731

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_07:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_002946275.1 Volvox carteri f. nagariensis hypothetical protein, mRNA
ATGGCAGGCCAGGAGAGCCTGCGGGCGGACAGACAGACATGCGCACGTGCGGTACGGAAATGTGGAGATG
TGGAGGGAGGAGCTCTATGTGGAGTCCCGGTGCACCACCGGGGTGGTGTGGCAGCCCAGCCCAGCCCAGC
CCAGCCCAGCCCAGCCCTCACCGGCATGGCAGTAATCGCTGGTGCTGATCCAAGCCTCGAACGTCAAGGC
GGTCGTGGGGAAATCCTGCACCATGCGCATGCACGCGACAGACAAACATACAGACGCCCCTGGGTGAACG
ATTTCCAGAGCCACCACCACCACCACCACCACCACAATCCCCCGGGTACGGCTTTCCACGTTACTGAGCC
CAAAGCTGCTGACAAGACCCCCTCCGACTCGCCCCACACGGTAGCGATCCCTCGCTCGGCGGCTGCAGCT
GCAGCTGCACCCCGGCGGGGACCCCCACGGCGACAACAAATAGCAATAGACACAGCCACAAGAAGTAAGG
AGGCAAATGCGCCAGAGCACAGCGTCCGGCAATTGTCGCTGCCGACCGCGCTGCTGGGCGCGGAGCGCTG
GCTCGGCTTCGATGAGATCAACCTTATGCAGTTCACGTCGCTGCTGCGCGGGCTCTATCGATGTGCCTCT
GTCTCTGGAAATCAACCTAGGCAGCTATCAGAACACACAGGACACAACCTGCCGCTGTATCAATGTATTA
AGGAAGGAACGCAACGTGCTGGCAGAGCTGCTGCTTTCAACAGTGTGCACGTCGGTCCCTCCAAGAAAGG
CACCCATGTACCAAATAAAATAGCGGTGGTTGAGAATTCCTCTCGAGATGCTGTGCATCAAGATTTCCTC
CTAAATGGCCTCATACTGGCAGTTTCTTCCCCTGGCTGCCACTACCACTATACCAAGGTGCTAGATCAGC
GGATTTGCCGCACAGACCCGGGCGCCTACACGCACGCATGTCCCTACCACTACCACTACCACTACCACTA
CCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCAC
TACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACC
ACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTACCACTA
CCACTACCACTACCACTACCACCTACGTACCACACCAATCTAA

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4ad/0_187b9e_a39d7845_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/893194/158289418.4ad/0_187b9f_55c1f0c3_XL.png
Оригинал: https://img-fotki.yandex.ru/get/893194/ … 3_orig.png

Фрагмент 1:

https://img-fotki.yandex.ru/get/872977/158289418.4ad/0_187ba0_74eebb57_orig.png
Программная 25555-спираль.

Фрагмент 2:

https://img-fotki.yandex.ru/get/893240/158289418.4ad/0_187ba1_83aebd74_orig.png

Прямая альфа-спираль.

732

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_08:

https://www.ncbi.nlm.nih.gov/nuccore/LS … mask=65536

>OLP82321
atgcacgcgtctcggtgggcgggctgctttgctcggcggcggcggcggcggcggcagcag
cagcagcagcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaccaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactaccactac
cactaccactaccactaccactaccactaccactaccactaccactaccactacnnnnnn
nnnnnnnnnnnnggaaaaaaacgaaaacacaccggtgcaggtactcggtgggaatgccca
gctgcttgtccatctgctctgccaccttgcggcgtctga

Результат:

https://img-fotki.yandex.ru/get/516062/158289418.4ad/0_187ba2_2ef47157_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/879536/158289418.4ad/0_187ba3_df97b950_XL.png
Оригинал: https://img-fotki.yandex.ru/get/879536/ … 0_orig.png

733

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Комплексный заказ 2017-12-01_09:

https://www.ncbi.nlm.nih.gov/nuccore/LSRX01001205

Результат пока некорректный: http://nanoworld.org.ru/post/96548/#p96548

***
Комплексный заказ 2017-12-01_10:

Ищем: PLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPLPL

https://blast.ncbi.nlm.nih.gov/Blast.cgi

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_002951995.1 Volvox carteri f. nagariensis hypothetical protein, mRNA
ATGACTAAGAACTTCTACAATGGCTTCCAGGACTGCCCCTACACACAGTTCCTACCCGAGCAGCTGCAAG
CACTGACCACGCAGTTGGTGGAGCAGCTGGGAGCCACATCGGTCACCACCCGCTTGCAGCCCGGCGTGCC
GCAACAGGTGACCCACGTGGTCGTGGGCAGCAACCCCCTGGAACTTCCACAGCTCGATGAGCTTGCACAG
CAGCTGCAGCCCGCACTGCAGGCAATCCAACGGGCGCATCCCACCCTGGAGCTGACACCCCAGGCGCTGC
GCGTCCGCATGAGGGTAGTGGACAGCGGCTGGCTGCAGCGAGTCCTCCAGTACGGCAGGGTCCTGCCCCT
GCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCC
CTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGC
CCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGCCCCTGGCGTCAATAGTTGAACT
TGCGCATGCCCGCTGCCCCGCATTCTGTGCCCGGCGTGTTGGAGGCGGCGTCGCGAATGTGCCAGATCAG
CCGCAGCGTAGTGAGCGCCATCAAGTCATCCAGGAGACGGCGCTGGCAGCAGCGGCGTCCTCCGGTGCGG
CAGAGGCCGCCTCGGCCGGGCAATCCACCGTAGCCGCCTGCAGCAATGGCGGCGACGGCGGCAGCCGGAA
TGGTGCCATCGCCGCCGCCGGCGGGACTCGAGACCACGGCGACGGCAGCCGTACAGATGGCGATGAGAGT
GACGGCGGCGAGGTTGGCTTCTCGGTGGAGCGGGACACGGCACGGCGACTTGATGAGGGTCCCGAAACAC
CTGAGACACAACATGGACCCCAGCTGAACCAGATCCAGGTTCAGATCCAGAACCAGAAACAGAACCGGAT
CCGGATCCTAGCTGTCTCCCCGCTGCCAGGACCGCGTCCCTCGCCTGACGCACCGTTGGCAAGGTTCTAC
GGCTGGCTGGGCGAATGGCGATCCGAGCTGGACCAGGTGACGCTGCTGTCAGGTGCGGGGGGGGCCCGAG
CGATGTGGGTCGACGTGTACGTGTACGTGTACGTGTACGGCATAGACACGGCGGATAGCGATACGCCCCC
ACCTCACCCTCGCGCTACGGCCAACTGCTTCGCCGCGGCGCCGCCGATAGAGCTCGTCATGTACGGCATC
TTCGACTCGTCGAGATGCTCGTTCATCGGCAACGGCACCATTGATGCGGCACTACGGGAGCTCACCAAGT
ACGAGGAGGCACTCGCTGGGCCTCGAGGCGCGTGTGCAGACAACACGGACGGGTCTAAGGCGCTCCGGCC
ACCTCGCGACAGCGGTGCAACAGTCTCGAGGCACGCGAGGGCTCGCGGTGGCGGCGGCGGGGGGGATGGC
CGCGGTGCCGTCGCCGCCGCCGGCAGCGGCCCCATCAACCATCAGGCGCTCAACTACGCCCATGCCGCCG
CCGTCGTACGCGCCTGTGCATTCCGCATCACCGCCGCCATGTCGCCGCTGCGCCTGCAGAGCGAGCTGCC
GTACATAGGGCCCTTCACAGCGCGCATCATACATCAGATGGTGTCCAGCCTGGGGTCCGATGGCGGGGGC
GGCGGAGGGAACGCGGATGGCAGTTGTAGCTGTGAACCGCTGGACGCGTACCGTTCGGATCTTCCAGCTC
GAGATTCCCGGGGCAGGCTTCGGCCTGGAACTGAGGGTGCCAGTACACGGCGCATGTTCTGCCGCCTGCC
GGGATGCGGCCCTGTACTGGCTCGAGCCTGGTGGGAACAAGGTTTCCGTACATTTGAGCAGCTGCAATTG
TACGGCGCCGCCGCGCGGCAGCGGGACGGTTTGGAACCGTTGGAGAGGGTTCCGGAGCGGGGCAGCGGCG
GCGGCAACGGCAACGGCGGCAGCGGTGACGGCGGTGACGACTGCGGCACGAGTGGTGTTGGTCGTAGGCG
GAAGTGTCAAAGAGCGATTGGGGAGTTTGGGGAGGAGGTGCTGGATGCTGAGAGGGAGGGGGACCGCGAG
GAACAGGAGGAGGAGGGAAGCCGGGCGCCGGCGGCGGCGGCGATGGCAAACCGAGAAGCGAACCCCGATG
CCGCCACCGCCGTCGCCAGTGGCACCAGCAGCGATGACAGCGACAGTGACGGCAAGGGCCGCAAAAAGTC
CTATAGCAGGAAGCGTGCACGGTTTGGGCTGGTGGGGGGCCAGTCCCGCACACCTGCCCCGTACAATCGT
CCTGGCGGCGGCGGCGGCGGCGGCCGCAGCAGCGCCCGCGGCCCCGGCGGTCTCCTGGCCGGCTGGTGGC
GCGGGGAGATCTGGTACTCCCTGGCATTTCAGGACCACCTGGCGGAGGTGGTGGCGGCGGAGGAGGTGGC
GGAGATGCGGCGGGTGGGGGGCGGACGCAGGGGGCGAGCCGCGGAGGACGTCGACTTCCTGGTCACGTGC
ACCAACACACGCGGGTCCGATCTCGACAAGGAACCGAAACCCCAAAGTGAAGATGAGGGCCAGGGTTACA
AAACGGCGGGGTACGCGCGTCATACGGGGTATCTGTACGGCACCGGTGATGCCGGCGGTGCCAGTGGTGG
CGGCGGCGGCGGCGGCGCGGGCGGAGAGGCGCCTCTTCTTGTCCTGTTGTACCGGCAGTTGGTGGCGGCT
GGACGGGTGGTGCCACTGGAGCAGGGTTTCTGTCGCCTGCAGGTCAATCAGGAGCCGGGGTACATAGACG
CGATGAAGCGCTTGGTGGCCTCGGGCCGATCGGCGGGTCAGGAACAGATGGACAAGTACGACCACCTATG
GTGCATCTGGGTCACCAGCCGGGGCCGACGGCGCAGACTTGACGTCATGCTGGTGCCATACGGCCAGCAA
TGGCCGTACGCTGTGGTGGGCTGGACGGGCAGCAAGCAGTATTTACGGTTCATGCGGCAACACGCGCTGA
ATTGCGGCATGTTCACCAACTCCCACGCCACGCTGCGTCAGACCACCGCCGGCGTCCGCCTGGTGCCCCA
GGAGGTCCTCCCAACCGATTCAAACGGCCAACAGTTCCAACCCCCACAGTGGGCCGAGCGAGGCGCAGCG
GAGCAGCTACAGCTACAGCTTCTAGAAGGGCGCTCCAGGGGTCTCGCGACCTGCATGGTTGGAGCTACCG
CCCGTAATGCGGACGCTGGCGGAGCTGACGACAAGAGGGCAGGCTCAGCCAGCAATGTCGCCGCTGGCCC
CGCCGACGCCCCTGCCGCTGCGGCGGCGGCAGCAGCAACAACTACAGCTGCGGCGTCTGGACAGACCCGA
CCATTGACGTGGGACGGCTTGGCGGATAGCAGCAATGTCACGGCGGCAGCGGCGGCGTGTGAAACTCGAT
ACCCCGGGCTGGGGTGCGGGGGGACGGGGCTGCGGCCCGTGGCTTCGGAGCGGGATATTTTGGAGCTGCT
GAAGCTGCCGTACAGAGCGCCCCACGAACGCAACGCATAA

Результат:

https://img-fotki.yandex.ru/get/962386/158289418.4ae/0_187d05_fb266b6c_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897385/158289418.4ae/0_187d06_d5c0b377_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897385/ … 7_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/369087/158289418.4ae/0_187d07_3275c26b_orig.png

Последовательность n(PL) образует программную 14-спираль.

***

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_011504803.1 PREDICTED: Ceratosolen solmsi marchali keratinocyte proline-rich protein-like (LOC105366382), mRNA
ATGTATCTCTATCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTAC
CTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCT
ACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCT
CTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTACCTCTCCCTCTCT
CGCTAATCTCAGCGCGGCCGCGTATCTCGACGAGACCTAAGCGATCCCACGGCGGTGATGACGGCGGTGA
TGACGGCCGAGGTGACGGCGGTGACGACGGCGGTGATGACGGCCGAGGGGACGGCGGTGACGACGGCGGT
CTTGACGGCGATGACGACGGCGGTGGCGACGGCGGTGGCGACGGCGGTGGCAACGGCGGTGGCGACGGCA
ACAGCGACGATGACGGCGACGCCAATCAGGTATTAACATAA

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4ae/0_187d08_a1fcd5a1_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/509531/158289418.4ae/0_187d09_46aeb9ce_XL.png
Оригинал: https://img-fotki.yandex.ru/get/509531/ … e_orig.png

Фрагмент 1:

https://img-fotki.yandex.ru/get/509739/158289418.4ae/0_187d0b_cf672cb1_orig.png

Последовательность n(PL) образует программную 23-спираль.

Фрагмент 2:

https://img-fotki.yandex.ru/get/921322/158289418.4ae/0_187d0a_3e00ce86_orig.png

Программная 3555-спираль.

734

Re: Online service PROTEIN PICOTECHNOLOGY

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 92 926

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Общество вимановладельцев

Комплексный заказ 2017-11-29_11:

Татьяна Рясина пишет:

Вадим Черезов https://www.ncbi.nlm.nih.gov/pubmed/17962520

human beta2-adrenergic G protein-coupled receptor

https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

https://img-fotki.yandex.ru/get/896349/158289418.4ac/0_187938_b0dc3657_XL.png

http://www.uniprot.org/uniprot/P00720

https://www.ebi.ac.uk/ena/data/view/CAA28212

>ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein
ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
TATAAAAATCTATAA

Результат:

https://img-fotki.yandex.ru/get/480022/158289418.4ac/0_187939_bf9f1843_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/879536/158289418.4ac/0_18793a_6ec915a1_XL.png
Оригинал: https://img-fotki.yandex.ru/get/879536/ … 1_orig.png

Заказ (часть 2)

http://www.uniprot.org/uniprot/P07550

https://www.ebi.ac.uk/ena/data/view/CAA28511

>ENA|CAA28511|CAA28511.1 Homo sapiens (human) hypothetical protein
ATGGGGCAACCCGGGAACGGCAGCGCCTTCTTGCTGGCACCCAATGGAAGCCATGCGCCG
GACCACGACGTCACGCAGGAAAGGGACGAGGTGTGGGTGGTGGGCATGGGCATCGTCATG
TCTCTCATCGTCCTGGCCATCGTGTTTGGCAATGTGCTGGTCATCACAGCCATTGCCAAG
TTCGAGCGTCTGCAGACGGTCACCAACTACTTCATCACTTCACTGGCCTGTGCTGATCTG
GTCATGGGCCTGGCAGTGGTGCCCTTTGGGGCCGCCCATATTCTTATGAAAATGTGGACT
TTTGGCAACTTCTGGTGCGAGTTTTGGACTTCCATTGATGTGCTGTGCGTCACGGCCAGC
ATTGAGACCCTGTGCGTGATCGCAGTGGATCGCTACTTTGCCATTACTTCACCTTTCAAG
TACCAGAGCCTGCTGACCAAGAATAAGGCCCGGGTGATCATTCTGATGGTGTGGATTGTG
TCAGGCCTTACCTCCTTCTTGCCCATTCAGATGCACTGGTACCGGGCCACCCACCAGGAA
GCCATCAACTGCTATGCCAATGAGACCTGCTGTGACTTCTTCACGAACCAAGCCTATGCC
ATTGCCTCTTCCATCGTGTCCTTCTACGTTCCCCTGGTGATCATGGTCTTCGTCTACTCC
AGGGTCTTTCAGGAGGCCAAAAGGCAGCTCCAGAAGATTGACAAATCTGAGGGCCGCTTC
CATGTCCAGAACCTTAGCCAGGTGGAGCAGGATGGGCGGACGGGGCATGGACTCCGCAGA
TCTTCCAAGTTCTGCTTGAAGGAGCACAAAGCCCTCAAGACGTTAGGCATCATCATGGGC
ACTTTCACCCTCTGCTGGCTGCCCTTCTTCATCGTTAACATTGTGCATGTGATCCAGGAT
AACCTCATCCGTAAGGAAGTTTACATCCTCCTAAATTGGATAGGCTATGTCAATTCTGGT
TTCAATCCCCTTATCTACTGCCGGAGCCCAGATTTCAGGATTGCCTTCCAGGAGCTTCTG
TGCCTGCGCAGGTCTTCTTTGAAGGCCTATGGGAATGGCTACTCCAGCAACGGCAACACA
GGGGAGCAGAGTGGATATCACGTGGAACAGGAGAAAGAAAATAAACTGCTGTGTGAAGAC
CTCCCAGGCACGGAAGACTTTGTGGGCCATCAAGGTACTGTGCCTAGCGATAACATTGAT
TCACAAGGGAGGAATTGTAGTACAAATGACTCACTGCTGTAA

Результат (часть 2):

https://img-fotki.yandex.ru/get/879536/158289418.4ac/0_18793b_a02233d9_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/769660/158289418.4ac/0_18793c_25152180_XL.png
Оригинал: https://img-fotki.yandex.ru/get/769660/ … 0_orig.png

Программа Пикотех показывает, что первый белок состоит преимущественно из пи-спиралей, а второй - преимущественно из альфа-310-спиралей.

Рентгеноструктурный анализ высокого разрешения не может отличить пи-спираль от альфа-310-спирали.



На сайте NCBI

https://www.ncbi.nlm.nih.gov/Structure/pdb/1FBB

Molecular mechanism of vectorial proton translocation by bacteriorhodopsin

Subramaniam S, Henderson R

Subramaniam S
https://ccr.cancer.gov/Laboratory-of-Ce … ubramaniam

Sriram Subramaniam, Ph.D.
Center for Cancer Research
National Cancer Institute
Building 50, Room 4306
Bethesda, MD 20892-8008
Ph: 240-760-6384
subramas@mail.nih.gov


Александр Юрьевич,

напишите пожалуйста резюме 3D диаграммы Пикотех, и вышлем по адресу

735

Re: Online service PROTEIN PICOTECHNOLOGY

Subramaniam S  публикации

https://www.ncbi.nlm.nih.gov/pubmed?cmd … dispmax=50

736

Re: Online service PROTEIN PICOTECHNOLOGY

http://nanoworld.org.ru/post/96477/#p96477

Татьяна Рясина пишет:

Это здесь  http://nanoworld.org.ru/post/96441/#p96441


Напишите пожалуйста резюиме диаграммы.

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_04:

https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

Результат:

https://img-fotki.yandex.ru/get/483127/158289418.4ad/0_1879a5_bcb641c8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ad/0_1879a6_beabcae0_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 0_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

737

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:
Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 92 926

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Общество вимановладельцев

Комплексный заказ 2017-11-29_11:

Татьяна Рясина пишет:

Вадим Черезов https://www.ncbi.nlm.nih.gov/pubmed/17962520

human beta2-adrenergic G protein-coupled receptor

https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

https://img-fotki.yandex.ru/get/896349/158289418.4ac/0_187938_b0dc3657_XL.png

http://www.uniprot.org/uniprot/P00720

https://www.ebi.ac.uk/ena/data/view/CAA28212

>ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein
ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
TATAAAAATCTATAA

Результат:

https://img-fotki.yandex.ru/get/480022/158289418.4ac/0_187939_bf9f1843_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/879536/158289418.4ac/0_18793a_6ec915a1_XL.png
Оригинал: https://img-fotki.yandex.ru/get/879536/ … 1_orig.png

Заказ (часть 2)

http://www.uniprot.org/uniprot/P07550

https://www.ebi.ac.uk/ena/data/view/CAA28511

>ENA|CAA28511|CAA28511.1 Homo sapiens (human) hypothetical protein
ATGGGGCAACCCGGGAACGGCAGCGCCTTCTTGCTGGCACCCAATGGAAGCCATGCGCCG
GACCACGACGTCACGCAGGAAAGGGACGAGGTGTGGGTGGTGGGCATGGGCATCGTCATG
TCTCTCATCGTCCTGGCCATCGTGTTTGGCAATGTGCTGGTCATCACAGCCATTGCCAAG
TTCGAGCGTCTGCAGACGGTCACCAACTACTTCATCACTTCACTGGCCTGTGCTGATCTG
GTCATGGGCCTGGCAGTGGTGCCCTTTGGGGCCGCCCATATTCTTATGAAAATGTGGACT
TTTGGCAACTTCTGGTGCGAGTTTTGGACTTCCATTGATGTGCTGTGCGTCACGGCCAGC
ATTGAGACCCTGTGCGTGATCGCAGTGGATCGCTACTTTGCCATTACTTCACCTTTCAAG
TACCAGAGCCTGCTGACCAAGAATAAGGCCCGGGTGATCATTCTGATGGTGTGGATTGTG
TCAGGCCTTACCTCCTTCTTGCCCATTCAGATGCACTGGTACCGGGCCACCCACCAGGAA
GCCATCAACTGCTATGCCAATGAGACCTGCTGTGACTTCTTCACGAACCAAGCCTATGCC
ATTGCCTCTTCCATCGTGTCCTTCTACGTTCCCCTGGTGATCATGGTCTTCGTCTACTCC
AGGGTCTTTCAGGAGGCCAAAAGGCAGCTCCAGAAGATTGACAAATCTGAGGGCCGCTTC
CATGTCCAGAACCTTAGCCAGGTGGAGCAGGATGGGCGGACGGGGCATGGACTCCGCAGA
TCTTCCAAGTTCTGCTTGAAGGAGCACAAAGCCCTCAAGACGTTAGGCATCATCATGGGC
ACTTTCACCCTCTGCTGGCTGCCCTTCTTCATCGTTAACATTGTGCATGTGATCCAGGAT
AACCTCATCCGTAAGGAAGTTTACATCCTCCTAAATTGGATAGGCTATGTCAATTCTGGT
TTCAATCCCCTTATCTACTGCCGGAGCCCAGATTTCAGGATTGCCTTCCAGGAGCTTCTG
TGCCTGCGCAGGTCTTCTTTGAAGGCCTATGGGAATGGCTACTCCAGCAACGGCAACACA
GGGGAGCAGAGTGGATATCACGTGGAACAGGAGAAAGAAAATAAACTGCTGTGTGAAGAC
CTCCCAGGCACGGAAGACTTTGTGGGCCATCAAGGTACTGTGCCTAGCGATAACATTGAT
TCACAAGGGAGGAATTGTAGTACAAATGACTCACTGCTGTAA

Результат (часть 2):

https://img-fotki.yandex.ru/get/879536/158289418.4ac/0_18793b_a02233d9_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/769660/158289418.4ac/0_18793c_25152180_XL.png
Оригинал: https://img-fotki.yandex.ru/get/769660/ … 0_orig.png

Программа Пикотех показывает, что первый белок состоит преимущественно из пи-спиралей, а второй - преимущественно из альфа-310-спиралей.

Рентгеноструктурный анализ высокого разрешения не может отличить пи-спираль от альфа-310-спирали.



На сайте NCBI

https://www.ncbi.nlm.nih.gov/Structure/pdb/1FBB

Molecular mechanism of vectorial proton translocation by bacteriorhodopsin

Subramaniam S, Henderson R

Subramaniam S
https://ccr.cancer.gov/Laboratory-of-Ce … ubramaniam

Sriram Subramaniam, Ph.D.
Center for Cancer Research
National Cancer Institute
Building 50, Room 4306
Bethesda, MD 20892-8008
Ph: 240-760-6384
subramas@mail.nih.gov


Александр Юрьевич,

напишите пожалуйста резюме 3D диаграммы Пикотех, и вышлем по адресу

Резюме: Первый белок состоит преимущественно из пи-спиралей. Второй преимущественно из альфа-спиралей.

738

Re: Online service PROTEIN PICOTECHNOLOGY

http://nanoworld.org.ru/topic/1845/page/99/

Татьяна Рясина пишет:

Спасибище!


Александр Юрьевич, сейчас разберусь чего к чему относится и наведу порядок в структурах, источниках и резюме диаграмм 2D по Вадиму Черезову. 

Нужны к каждой структуре пояснительные записки - резюме диаграмм 2D,
как Вы написали

для http://nanoworld.org.ru/post/96315/#p96315

"Программа Пикотех показывает, что первый белок состоит преимущественно из пи-спиралей, а второй - преимущественно из альфа-310-спиралей.
Рентгеноструктурный анализ высокого разрешения не может отличить пи-спираль от альфа-310-спирали."

И для http://nanoworld.org.ru/post/96311/#p96311

"Мы видим, что в первом приближении структура бактериородопсина, показанная программой Пикотех 2D соответствует вторичной структуре этого белка из Protein Data Base. При этом программа Пикотех показывает тонкую структуру спиралей, т.е. дает существенно больше информации, чем удалось получить методом РСА и другими. Понятно и другое преимущество. Время. Его пришлось затратить в миллионы раз меньше"


Я сейчас порядок навожу в информации по структурам Вадима Черезова и Вашим структурам для них.

Первое письмо я ему направила в США.   Сильно заредактировалась, поторопилась, нажала отправку, хотя хотела ещё лучше доредактировать и доформатировать. 

Из каждой Вашей структуры сделаем по письму и отправим по одному.  Вам зачот в зачотку по телепатии - я мысленно Вас уговаривала ещё структур сделать дополнительно. Думала, как Вас убедить. Вы сами сделали. Отлично.

У него в лаборатории есть сотрудник в США, А.Ивченко тоже из МФТИ, я потом поищу статьи с участием А.Ивченко, если найду, ему позже тоже отправим.





A useful model for detailing protein structures in addition to X-ray structural analysis
Tanya Riassina <tanya.riassina@bk.ru>
Кому: cherezov@usc.edu

сегодня, 18:51
To:
Vadim Cherezov, Ph.D.
Professor of Chemistry
Professor of Physics & Astronomy
The Bridge Institute
Department of Chemistry


From:
Alexander Kushelev
Head of Nanoworld Laboratory



Dear Professor V.Cheresov!



Let me bring to your attention more detailed  protein structure of human beta2-adrenergic G protein-coupled receptor, investigated by you and published in https://www.ncbi.nlm.nih.gov/pubmed/17962520 .

We offer you a convenient
comparative description  of the regions of the protein molecules, which gives an accurate spatial representation. Please see the structure you are studying http://nanoworld.org.ru/post/96315/#p96315 , described by our method named Picotechnology of proteines.

The Picotech program shows that the first protein consists predominantly of pi-helices, and the second - predominantly of alpha-310-spirals. X-ray structure analysis of high resolution can not distinguish a pi-helix from an alpha-310 helix.


The Picotechnology method is described in the monography
"Geometry of living nanoworld. Picotechnology of proteines" https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2
co-written with Victory Socolick.



The short discription of the Picotechnology  you can get by here http://nanoworld.org.ru/topic/1837/  (in Russian) and here (in English) http://nanoworld.org.ru/post/94362/#p94362
Genomic version of Picotechnology http://nanoworld.org.ru/post/96321/#p96321.


Also we could make 3D models like these http://nanoworld.org.ru/topic/1837/page/2/  and
quaternary structures of proteins (in manual mode).


Our models assume the existence of a "rigid" ring-shaped structure in electronic shells connected to polyhedra, which allows us to typologize the shape of the regions of protein molecules and accurately describe them in a three-dimensional scheme upto picometer.
We are glad to be useful in your studies


Yours faithfully
Alexander Kushelev
Head of Nanoworld Laboratory
E-mail
kushelev20120@yandex.ru
Skype
kushelev2009 (Кушелев А.Ю.)
Cell
+7 (903) 2003424
+7 (916) 8265031
+7 (926) 5101703


Information

Now one of popular algorithms of modeling of three-dimensional structure of protein who starts with it amino acids sequence, the way model construction on a homology on the basis of the general structural template is.
The novel way of modeling of structural template of protein on determining its nucleotide sequences is elaborated, as the information about the topology of the secondary structure of the protein and its individual structural template is stored directly in the gene for each protein. This information can be decoded in accordance with the table of the genetic code of the structural protein template authoring program Pikotech (PT) and Molecular Constructor (MC) as a coordinate file in pdb-format.
The important advantage of a method is that it is possible to construct the structural template individually for any unknown protein only "having read through" determining it nucleotide sequence. This template serves as a single matrix for three-dimensional structure of all proteins molecules in the post-translational folding in vivo and virtual folding or docking in silico.



Examples of Picotecnology proteine structures
http://nanoworld.org.ru/post/96354/#p96354



Sent by Tatyana Riassina
MIPT graduate 1986

Кушелев: Попробую что-нибудь написать...

739

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 114

Online service PROTEIN PICOTECHNOLOGY

Создана новая версия Пикотех 2D, которая корректно обрабатывает коды гигантских (fasta до 50 килобайт) белков.

Заказ 2017-12-06_01:

>XP_007234567.2
atggcagccaatcacgagccgtggttgctgttggtcacagtcagtcatgactaccttggctgtagggtct
ttcaagtcccttggtcttcaacggtccagcacatcaagctgctcgtctacgaagaaacacacttccctgt
gtgtgagcagcggctgcttcacaatggaaaagtgattaatgacagagttgaagttggatctttggtaccg
cacgggagtcgtgaaatattcatgacgctgcacggccgaggcctgagagggggagggaggtttggacaga
ctactccacctttagtggagttcctgaaggacattttacgtagatatccagagggtggacaaatactgaa
agagctgattcagaatgcagaggatgcaggtgcgacagaagttcggtttgtgtatgatgagactgaatat
ggggtggagtcactgtggtctcaagatatggtccagtatcaaggaactgccttgtatgtgtacaacgatg
cagttttcacaaaggaggactggaatgggattcaggagattgcaaggagtaggaaaagagaggacccttt
aaaagttgggcgatttggtattggattcaactctgtttaccacataacagatgttccaagcatattcagt
ggggatcaaattggtatgctggaccctcatcagatgctttttggagttcacgagtctggtcagtgctgga
acttgaagtctgactcaaaggaaataatggagcttcatgaccagtttgctccattttttggcctgtgtgg
cagctcggaagacaccgttaaagagggcaactttccaggaacgctttttcgctttcccctccgcatgaaa
ccttctcagctgagcagcaacatctacaataaagagaaagttctggagctgtttgagtcctttaaggcgg
atgcagacacggtgctgctgttcttgaagagtgtgcagaaggtctctctgcatgtgcgcgagtcagacgg
tactgaaaggatgctattccaggtcacagcaggcgagaatgcagagaacaagctggagaggcccaactcg
ctgaaaacgctgggcttggccattgacagctacagcaatggagttccaagtgattcggtcacctgtgcca
cgtaccagctgaccattgaggtacaggatgaaactgccaaggagacccagacgaccacgtggctggtttg
caatggcattggtggccgaggcatgtgtggtgaactggactccttagctgatgatctgaagttcatccca
acgattggcatagctttgccattgactcttctcgacgaggataatggtgcggcatctagcttttcgggtc
gggccttctgtttccttccgctgcccttgggagaggaaagtatgacagggctaccagtgcatgtaagcgg
cttctttggcttgaccgacaaccgcaggagcatcaaatggcgggaagtggaccagtggagggacccagca
gctctttggaatgaactcctaatcgtaacagtcatcccaagggcttactacacactcatcatggagacaa
ttagacgcgttcagaacaagaaggaccaagatttccctctctcaccgggaggcatttatggagcctggcc
tgatcccaacaagatacgtccacactggagaccaattcttgagcccctgttccatgacttgctccagcag
ccagtcatctactcactcagtagcacttgggtccaagtagacgacactgtgttttcagagcttgactcca
caaaggccagtacagagactgtgatcacatacctccagagctcagggatgacagtggccaaagtactaga
caccattgcagcagttctgaatacatttgtctccaaaccggacagcataaagaaagtgacaccttctttt
gtacgacagactctgaggaaaactaggcacaaagggcccccccaggagaaactgctcctgctcgagttta
tcctcagcgatgcatgctacagtgacctcattggactagagctgctgcctttgcaaaatgagacttttgt
tgctttttcctcctcagtgagtgacaaggatgctgtgtatattgcctctgaagagtatccaaggtccctc
tatccaggtttggaaggaagattcatactggaaagcattgccccccatgtcatgaacagcctgaaagaag
cagcaaaaagcagagttcagcagtatctttggggttgttcaggaaggccctgcactcaggttcaagtctt
aacccccgagcgatcagcacgcctcattaaagaaatcctcacaacagcttggccttctagagagtttgct
gttcagtggaaccctggcgatcaagagatgaagcatccgtcagcatcctggatcagaatggtttggaaac
atctctacatcaattttcccgatgacctaagtacctttgaagacatgcctttgattcccaatgtgccact
gaatgactgtgttgaatcgttgaaccttttgcgcctcaagactccatcccccatcgttattgtgagtgaa
gaggagggctcgctgtctgaggtcctgcttgaagtcataaaaaaggttggaggagttgtcttaaaaacac
tggatccatgtttgcagcatccactcctgaaaaattacatccatcagctgtctccaagcacactactgca
aatcatggaccggatctcgccccagagactagttagtcaagtatcatcactctccgtcaaacagaagact
gccctcagaagcttcttagctggtcttagtgatgtcaccgagaaggagaaacgtgtaatccaagatcttc
ccatatttgtgaaggtggggcagcattcagagaaaggcactccatcctatacctttttgaagggagcgag
agcgttgcaccatactgcaaagcatcctccagatgtcaagttgtccatcaacattgtcgacagcagtgat
gaggccacaattcgtctgattggactgttaaacgtggagcaggtcaaaagcactgaatgtctgaaggtga
ttgttcaggacattgagtccaaagggttctacacgaaagaagaagtgaaaaggatcatgctctgggcact
tactcatttttcatttttgaagaatgaaaataaagcagtggtcacttggctttcctccctaaagttcata
tattcctcctcaggaaaaccctttgcaccaacagactttttcgatcctgaactggagatactgcagaatc
tcttctacatggaagaaaagtccagatttccaccagacacctacatatcatctcctgatgttcttcattc
acttaggcagttagggctcaagaatgaagtccaacttactgaaaaagatgtacttcaggttgcccagaaa
atcgaagaattacagggaagtcctaagccagaatgggagtcacttctgaagaaggcaaaaacccttctta
caattctgaacaaacaaacaaaattggttaagtctgcagaagctcaggcattgctacagaacttgaaatg
ggtaccagtctgcaaggacagacctttgaattaccccaagtctcttgcctggaagggagactcttgtaat
atttcatccctgtctgaaatgtgcgatatatcccatgcagtgctggttggttcttctgtagcacttgtgg
aacgaacatctgctggaatgaaaaaagccctgaagttatccatggatcctcaagtcgaccaagtgcttca
gcatttaaaagcagtaaatgactggcacagatctcaagcattcaccacagaggattggtatcaattccag
cagatcctttttgaaatctacgagttcatgcaagttcatttagcaaatgcaagagaagcagtgaagtctc
tgtcctttgactgggtatggactggaaaaacatttgcatctccctcccaaactgtcttgaagcctatacc
agacctggatctacagccatacctgtactccttaccaaagactatcgcaaaattccacaaattgttcaaa
ttctgtggttcaattgaggaagttgttcccagccatgtgttcgaagtggttaaaacagttaaagaaagaa
gtgaagatgaaatgtccaaagaagagagcaagcatagtctcctgctgttgataaacatcttacgatggat
ttacagcagtcagataacagtggatgttgacatgcatgtgccaattttttgctacaaagatccaagcaaa
ttagtcatgaagccaattcatgagtgcacttattgtgacatcaaagttgatgacttgattgacctgcttg
acgatacctcagagcccatcatactcgtacatgatgacattcccatgaaaactgcagaatggttaagagt
accttgtttgagcacaaggctcattaacccagagaacctcggctttgaacagtctgggcagagagaacct
ctaactgtgagaatcaagaatattcttgaggaatatccatctgttgcagatatcttcaaagagcttctgc
agaatgctgatgatgcaaatgctactgaatgcagttttctgattgacatgagaaagaatttggatctacg
agaaaaccttctggaccctgggatgattgtttgccatggcccttctttgtggtccttcaacaattcagtt
ttctctgacacagacttccttaacataacccgactcggtggatcgatgaaaagatgtgaagcagacaaag
tcggcaaatttgggttaggtttcaactctgtttatcatgtgaccgacatacccattatcatgagcagaga
gtttatgatcatgttcgatcccaacatcaatcacatcagcaagcacatcagggacaaatccaatccaggc
attaaaatcaactggagtaaacagcagaaacgactgaggaagtttcctaaccagtttagaccctttatta
atgtcttcaactgtcagcttcctctgtcacaagagtccccatacaaatacgatggaactctcttcaggct
tccattcagaacagagcaagaagcagcagttagtgaaattagcggtatctactacaacaccacagatatc
tattcactagttgatgaattcagcatctgtggccaccggctaattcttttcacacagcatgttggaacaa
tggtcctgaagtatttgaaatctgaggaatcaaatcctgctgctgcacaagatgtagtcacaattaacaa
aagtgtgtggtcttccaaagcaacatatggtcccctcagcattctgaaatctgcagccaaagtcatgaag
aaagtggcagccaccaacagagtaccagctgatgttcctaagtctggttgcattatccgcattgtcgtag
aagagtaccacaatgtattcaggcgaattcttgatctgcagtccccccttttcagaggttctgaagagga
tccatcttcatactttgagatggcagctaaaggctcacaaacccaaaagagacttaatgatgatatgcct
cagaagggtgttgaaaacacaaactggctgatctgttcatgtatggatgtgactgaagctttgaagttct
ccctgaatgacagtggaaagcgactaggactggtgccttgtggcggtgtagcagttctgctctcggaaga
agaaaatcgaaaatggacagtgaaaacaagcaccagtccaattggagaagtcttctgctacttacctctc
agaatcaaaactggactgcctgttcacatcaatggatgctttgcagttacatcaaatcgtaaagaaatct
ggaaaacagataccaaaggagaatggaactccattttcatgagacacgtcattgtccaggcatacttggc
tgcacttagcactctacgaacaatgtcagaaaatggggaactcctcgactacaactactacgcagcctgg
cctgaccctggtcttgtacatgacgacttcaatttgatttgccaaggcgtatatcaagaaattgccaaag
gaggagacaatgacaatgccagagtcttttcagatggcaaaacttgggtgtcaatcaagtatgtcaggtt
tttggatgactccttgctctgcagaccggatgtaggacctgctgctttcaaaatcttcatgaaatacctc
aagaaatgtggctcccaagatctctgtgctgttgagctgcctgattgggtcaaagaaggctttgatgatg
ctggctgtaaagggaaactgatggagaacacacttacagaaagacagttcttctcagatgtgtttttccc
aaacatacaagacatagacaaggacctccgtgaccccctgatgtactatgtcctcaatgaaaaattggag
gactttgcatctatactaagacagactccatgtattccatgctcaggtacttctgacagacttgttctgc
catctcgactcatacatccagagggtagagttgccagactgtacaacagtgaagatggtcgcttccctga
aggaagtttaaaagactatttgaacccagtgtgcttagtgaagttggtacagttgggtatggtaaaagat
gacctctcgtgggaagacttgactgaaagggcagagtctgtaatggcactcaatgaaacagaccatgtag
ctgcatgccacaggagcagtatactgcttagccttattgatgaaaagctgaaaatgacagacccaagagg
aaatggttatgttgaaaaattgcaagagatcaagttcctaccattcttgaccaagcctgcaggcttttca
ctcccttggcatgggaataattttcctcagtccacaattttctctgcaacagaacttttcacaacagaac
atcaggacactgtgtgtttaatgaagccaatcctaaatgagagctctccatcttttaaaggttgtggccc
tatctctctagctgtgaaagacttccttgggctaattaaaaagccagctgttgggttagtcataagccaa
ctaaaagaactctccaaatcatttgatggtgtcacactgtaccaagaaaacataacaaatgcgtgctaca
aatacttacatgaagagatgatgcactccaatactgcaaaagatgaaattacggaggagctgaaaacctt
ctgctcaattttagtggaaaactcttacgtgaatccatccaaagtggcattttacttaaattttgatgca
gctccgtatctttaccagcttcctaacaagtataggaacagctgtcgtgagctctttgaaaccgtggggg
ttcaaccaagcttcacagttgaaaattttgcatctgtcctagaaatgcttaagagtgaatgtgggagaag
atgtcttactgaggataacttccagcttagtcgcagaatcatcagtgaaggaatatggagtttgattcga
gacaaaactcaggagttctgccaaagcaactatggacagatacttttgcctgacagcaatctcactttgc
agccatctaagtcactctgctataatgactgcccatggattaaggtcagagattcaactgtaaaatattg
tcatgcagatatcccaagagaagtcgcggtgaaattgggcgctgttcctaaacgccacaaagctttggaa
aggtatgcttccaatgtctgtttcaccactcttggaagtgaatttgggcaaaaggagaaactaaccagca
gaatcaagagtatcctcaatgcttatccatcagagaaggaaatgctgaaagaactccttcagaatgcaga
cgatgccaaagcaacagagatatactttgtctttgattctagaatccatccaactgacaggatatttgat
gacaagtgggtgccaatgcagggtccatcactctgtgtgtacaacaatcagccgtttacagaagatgata
ttagagggattcagaatcttggcagaggaactaaagaggcaaatcctggcaaaactggtcagtatggtat
aggattcaactcagtgtatcacataacagactgtccatctttcatctcaaataatgacattctatgtatc
tttgatccacatgcacgttacgcacctggagcaacatctgtcagcccaggaagaatgttcagagacttgg
attctgatttcaggtcccaattttcggatgtcctgaacttgtatctagggaattgcttcaagctggaacg
ctgcacaatgtttcgctttcccttacgcactgtagaaatggcaaagatttctgagatcagttcggtacct
gcttcagacaggatggtccaaaatctcctagataaactacgagctgatggtgcagagctgcttatgtttt
tgaaccacatggagaaaatttcaatatgtgaaatagaacatggcacaggcgaactaaaaacactgtactc
cgtgactgcaaaaatcacggatggtgatcgtctgaaacgcaagcagtttcatgcttctgtagtggacagt
gtgaccaagaaaaaacagctgatgcaaatcccagtacagcaaattacgtacaccatggacattgaagatt
cagatgggaatttaacaaactggatggtgtgcaacagatctggcttctctgacatggaaaaggtgtccaa
gagtgtaatttcagctcacaaaaatgaggacataacactcttccctcgaggaggtgtagcagcatgcaca
agccacaactacaaaaaagctcatagagcattctgctttcttcccctttctctggagactggcctgcctt
ttcacgtgaatgggcattttgccttagattctgccagaaggaacctgtggagggatgacaatggagttgg
agtaagaagcgactggaacaataacctgatgatggcattaatagcacctgcttacgtggaactgctggtt
cagttgaaacgtaaattctttccagggccagaccccactatgacaattcttcagggtacaccaatccatg
ttgtcaaagacatcctgagaaaattcttgtttttcttccctgtgaacagacttgacattcagccagactg
gtactgcttggtaaaggcaatctatcagtgcatcaatttggatctgaaaagactcctccctgttgtcaga
gcgccacacatagacaacactgatatgcattcagcagtgtacatctcttgggtgaacacgtccacttcaa
ctaagagccgagcattttttgacaacctgttgcaggatgagctgcagcaccttaaaaacacagaatacaa
catttccacacgcaaatctgtggcagaaaatgtctacagactaaaggccatgcttttggatgttggcttt
aacttaatccacagttgtgatgaaacgtccagcctttacttctgcctagaagatgcagggattccagtca
gctatgtgacgccagaagatgtcagaaaattcctgctgacatttcaatcaccagacgcatcatgccaagt
tgggaagctgccctgtcgactgcagcagtctaacttcaaactcttccacagcctgaagctcctagtggac
tactgctttaaagacatagaagaggatgatatcaaaatagagggtctaccactgctcttgacaatggaca
acattttgcaagtttttgaccctaaacggccaaaatttctgaccaatcatcatgatctcatctcctccag
gaaagagctgttcatgcacaccttgtacatgagatacagcaacatcctattcaaagcaggtgttgcaaag
gtttttgacatcagtagttttggagatttattgggatcagttctccctcgagagtacagaacaagaacct
ctgtgaagtggagagaaaactatgctagtgaatcctggctgaaaagtgcatggcacttcatcagtgagaa
cattggcatcaaagatgaccagacagagatgaagcccaaatttgagaccgttctggacatccttaaagat
tgggctctgataccagggatcaagtttatggtgtccagcaacaagttagttgtaccagagtacgatgttt
tgctacccctgagtcttatgtatgctgccattttccccaatgggcagaatgacaaagtcttccacaccct
aacgaaagcagggtgctttcagatggctgtaaacaaaatttgcgccaaagagaatcccattgtgcctctg
ctggcccagcaggctgcaaatatagaaaatccttccagcattttgagagcccttgaatacatgatccaga
caacagctttcaaggcagttaacctgacagacaaagactttgaagcacttctgttatactttaactctaa
tttggccagcctaagccaagatgatgtacaaagtctaaaattgctcccatgttacagaactgtcaatggc
cggcatataagcattgcaaactatggagcttgctacattttgatcaaaagcattccctccattgacatgg
aaaaatgggcaaacaccacatcttcagcttttctagctgacaatccacagctcaaggaattgtacgcctt
ccttgggtgcacccctgttgatgatctggacgtctacctaaagcatcttcttccaaagtttgacattttg
tcacatgatggaaaaatccagcatctcatctatctaaaggagaggttactggcactggaagagtccagtg
acataaaggatcaactctacgaaaaactggaaggtctgtcatttatttacgacgcaacaagcagactaaa
acctgccaaagccttctatgaccaaactgagaaagtatttgaagtgatgcttccaccaaaatccttcatc
cctccagatttcttcaggaaaattgagcaaatgttaaaaccaaaaaacggaactgcattcttaccatcat
ggattacattcctacgcaaaataggtttaaaatatgttgtgtctcaacagcaagtcctacagtttgcaaa
agaggtcagcatcaaagctcaaactgagaactggtccaatggaaaagtccagacaattgttgatgtgctc
ctaaatcacattttcaatgagagggcagatctttttgagggaggattcctcaaagaactttccatgatac
cattcctgtgtccagagcgagctccaccagaacttgtcagacttcatcctcaacatcaggaagtgaatga
cacacttcctctgattcgtttcagtgggtcccaggttaacccaaaatttaaacagacagatatcatgcag
ttactttggacatcctgtccaattttaccagagaaggccactccaggaagcataaaagaccaagagggaa
gcacagttacaggacaggaacagcttgaccaggttttggctctgttgaatgtcaatatggacccccctct
ggaaaaggtcattagcaattgcaaaaacatctgcagcgtcacaaatgtggatgatgacacagtcaaaaca
agaagcaaagtcttgaggagcgcatatgagttcctgaatgcagataaacgggaattccgttatcagttac
ggggagtagcatttgttatggttgaggatggctggaaacttctgaaaccagaggaagttgttataaatct
ggacaatgaatcagacttcaagccatatttgtacaaacttccacttgaacttggcacctttcaccagttg
ttcaaagtattaggaactgaggatgttgtttcgaccaaacagtatgttgaagtattgtttcgcatataca
gaagctcagaaggcaaacagctggacccaaatgaaatgagaacagtgaagagggcagtgtctgggctctt
caaaagtcttcagaatgaaccagtacaaatccgcaaagaccttgaatccctcagagatttaaccttttac
ttgccaagtcacgatggtcgacttgccaagtcaaacacgttggtctttgatgatgcaccacattacaaga
gcagaatccagggcaatgttggagtccaaatgcttgttgatatgagccaatgctatctgggcaaagacca
tgcctttcacactaagctcattatgctgcttcctcagaaactaaggcctcgacttttgagcagtatcttg
gaggaacaactggatgaagaatctcagaagatgtgtcagtttggagctctttgctcacttcagggacgcc
ttcagctattactttcctctgagcagttcatcacaggactaatacggatcatgaagcacgagaacgataa
tgcgtacatggtcaatgaggaaaaagcaatacggctgtgcaaagctttatgtgagggtttgaaggtgtcc
tgcttcgagaagctacagaccacattgcgagtcaaaggctgtagtcccattccacatagccggagtgaaa
ctctggcctttctaaaaaggtacggcacctcagtcatccacctatacatacaacattctgatagtaagga
cattaattttctgcttgcccttgcgatgaccctaaagtctgcaacagacaatctgatctctgacacttcc
tatcttattgccatgctgggctgcaatgacatctacagaatcacagaaaagctggacaatcttggtgtta
agtatgactcaactgagccctcaaagcttgaacttccccttcctgggacacctattcctgcagagataca
tcatattcttttaatggaccctttgaatgtattctatcccggagagtatgttggctacctagttgactcg
gagggaggagactttttagggtcttatcagccaacctacacttatgccatcatagttcaagaagtagaga
gagaagaggacggcaacccaagctttcttgggaaatactaccaaattgacattggatatagcgaatacaa
aattgtgagctcccttgatctgtataaattttctagacaagacgagagcacccatattcgagatggtgtc
ccaactactcctacaagcccatcagagagtcgctcctcaggccccaggctggtaccgccgattttccctg
acaaggaaaagcacataactcctcctccaaaggcatctccgaagaagatcaagcttaacgcattaccgga
aattctaaaagaagtgacatctgttgtggaacaggcttggaaacttgctgaaaccgagcgaaagaagatc
ataagacggttatatctcaagtggcatccagacaaaaatgcagaaaaccttgatattgccacagaggttt
ttaagcacttacagaaagaaatcagcaggatggagaagcaagcacaggcagagcaggctgcagaaagagc
ttcaagaagaactttctctgcatcttccactcgctttcagtcagagaagttctcttatcaaagattttac
acatcatggaaccaagaagcaacaagccataagtcggagaggcaacattttcgagagcagttcaccagct
atgcaggaacgtcacattctagccgattctttgtgccaccatccttcaagtctgtgggcaatcctgtgga
ggctcgaaggtggctgcggcaggcaagagccaacttttcagctgcacgaaatgaccttcacaaaaatgcc
aacgagtgggtgtgctttaagtgctatcttgccaccaaattagcattaatagctgctgactatgcagtta
gaggcaagtcagacaaagacgtgaagcccacagcactggcccagaaggtggaagagtacggcactcagct
cactgggctggctaaagatgttcacatcttggaaggttatggcgttgacagcctcagaactcgctatccc
gacctgttgccttttccacagattcctaatgatcggtacacttctgaagtggccatgagggtcatggaat
gtacagctcggattattatcaaactagagacatttgtacagcagaaaatatga

Результат:

https://img-fotki.yandex.ru/get/893904/158289418.4af/0_188264_2aad2770_orig.png

https://img-fotki.yandex.ru/get/893904/158289418.4af/0_188265_9e1f5dfb_orig.png

https://img-fotki.yandex.ru/get/893904/158289418.4af/0_188266_eb14bdb9_orig.png

740

Re: Online service PROTEIN PICOTECHNOLOGY

Комплексный заказ 2017-12-07_01:

Результат 1 из 2611:

https://img-fotki.yandex.ru/get/897385/158289418.4af/0_188369_800d2e02_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/893904/158289418.4af/0_18836a_fa73da15_XL.png
Оригинал: https://img-fotki.yandex.ru/get/893904/ … 5_orig.png

Результат 103 из 2611:

https://img-fotki.yandex.ru/get/892702/158289418.4af/0_188379_96ba8f74_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/892702/158289418.4af/0_18837a_420c23d3_XL.png
Оригинал: https://img-fotki.yandex.ru/get/892702/ … 3_orig.png