811

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 738

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_02:

https://www.ncbi.nlm.nih.gov/nuccore/1183860967

>DAA82270
atgaaaaatagcagaaaacgtagtaaacgaattgttgcatcagcattaacagctctattt
attgcgcaacaatcaatgctattatccgttgttgcaagtgacatcacaggcgtaactggg
aacaatggagtatataatattaacccaagtacagcaaaaggtgatattggtttcaggcac
tatgaaaactttaacctatcaaaaggtgacattgcaaacttgatttataaatatggtgca
acagacatcgaaacctttgtaaatatggtagataaccaaattaatatcaatggtttggtt
aatacaatgagaaataataatttctacaatgggaaagcagtctttatttctccaaacgga
atggttgtcggagcttctggtgttcttaacgttggctccttaggagtttatacaccaaac
agcactgattataataattttaataaagaagacccaacaattgcagggcttaataattta
accaagagtgatgctaatggtgcagcacctgtaactatcaatggtaaagtcatttcttct
ggcgatgtcgaaatcattggaggaaaagtcgatattggcaaaaatgcaggaattattggt
ggcgtaaacaaaagtcaaatgaaagcaattacaagtgatgatcaagcaacagccttgttc
aataatcttgttaatacaaataatcttacaaatggaagccaatttattagtgatgaagct
ggacaaatccgaattacatctcaaggcggagtaaatgtagctggaaatattattaactac
gctactggtggagattacacaaatccaaataattcaaattatagcggaatcaaaatttta
agtcacaactcatcaacaccaaatggagatataatttcttctggaattaacgtttctgga
acaattgcaaatgcaaaaggacttgttcaacttgataacaatggcggagatatagatatt
tctgggaatattaagaataatggaacaacaaatatttataatacaccatacgcactatat
tctgacagtaccaagaatgaaaaaattgcccaaaattctggattaaaaatttctggaaat
attgatactaaaggcgatttaaatattgaaaacagaggcggaaaaggtcttaatatctct
ggaaatatcaatcatgatggggatgcaaatatctcaaatggttatactgataatgatatt
tttggctacgatggtaacaattcaaaagttaacacaggagctttagatatttctggggat
gttaatatctctggaaactctaacattataaactaccaacacggtgttgatggtttaaat
gttacaggcacagttaaaactggaggagatgcaacatatacaaaccacggtaaagctgga
ttaaatattaaagataacggaagcatttcttcaaataatcttgcaatgttgaacactggt
gctggaggtttaaatatttctggttccgcaaagaataataaaactgcaacagttacaaat
aaagctggagatttaacaattggaggaacatttgttaacggaggagatgctacgtttaca
aatgacggaaaccaattcaacatttctggaacagtaacaaataaattaaccgatgcagaa
aaagaattcggcaccattaacatggttaataatggtgaaggcggatttgttattgaaaac
agtggcaacgtaaatgcagaaagctctaatttatcaattacaaacaacgctggaaatctt
gacattaatggttctgttaaaaacgatggaggcaaaaaccttacaaacaagaccgaaatt
ttaaatgatggcaagacattaaacattggcaaaactggtaaagttaatacatctggaagc
ctagcaattacaaataacggcgaaggcggaatgaacattgatggttccgtaaataatgac
aactctgcaacgactgctaatgataaaatcgcattcaaggatgctaacaatacaaccatt
acaaatacagcaggaacattgaaagttgacggaaatgtttcttctaatacatcagaatta
acaatgacaaatgagggaaaaacatttgaaatcaacggaaatatttctggtacaaacaac
aatgtaaaccttattaacaaaaatggagcattagacctaaacagttctggaagagttaaa
tcaacagatgatattaatattacaaactctggtaaaggcggagttaatgttaaaggtcta
gcaaatgcaaagaaaaatgttaacatcgacaacaaagacagtaatgttgtaattggtgat
aaaacagaaaataacaactatgtaacagctggcgaaaatatcaatatcgcaattaacaat
ggaagcttactaaactatggagttgtaaaaacattactaaatgctggtggcgacctaaat
atgaacgttacagatggcacaatcggtcttgatgttcaacaaaaagcttgccaaggctct
ggatgtactggtattgggccaaaagctgatggttcaagagatttcacaaaatcaattaac
gcaaatatcaagggtaaagttaatgccacaaccaacaaggcaaacaaaccagatgattta
gttatcaattacgcagcaattgattccgatatgaacatcgataaaatcaaagcagacgga
aaagttatcttaactgttgacgatttagatcatatcacaacgggtaaagctagcggcaca
agatataatatgattaacgctagcactcaagaaaacggaacaaatatcattggtaaaggt
atttcattaatctctaatggcagcattggaacaaaagataatatggtaacattcatccaa
acagatgctgataaccataaaatggatggacttgcaaataaaaacatttacttaaaagaa
aatagcttcaatgaatatggcagagatggtgaagttattaaaaatgcgatatgtacaatg
attgcaagagaaggggatttataccttgaacttgcaggaaatactacaattgacaatatc
acagctgaaggtgatatgacagttatcactagaggtaaaaacctaacaatcaccaactta
ggtcatattgaagatccagcaatcatcaatggagaagattactttggacctcaccatgat
ggatatgaatttgataaaggttacgacaaggatgactacaaatcagaaattcttccaaac
aatgtaactcttaaagctcttgacattaaccacgttatcagaccaacagaagaacttgtt
gacggagcacatgaagcctgggcagattcaacagttagagtaacaaatgcggttcttgat
aatgggaaaatggatattaccgcagataatatctatgcgaatggcgtatatgttcacttt
ggtaaaaatggatacagcaaaaaaccagatgactcaacaaacaaaatgattggtgttgac
ggagatccaatgggacactcagttagaccagatgatgttgaaggaattggaagaactgaa
actgaaagaaactactatgatgaagatgatactccactagttccagatacagataccgac
ccagatactgatactgacactgatactgacactgatacagatactgacactgatactgac
actgatacagatactgacactgatactgacactgatacagatactgatactgatacagat
actgatacagacactgatacagacactgatacagatactgatactgatactgatactgat
acagacacagatacagatacagatactgatactgatacagatactgatacagatactgac
acagatactgatacagatacagacactgatacagatacagatacagatacagacactgat
actgatactgatactgatactgatactgatactgatactgatactgatactgatactgat
actgatactgacactgacactgatactgatactgacactgatactgatacagatactgat
gatgaaccaaatatcgattctgatgcagatggaagacaagcatttattcaaagaaaaatc
ttagatgataatgttgattctatcgataaacgtcaatatatgagatacagtgtttctgat
aacaaaaatccagttggattagaaccaggacacggaattgaaggattacttgatgtatct
agaggcggtattgcagtagtccacaataatgatttaaaagttggagatgttgttcctgta
cacatttcatacggaggtttagacatcaaagcagatgtaaaagttatctcttcaaccgac
catagagcaggtgcaatgtttgttaacttagaccaatcaactgcaaaccaattgttatac
ttaaatatgattttagacgatgtaaatcacatctctctaaatccgtaa

Результат:

https://img-fotki.yandex.ru/get/765007/158289418.4c9/0_18cfd7_48042da6_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/476282/158289418.4c9/0_18cfd8_1efb19_XL.png
Оригинал: https://img-fotki.yandex.ru/get/476282/ … 9_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/509885/158289418.4c9/0_18cfd9_464e8e3_orig.png

812

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 741

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_03:

А теперь посмотрим весь геном:

https://www.ncbi.nlm.nih.gov/nuccore/1183860967

https://img-fotki.yandex.ru/get/760582/158289418.4c9/0_18cffb_18dab18e_orig.png

Все белки пи-спиральные ...

Типичный представитель:

https://img-fotki.yandex.ru/get/478076/158289418.4c9/0_18cffc_5ee57199_orig.png

https://img-fotki.yandex.ru/get/877959/158289418.4c9/0_18cf8b_3d717cd5_orig.png

813

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 750

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_04:

https://www.ncbi.nlm.nih.gov/protein/CC … F62A3UZ015

https://img-fotki.yandex.ru/get/369434/158289418.4c9/0_18d021_b5cb7255_orig.png

Белки, закодированные в этом геноме, разного типа.

https://img-fotki.yandex.ru/get/769006/158289418.4c9/0_18d022_f96fee9d_orig.png
Самая интересная структура у этого белка.
Обратите внимание, что последовательность n*(DT) образует очень непростую вторичную структуру...

814

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_05:

https://www.ncbi.nlm.nih.gov/protein/OL … F62A3UZ015

https://img-fotki.yandex.ru/get/510105/158289418.4c9/0_18d025_a7831692_orig.png

И снова мы видим "голубой геном", т.е. все структуры пи-спиральные.

https://img-fotki.yandex.ru/get/509885/158289418.4c9/0_18d026_812d91c2_orig.png

А это самый интересный белок с последовательностью n(TD)

815

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_06:

https://www.ncbi.nlm.nih.gov/protein/OX … F62A3UZ015

https://img-fotki.yandex.ru/get/373867/158289418.4c9/0_18d027_d7d27c83_orig.png

Почти "красный геном"

https://img-fotki.yandex.ru/get/749077/158289418.4c9/0_18d028_b6eb5cd1_orig.png
БОльшая часть белков альфа-спирального типа

https://img-fotki.yandex.ru/get/476282/158289418.4c9/0_18d029_ba8318a9_orig.png
Однако белок с аминокислотной последовательностью n(TD) больше "голубой", чем "красный". Но в нём нет пи-спиралей. Точнее всего одна. Много одиночных пи-кодов, т.е. неполных витков пи-спиралей. Тем не менее вторичная структура кажется светло-голубой из-за обилия одиночных пи-кодов.

816

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 773

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-08_01:

https://www.ncbi.nlm.nih.gov/genome/?term=salamander

https://www.ncbi.nlm.nih.gov/nuccore/PGSH00000000.1

Результат:

https://img-fotki.yandex.ru/get/368796/158289418.4c9/0_18d072_81e247e7_orig.png

https://img-fotki.yandex.ru/get/766539/158289418.4c9/0_18d077_6c732734_orig.png
Белок "по имени Серл" smile

https://img-fotki.yandex.ru/get/509885/158289418.4c9/0_18d093_cc577a11_orig.png
А здесь мы видим программную 74447527-спираль, образованную аминокислотной последовательностью n(APVVRAS), которая строится под музыку в семидольном ритме.

Видна и другая программная 741112555755-спираль, образованная аминокислотной последовательностью n(PVKKSSPVKRKS), которая строится под музыку в 12-дольном ритме.

https://img-fotki.yandex.ru/get/1027630/158289418.4c9/0_18d0b9_3c50a64c_orig.png
А это белок по имени PWR smile

https://img-fotki.yandex.ru/get/1029133/158289418.4c9/0_18d0ba_a11b164b_orig.png
Большинство белков в геноме этого вируса "красные", т.е. преимущественно альфа-спиральные.

https://img-fotki.yandex.ru/get/478621/158289418.4c9/0_18d0bb_2449aa03_orig.png
Но есть и "слегка красноватые" smile

https://img-fotki.yandex.ru/get/373752/158289418.4c9/0_18d0bc_2e4fbb2_orig.png
И голубоватые с единственной пи-спиралью

817

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 96 374

Slype, 2018-03-01:

Главный: Можешь определить структуру белка соматотропина человека?

Кушелев: Заказ 2018-03-01:

Структура белка соматотропина / Human growth hormone gene (HGH-N)

https://www.ncbi.nlm.nih.gov/nuccore/M1 … rt=genbank

Human growth hormone gene (HGH-N)

>M13438
atggctacaggctcccggacgtccctgctcctggcttttggcctgctctgcctgccctgg
cttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatg
ctccgcgcccatcgtctgcaccagctggcctttgacacctaccaggagtttgaagaagcc
tatatcccaaaggaacagaagtattcattcctgcagaacccccagacctccctctgtttc
tcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagag
ctgctccgcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcagg
agtgtcttcgccaacagcctggtgtacggcgcctctgacagcaacgtctatgacctccta
aaggacctagaggaaggcatccaaacgctgatggggaggctggaagatggcagcccccgg
actgggcagatcttcaagcagacctacagcaagttcgacacaaactcacacaacgatgac
gcactactcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgag
acattcctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttctag


https://img-fotki.yandex.ru/get/909751/158289418.4d1/0_18e707_e01b0128_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/1003890/158289418.4d1/0_18e708_ed9c19ca_orig.png

https://img-fotki.yandex.ru/get/769132/158289418.4d1/0_18e70a_863897f4_XL.png

https://img-fotki.yandex.ru/get/907951/158289418.4d1/0_18e70b_ca88f6fa_XL.png

https://img-fotki.yandex.ru/get/479032/158289418.4d1/0_18e70c_215edf06_XL.png

https://img-fotki.yandex.ru/get/907951/158289418.4d1/0_18e709_cf37f341_XL.png

Музыка сборки: https://yadi.sk/d/VHbxwhfK3SwPNU

818

Re: Online service PROTEIN PICOTECHNOLOGY

Музыка сборки белка в профессиональной аранжировке

Этой мелодии больше 3 000 000 000 лет!

Слушать в профессиональной аранжировке:

https://cloud.mail.ru/public/DkYq/RbevtzUVd

https://yadi.sk/d/2A9mnmZb3SqgHL

Подробности: http://nanoworld.org.ru/topic/1930/

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a59c_2fc79d96_orig.png

**************************************************************

Формы, механизмы, энергия наномира. Сообщение 96 293

Музыка сборки белка в профессиональной аранжировке

С ДНЁМ РОЖДЕНИЯ УВАЖАЕМЫЙ АЛЕКСАНДР !!!
2018-02-27 23:28

МУЗЫКАЛЬНЫЙ БЕЛОК КУШЕЛЕВУ В ДЕНЬ РОЖДЕНИЯ.mp3

Не успел ко дню рождения закончить, но лучше позже - чем никогда )) С ДНЁМ РОЖДЕНИЯ  АЛЕКСАНДР ! ЗДРАВИЯ И ДОБРЫХ ЛЮДЕЙ ВО КРУГ ! с уважением А из  Н

Кушелев: Супер! А можно увидеть исходные ноты и ноты всего произведения? Вы в MIDI пишите?
С уважением,

819

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 97 715

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:

Как выполнить 2D визуализацию взаимодействия лиганд-белок?

Кушелев: 2D - это таблица типа такой:

https://img-fotki.yandex.ru/get/765007/158289418.4c9/0_18cfd7_48042da6_orig.png
По ней иногда можно догадаться, какие участки одной молекулы будут связываться с участками другой молекулы. Но визуализацию можно сделать на уровне 3D (в пространстве). Если будет заказ, попробую сделать. Но наша "фишка" - надёжные 2D-структуры, которые не может показать рентген. А мы можем, причём быстро, в автоматическом режиме и целыми геномами. На это и нужно делать акцент при беседе с потенциальными клиентами. Они будут говорить, что 2D-структура их не интересует, им нужна четвертичная или хотя бы 3D, но им нужно предложить для начала взглянуть на 2D структуру тех белков, с которыми они работают, пользуясь результатами РСА. Некоторые из потенциальных клиентов прозреют, увидев, что РСА не может надёжно определить даже 2D-структуру. Более того, РСА не отличает пи-спиараль от альфа-спирали. Прозревшие молекулярные биологи и есть наши будущие клиенты. А упёртые пусть не напрягаются. Не нужно на них тратить время и выворачиваться наизнанку, выполняя ручную сборку 3D и 4D-моделей. Для раскрутки нам хватит заказчиков надёжных 2D-моделей.