggttggtgat
ttggttggtagcttggttggtggtttggtggttggcggtttggttgatttcttttttgtt
gttggggctgctgttgttggggctggcactgctcttttttga

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/g1Zx-SZl5cUUiw
Развернуть: https://yadi.sk/i/J4M8gOsGbJRRcA

Слушать музыку сборки (MIDI): https://yadi.sk/d/MzhMTsFUmC0zmw
Я бы сказал, что музыка вполне подходит для аранжировки.

Программная 2757-спираль переходит в 57- и эволюционирует далее...

868

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-13_002:

>oxa49229
atgtatcttatcatccgtcccgtggaattttccgtgacatccctgcattctgattggctg
ttgaaattctggctccaccaatcgggttataatttcggttatgatttcggttatgattta
ggttatgatttcggttatgatttcggttatgatttcggttatgatttcggttatgatttc
ggttatgatttcggttatgatttaggttatgatttcggttatgatttcggttatgattta
ggttatgatttcggttatgatttcggttataatttcggttatgatttcggttatgattta
ggttatgatttcggttatgatttcggttatgatttaggttatgatttcggctatgatttc
ggctgttatgatttcggttatgatttaggttatgatttcggttatgatttcggttatgat
ttcggttatgatttcggttatgatttaggttatgatttcggttatgatttaggttatgat
ttcggttatgatttcggttatgatttcggttatgatttcggttatgatttaggttatgat
ttcggttatgatttaggttatgatttcggttatgatttcggttatgatttcggttatgat
ttcggttatgatttaggttatgatttcggttatgatttcggttatgatttcggttatgat
ttaggttatgatgtcggttatgatttaggttatgatttcggttataatttcggttatgat
ttcggttatgatttcggttatgatttcggttatgatttaggttatgatttcggttatgat
ttcggttatgatttcggttatgatttaggttatgatttcggttatgatttcggttatgat
ttaggttatgatttcggctatgatttcggttataatttcggttatgatttcggttatgat
ttaggttatgatttaggttataatttcggttatgatttcggttatgatttcggttatgat
ttcggttataatttcggttatgatttcggttatgatttaggttatgatttaggttatgat
ttcggttatgatttcggttatgatttcggttatgatttcggttatgatttaggttatgat
ttaggttatgatttcggttatgatttcggttataatttcggttatgatttcggttatgat
ttaggttatgatttaggttatgatttcggttatgatttcggttatgatttcggttatgat
ttaggttatgatttcggttatgatttcggttatgatttaggttatgatttcggctatgat
ttcggctgttatgatttcggttatgatttcggttatgatttaggttatgatttcggctat
gatttcggttataatttcggttatgatttcggttatgatttcgggtataatttcggttat
gatttcggttatgatttaggttatgatttaggttatgatttaggttatgatttaggttat
gatttcggttataatttcagttatgatttcggttatgatttcgggtataatttcggttat
gatttcggttatgatttaggttatgatttcggttatgatttcggttatgatttaggttat
gatttaggttatgatttcggctatgatttcggttatgatttaggttatgatttcggttgt
gatttcggttttgatttaggttatgatttaggttatgatttcggttatgatttcggttat
gatttcggttatgatttaggttatgatttcggttatgatttcggttatgatttaggttat
gatttcggctatgatttcggctgtgatttcggttatgatttaggttatgatttcggttat
gatttcggttatgatttaggttatgatttaggttatgatttaggttatgatttaggttat
gatttcggttataatttcggttatgatttcggttatgatttcgggtataatttcggttat
gatttcggttatgatttaggttatgatttcggttatgatttcggttatgatttaggttat
gatttcggttatgatttaggttatgatttcggttatgatttcggttatgatttaggttat
gatttcggttataatttcggttatgatttcggctatgatttcggctgtgatttcggtttt
gatttaggttgtgatttcggttatgatttcggttatgatttcggttatgatttcggctat
gattccggttataatttcggttatgattacggttgtgatttcggttatgatttgggttat
gatttaggttatgatttaggttatgatttaggttatgatttaggttatgatttcggttat
aatttcggttatgatttcggttatgatttcgggtataatttcggttatgatttcggttat
gatttaggttatgacttcggttatgatttcggttatgatttaggttatgatttcggttat
gatttaggttatgatttcggttatgatttcggttatgatttaggttatgatttcggttat
aatttcggttatgatttcggttatgatttcggctgtgatttcggttttgatttaggttgt
gatttcggttatgatttcggttatgatttcggttatgatttcggctatgattccggttat
aatttcggttatgattacggttgtgatttcggttatgatttgggttataatttcggttat
gatttcggttatgatttagattatgatgtcggttatgatttcggttatgatatcggttat
gatttaggttatgatttcggttatgatttcggttatgatttcggttatgatttcggttat
gatttaggttatgatttcggctatgatttcggttatgatttaggttatgatttcggttgt
gatttcggttttgatttagattatgatgtcggttatgatttcggttatgatatcggttat
gatttaggttatgatttcggttatgatttcggttatgatttcggttatgatttcggttat
gatttaggttatgatttcggctatgatttcggttatgatttaggttatgatttcggttgt
gatttcggttttgatttaggttatgattaa

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/iF6xqjvAk7tF6g
Развернуть: https://yadi.sk/i/ORzZ_TxGW4LHZQ
Слушать музыку сборки (MIDI): https://yadi.sk/d/OIYHrFVRz5-vyA

Программная 5777-спираль, переходящая в квази-спираль.

Музыка вполне современная smile

869

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 103 036

Заказ 2018-11-13_003:

https://www.ncbi.nlm.nih.gov/nuccore/LN … to=1448081

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/_AQcYsijxM6jyw
Развернуть: https://yadi.sk/i/xDGY9O8vnLUhGg
Слушать музыку сборки (MIDI): https://yadi.sk/d/9YOf9XyJu1tXdA

Заказ 2018-11-13_004:

https://www.ncbi.nlm.nih.gov/protein/OX … P93DP6B014

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/BxcswjRDYDFAtw
Развернуть: https://yadi.sk/i/9nR7ANPXzKyvyw
Слушать музыку сборки (MIDI): https://yadi.sk/d/m24E6ztEEUEW1g

Прикольная музыка. Сначала одна спираль собирается в 5-дольном размере, потом другая, потом опять первая.

870

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-13_005:

>FNSW01000001.1:c4342890-4342456 Paenibacillus sp. GP183 genome assembly, contig: Ga0132018_11, whole genome shotgun sequence
ATGTATGTTAATGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACT
TTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGA
CTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTGGACTTTGGTTTG
GACTTTGGTTTGGACTTTGGTTTGGACTTTGGCATTTGTACCTTCGCTTTGGCACTTGCTTGCAATCAAG
CCGTACACAGCAGACTAATTACCACTGCCTTTGTTATCTCCTCGATTACTGTCCCCTTGCTTCTTATCAG
CTTGTTGGTCTTTATTAGTTCCGTCCGAATTCGAGTTGTTCCCATCCTTTGGTTTAGGTTTGGGAGAAGG
CGTTTTTGTAGGTGA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/fb9WktWEZfoyAQ

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/5I1UE3lCuBlD2g

Слушать музыку сборки (MIDI): https://yadi.sk/d/r6sPkNC-H9nrnw

Программная 5577-спираль строится под вполне гармоничный перебор...