671

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-24_01:

>XM_018930789.1 PREDICTED: Bactrocera latifrons EMI domain-containing protein 1 (LOC108967387), transcript variant X4, mRNA
TCAGTTCTCACAGATCGGTCCAAACGGTACGGTCTAGCAAAATTTTTTAATAGATCGCCTAGAACTTT
TAGAAAAGTAATTTTCCTTGCTTAAAGCAAATCAAATTTTATATTTGCAAAAATGGCGCGTGCTGTACTA
TGCATGGCCATCGCTTGCATTTTAGTGCAATGCGCTCTCTCTCAAAACTACGATAAGGAAAATCGTCGCC
TCATTCTGCAAATTAAAGATCAAAAAACGACCAACCAACAATACTATTCGTCGAATTTCGATACCAGAAA
TGGTAATTATGAAGGTTTTGATGGTCGTTATAAAGGTATTAAACAAGGTCAATATGTCCCGGACAATTCG
GGCAAATATGTTCATGTTGAAGGTCCAACTGGTCCACCAGCCGTACCATATGTGCACGTAGAGGGACCAC
AAGGCGGTTTTGGCGGTGAAGGCGGCTTCGGCGGCAAAGGTAGCGGCGGCGGTGTAGGACCAGGCGGCCC
AGGCGGCCCAGGCGGACCAAAGGGACCCGGCGGTCCAAAGGGACCTGGTGGTCCAAAGGGTCCACCCGGC
CCACCTGGTCCACCCGGACCACCAGGACCATTCGGCCCAACTGGACCCGGACCTAAGGGACCAAATGGCC
CACCTGGACCACCTGGCCCACCTGGACCAACACGTCCCGGCCCACCAGGACCACCTGGCCCACCCGGCCC
AACCCGTCCCGGCCCAGGCGGACCACCTGGACCACCAGGCCCAACCCGTCCCGGACCACCAGGCCCACCC
GGACCAACACGTCCCGGCCCACCAGGACCACCAGGACCAGATCGTCCAGGCCCACCCGGACCACAACCAC
CATACAAACCAAGTGGCCCAAGAGACTCAAATAAGAATACACCCGGCTATTTGCCACCCGTCTCAAAAAC
TGGACACATCTTTTGAGAAGGAACAACCGTACAAGACAATTACCACAACAAACACAAATACTGACAGACA
AACCGGACAGAAAATCACTCAAGGAGGCGTTGGTCAAAAGGTAACCACAGCAACATACGAACAAACACCC
GGTATCTATAATGGACAGAAGGTAACTACACAAAAGGAAACTAATATCTATGGGCAAATACCCGGTTATC
CGATTGGACAAAAAGTAGTCGAAAAAGTAACAACCACCACAACGACGAACCAAAACGTACCCAGCTATCC
GACAGGACAGCGGGTCGTTGAGAAAGTAACCACCACGACAAATACCAACAGAAATGAAGGTTACAAGCCC
AGTCAGCCCACAGGTGGTCAACGTTTCGAACAAAACCGGCAAACAGAGAAGAATGTAGTTACCAACACCA
TTACAAATTACCAAACGCCACGTCCCTCCTATCCACCGACCGAAATAAATAACGAACGTGTGTGCTCATG
CAATGCGGATCGTACACAACAAACTACTACAATAGGCACACAACAATCTACAACCTCGTCCTTCGGTAAA
CCAACGTCGGATAGTAAATTGTATAATCAACAACAATTCACAACACAAACAGCAACCGCATCGGGCGGCC
AAGCGTTCTTTGGCGGTATAACGAACTCTATGTCATTATTACAACAATTGCCGGTGTTTCCACAAGCGCC
AGGTTATGCTGCGTCCTATGCACCGGACAAGATACCTAAAGGTGCCATTGTAGCATTTATGCCGGTAATC
ATTTTACCACAATCAGCTTACGAGCAATGCGACGATAATGCGTTACATACGGCCGACAGATACCAACAGA
ATGTCGACAGCTTCCCATTGGGCGTGCAACCAGCACCGATTCCATTTAGCTTTAGTCAGATTACAGGCGG
TGCACGTAAAGATCAATGCATGTGCCCTTGTTCTTGCACACAAAACATACCAGACAGACTGCACAAGAAA
CGAGACACGAACGCTAGTGACGGACTGAATGCAACCGTAGCCGTAGACAATGCGAAAGAGACAGCTGAAG
TGAAAGCTGTAGAAGCTTTAGTGACGGACGAACAAGCGGAGACCAAAGTGACGGAAAATAAGGTACTAGA
TACGACATCAGCAAGCACGGAAAATGTAGAAACAACAAAGCAATTGACACCAGCTGTGGTGGAGACAGCC
GAACCGGTAGCGTTGGTTGGCGAAGCGACTGCAACGACGACAGTAACGACAAACGAAGATGTTAAAGTCG
CGTCAGAAAGCGAAAAGATCGCAGAACCGACGCCAACTGTTGTGGTCGAAGAAAAGAAAGACTAAATAGA
CGTTATGACGAACGACGTTAATGACGTTATACTACAATTTGTCATCTACATACTCACAAACATCCAACAA
GAAATCCTCTCCAATTTAGGAATGACAAAATAAGTTATCCACGGATACCATATGAAATAACGCCGTCCGT
TAGCAAAAGAGAACGTCAACCACA

Результат:

https://img-fotki.yandex.ru/get/921322/158289418.4a8/0_186e76_8bbda5e4_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/896349/158289418.4a8/0_186e77_144e4555_XL.png
Оригинал: https://img-fotki.yandex.ru/get/896349/ … 5_orig.png

Свинем рамку считывания ещё на один символ:

Результат:

https://img-fotki.yandex.ru/get/893240/158289418.4a8/0_186e78_5223a857_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/212758/158289418.4a8/0_186e79_408c3ce5_XL.png
Оригинал: https://img-fotki.yandex.ru/get/212758/ … 5_orig.png

Похоже на ошибку в исходных данных...

672

Re: Online service PROTEIN PICOTECHNOLOGY

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 86 426

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Обнаружена корреляция между первичной, вторичной и музыкальной структурами белка коллагена.

https://img-fotki.yandex.ru/get/218038/158289418.3e0/0_1763fa_ab3b35c1_orig.png

Первичная структура: Каждый третий - Gly
Вторичная структура: Каждый третий -"5", два других "3"
Музыкальная структура: Каждый третий - сильная доля.

Обратите внимание, что вторичная структура сдвинута относительно первичной на один аминокислотный остаток. Интересно, какой в этом смысл?

Kushelev пишет:

https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Формы, механизмы, энергия наномира. Сообщение 88 047

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34365|complement 1830 nucleotides
ttgagtcttacagaaaaatgtgatatttatgcagctcttcatgatgcaggaattaataga
gtggttaaacatcttatgcaacagcgcccgtctctttttaattttggtacttccttttta
gcatcaaatccaaatctattgtgtgaaaaaattatagctgtgcaagaagtaaacagacaa
cagaatcctcttttaacaatactagaaccaattcctgtcattggtctaccattaagccaa
tctagttcaaacaatttggcaataaattttgcaattcaactttctaaagctgaaatagat
ttccatgaagggaatgtatttcctttaccttcagaacttgtcccattggcaaatcaacgt
ttggctactcatttcaaagtttgtgccggcttggattgtctcggggacttgcctgttctt
agaaggcctccaaataccagaccgtctacttccaaactagaatgtttttgtctagatttg
tatgctataggtggatgcaaaatctctggattagcagaaaaccaaaaaatagggctcaaa
attgatgggatagagatagtggatttaaaaccccaaggattggaaaatgcaatcgaatgt
tatgcaaaatctgtacttaatcatggaatttttccccatgttgctgagattatttccaaa
ttgacatttgggataattactattcctccatccaatggtaacttccaagtatcaggaaat
ttgcagctttcaggaactacgaccgttcctagtaatcctgcaatcgaagatgatcaatta
aaaacatttatcaatttagacaatttggacttggatatcgtattctcaccaaatggtggc
ggtagtggcggtagtggcggtagtggcggcagtggcggcagtggcggtagtggcggcagt
ggaacaataacaagaacagtgaggccgcgatcaagaacaggcacctttgatctaaccgct
gctatatccgaaactacatttaaaaaaatatatggtgcccttcttgaaggatttaaattt
tcagtatcagacacgggcggctctggtatattctcagtaggttatacagtttcggctcat
ttagagaatggcacaatcgatctgcggaataatggttctattctaataagtgaattagac
gtgaaatgggacacattgcagcttaacataggcatagatattccaacacaaactattggt
ggcttttgcctcgttccaaatccatttggtggatgtttgattcgtgctccgtcaattgat
ctttttgaagcatcacctgatatttctttacccttgaacttgggtggactaataacatct
gaaattactttgagtgtaattccaaaggtgttttatggagttggctctggaattccaaac
agatggcaacttaccttagtccctacgcttccaatcgacttggatataattgacgtagca
gacacaattggagatttatttcataatctgattacaaatgcaattgtcagtcttcttagt
tctttgggactccctgattgggctatatcttttatagataccgtgcttggtggaatagaa
ggaataatccgaaacattctagatattggagacgatgtgggtgaatttattttaagtttg
attagtaatgttggtctattccaggatttgattgataagctggctcaattcatagcgctt
acgattctggaactcaaggatcccttggaagttcttgagggaaattctgccataccttta
attccagtaaagttaccaattgaatttttggatgttcggatcgatggtaatggtaatgag
ttgatccttgaaggggatgtgggtaattag

Результат:

https://img-fotki.yandex.ru/get/6109/158289418.423/0_17abfe_d7a43aa6_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/97884/1 … 0_orig.png

https://img-fotki.yandex.ru/get/196102/158289418.423/0_17abff_1e4e2a21_orig.png
В исследуемом белке обнаружен переход программной 335-спирали, характерной для коллагена первого типа в программную 553-спираль, которые строятся под музыку с размером 3/8 (в темпе вальса, точнее в темпе коллагена). Далее программная спираль переходит в бета-спираль длиной 4 аминокислотных остатка.

673

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-24_02:

https://www.ncbi.nlm.nih.gov/nuccore/CP … to=1147826

>CP010409.1:1147629-1147826 Xanthomonas sacchari strain R1, complete genome
TTGCTCTTGCTCTTGCTCTTGCTGTTGCTCTTGCTCTTGCTCTTGCTGTTGCTGTTGCTGTTGCTCTTGC
TGTTGCTCTTGCTGTCTTTGCCCTTGCCCTTGCCCTTGCCCTTGCCCTTGCCCTTGCCTTTGCCTTTGCC
CTTGCCTTTGCCCTTGCCTTTGCCCTTGCCTTTGCTTTTGCCGTTGCTTTTGCTTTAA

Результат:

https://img-fotki.yandex.ru/get/766539/158289418.4a8/0_186e7a_657e7f8b_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/486600/158289418.4a8/0_186e7b_e80eafd5_XL.png
Оригинал: https://img-fotki.yandex.ru/get/486600/ … 5_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/509739/158289418.4a8/0_186e7c_fb61d333_orig.png

Кратная корреляция. Последовательность n(LP) образует программную 3555-спираль.

674

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 92 719

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-24_03:

https://www.ncbi.nlm.nih.gov/nuccore/390878965

>EIP39793
atgctactgctactgctactgctactgctactgctactgctactgctactgctactgcta
ctgctactgctactgct

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/3000d5e05df82b0f99e619b1c724f1d8-full.png

Развернуто:

https://cdn1.savepice.ru/uploads/2017/11/25/a7fee9c75768139b5deb116e95da7660-full.png

675

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-24_04:

>SNB84262
ttgctgttgctgttgctgttgctgttgctgttgctgttgctgttgctgttgctgttgctg
ttgctgttgctgttgctgttgctgttgctg

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/9ca4af06c7990fc32fb3d408f309e751-full.png

Развернуто:

https://cdn1.savepice.ru/uploads/2017/11/25/3cae1eea6707e8f4b637863825d82f8c-full.png

676

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-24_05:

>KMG51759
ctgctcctgctcctgctcctgctcctgctcctgctcctgctcctgctcctgctcctgctc
ctgctcctgctcctgctcctgaaacagtgttga

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/a93064cadf2ae4f2a0875c582bc016a7-full.png

Развернуто:

https://cdn1.savepice.ru/uploads/2017/11/25/7f4bfd5e14ee41b51d6fa6b2601631ac-full.png

677

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-24_06:

>KGM21271
atgctgctactgctactgctactgctactgctactgctactgctactgctactgctactg
ctactgctactgctactgctactgctactgctaccaacataa

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/f9d39d5aaac2c8a4eae33e39838fb0f4-full.png

Развернуто:

https://cdn1.savepice.ru/uploads/2017/11/25/666a4d5b2369eb6ca515b5f1f52edc6f-full.png

678

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-25_01:

https://www.ncbi.nlm.nih.gov/nuccore/GU … port=fasta

>GU134111.2 Odorrana andersonii clone 473 andersonin-J peptide precursor, mRNA, partial cds
AAGAATTGCATTGGATACTGCTGCAGTTTGTAAGATAAATCTTGAATTGGAAATCATCTGATGTGGAATA
TTATTTGCTGAATGCTCAACAGATGTTTAATAAAAATAAAATACATCACTCAAATAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/9df326339d502f92ec37a69b1d8bc9c8-full.png

Развернуто:

https://cdn1.savepice.ru/uploads/2017/11/25/e46c13ebe7141e4763f488f397e655f9-full.png

Вот он, лизиновый "хвост" длиной 10 аминокислотных остатков Lys smile

https://cdn1.savepice.ru/uploads/2017/11/25/89a7b7b955cd71650c84946346422874-full.png
И музыка, под которую идёт сборка предхвостовой части вполне композитабельна...

679

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-25_02:

https://www.ncbi.nlm.nih.gov/nucleotide … JM1D1KU015

>NM_001358260
atggaatcccaggcagccacacccagcagcctgtcaggagagagctgtaccttggatcta
cccgcggtgtgtgacaccagcagttatgaagcatcccagagagtcagccagggaagcagc
aactctctgagttctctggaatcccatcctttcctttcttcttcgactactgatccagat
agcaattctctaaatactgagcaaaaaggctcctgggactctgagaacttctggcttgat
ccttcttcgaaaggccagttggagaccaatgaagaagaggatggacttcggaaatccctg
gatagattctatgaagcatttgcccatccactgccaggctctggggatccgctctctgca
tctgtgtgtcagtgcttgtctcagacaatctctgagctcgagggccaggagagccaaagg
tatgctctccgcagtttccaaatggcccaggtcatcttcagccgggatggctgctctatc
ttacagcgacattccagggacacacgcttttacccactagagcaagaaggcagctctgta
gatgatgaagagcccaccccaggactgtcaagagaggtcattcgtttcctcttggagcag
actgtaatgaaagactcgtag

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/9fb63290f4676f042ba07d8e7ab519cf-full.png

680

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-25_03:

https://www.ncbi.nlm.nih.gov/nucleotide … JM1D1KU015

>ATV90892
atgactcttcatctcacttttaaccgcaccccgaaagggatattagacaccccattggct
acattgttcgaacgagcgttgcccacaataataccaattacttgtggactccttggtctc
ttcgttttgcgtatgtttcgttggttgctcgtcaagtgccgccaacgtaatggacctctc
gccaccacagttctgcaaagactgtgtcaacgtgtttaccgtgcgttaacacgtaagaat
ctctattatgtagagaacctcgagaagaagcgcaacgaaacaagagtgaatttatttctc
tctgagaactctgctcgttttgaccgaactcacctaattggatattgtcgccgctgccac
ctatatggacacaccactgatagcaaactacatggaatcaacttggaagctgtgaccttg
gctaagtactgtaatacatttaactgtacctcttttgagcgtgctgtaaaattggcttac
acagtagcccacatccgtagcttcgaaaagaacccgaaagcctttatggatttctatgga
cattccaaccaagtcctccccaccaagattgctatcgcacctatcgcttcagtgaaagat
ctgaagatgctagacacccaattaggtaccacatatgtaaacaacactgtgacaatccca
catcattacttctacgcatatgctacatatgacgaattagttgatttggtggttaaactc
acaatggctgttgactatgtaactatctatacaacccatgatatgacaaacctgaatgct
gcaaattttgtagtatcagacacagtacccacgtttacaaacacttgcgatatctatgat
gttgtctgcgccgatatgaaaaagttaacgcgtgacggttccgtcctgcgtatgacaaaa
gctcaggcagatcaactcaaggataacgaagacgaaactgcttctacaacttctgcgcaa
gacccagctgatgtagatgcagtggacccactcaagcaatataacaagggtaaacaaaga
aaaccacgtcaacaaaaccaacaaactaatggttatgccaagcagaattatcgttacccg
caaacacgaggcctaggttatggagcacaatacaatacctatgggtactgtaacacgcaa
aatgtacaatacgctaacataacctccccatttggcactcctagtatgcaaccaccgata
caccctggaccagattatacaccagccggtttttactccagtggaccgaatccgcaaaca
aatacggacccggagactagtaaccttaatgctgctgtagtaacacccaacggtatatat
gacccacagcctgagcaaactcaattaacggatcaatttccgccgcaggctcaacaggca
ccagaacagtcaagtactgttatttccagtcaaggtcatcgctattcaacgaaattcccc
tggcttaacgttagcccactcgcgttacttgtaatcattactgcaataacattaccactc
tgtactgctcaaaattgtcgcacataccatacatcacaaacaatctcagtcgacatgcct
gcttcatttagcacgcgtgattcttgtatgcttgtgcacaatatcactgaacgcaccctg
agtcagtttaactacatgttaacccctcaggaatgtttctcagtagatggagtggaatgg
tcaccgcttactcgattaacgtttcaaaatacactcaacatccaaaatatcatcgaaccc
gttgccaacaaactagaaaattacgatttacatcgttttgttagtggtgatgtggtccct
ggcgcacttctggtgtttaaacacgaatttagggaggaactagagattgtacgccgtttt
tataatggcattttaatacaatacttcggttccctaaaaagtgaaggcccctcggatgtt
gtggtgtctttgaatgatcaatccgattattatatcatgacctcgtcgaagcacttcgac
acattgcgcagtgaattagaaaccagaaatcaacacattgtatatctaatagataatgag
gagatcacttgtgaacccccgctttgtgtctatttcaacggattcaactctacagtaaaa
gacctcaacttgcgcatacgcgatacaatcgagattacagttaagcacacgccaaccgga
cgtcccgttctcatcaaccccgcgtgttatgaccaatgtgaatgcatcgatattgtttac
aaagaacccgaacaacgtatagaaaaacaccaattttcggcatcgtactatacagaacgc
agtcgatatttcaaagcttatgcactctcaatttacgatgcattaatggatggaactctt
caacaccagaactttgaaataacccaacatccgtatgtctcaaccggacatgacgaccca
cattgctatacaaaaacatctcaaggtttttgcgtctatgaccctaaactagttgagtta
aatagttgtgtgaacctctacaactacaccatgcaatgcccacctgaactcgacttctgt
aaccaagttatgcaaactcagttttgcaaacctggccatgttgtttcaacggtaaaaacc
actgttttgcaagaatcctgctcaaaaggtaaggaagtagtagaacatggcactccaatt
aaacccacaccttgtacaacatatgagaaagtagaaatctttacaggtgattactcaact
gttccagcagatgtgctgttagtcgacgaatcaaaagttgactcggtagaagaaattatt
agtgttgtcgaaactcaaactgaatcatatccctgttcgaatccgcactttggcaattac
gtcaatttaaaggatctaacagcttggtttgacttactcgatgctagtaactcgtacaaa
catgtaattctaccctttgtgcactacgaacattatgatatatcatctgtattagagtca
gttgcctcgtatatgcttaattgcaggaattatacttggtatcaccattttgaacgtgat
tcaaaccgcgatcaattccgacatgtacctatagacaaacgtgctgtgtacgcatatgaa
ttttctgatatgtccaagaaagattttctggacatggttgctatattctttgacaccgtc
gacaatggacagtacaaacaatacagtccagcattagcaccttcagaaggccgccagcac
acacttcttttgtctattgagcttgaacaagactggattagactaaaccctaaacaacgc
gtctgtcaaaagctacgtgaaatgttcggatattgtgatttcaacttagtggacgtcatg
ttcactatgccatacactctagtacaacatggctcctacgttatgtacccaaaacgagag
cgtacagaattacaaaatcggtttgaatatcacatcaacagaatgaaggattttgcaaat
accatttacagttttgcatacaatgccactgttaatgttacactgacaatgcctagccta
ccaacggttaatctcacattgcccacaatgcctacagtaccaacagtaaatgtaccaaat
cctatgacatatttgtctaattggtaccaggcagttatacaaccacatataaatcaattg
agtgacatctacgtaggctatgaccgcgcatatccacgtatggctacgtattatagagat
tacatagaccgaatcgatgaatctgaactttgcgaagttctacatcatgctgacaccgta
gttatgtatagagattgcattgctaataacatgggtgaagttattttagaattcccacgt
tttggtccaacggcttttgatttccaaacaaaagttgtgaaaaatttaacgcgtgagaat
ctaaaactcttcataaccgcaattggctatacgtatcgtgaagaggtgattatgctatat
cgccccttgtttacggacccctaccaagttgtaccttcttaccacatcccaaatctggtg
cagtattgttttactgaagaaccaaatcagataagaggtacacctttcagcgccgataac
acacaatgtttcccaaagcttactggtttacgtgatctcgatcagtttcttagctgtttc
gttaattaccaatcagtaattgcaatccttttggtattcttctttgtcccaatgataatg
cgtacttttagatatgagacactattgtggacccgtttcgggatcctaaccacaattttt
gttgttaaatacctacacactatactacgtgttgactggatgttcggaaatctgctttgg
tggattacatccgtacaaatcgtacccaacagtttaactggtattaaggtagttacacac
ttcgtctatatcatcgcattgcttagtcaagcgtatactacgctacatgacctccaacgt
acatgggacattaagtttatgcctgcattgtgtcttacctatgtagaactagcattctat
ggttttgacttctatcaaaaatactttctcactaacgtatttagcaccttactccttggt
atattaggcactggtgtgctttatacctttagagatgcgctaaaaccggcccacaagcga
aaatacgttactctgcaacaagctgcaaacgattggtgtgcctttcgtgattcgcaacgc
acaccaactgattcatatgcccgtacaatgtgccagaagccttttcaggattgtatcggt
agtttagacgttgaaaaacttctaaaagccgattaccttctgcaatgttataacaacacg
gttgggacaacttttaacccaaaagagtgtatgctgataaagcagtttaacgttaatgaa
tggctggcacgaaacaccacgcaccttgcagaaaaccgttctcaacttcagaaccaaaat
gcgtacaccaacagctcacaacgatatgttgttcccggttgcaccccagaaatgaacccc
aagttgacttttctcaacccgactacgcaggtacgtagtattctatatggtgcaattgtg
gacggctatttgtacatcgaacgtcatatgtttggtggtgacaaggaaacgttcctaaag
aattacgctgatggtgagggcttgacgcacgttagtccccttcctcaatcaatttacaac
atcgcagaggcaactttgtataaaaccatgattaaggttccgttgcataaaccacaaccg
agccccttcaagaaacaccctgatcccaacaaatacactggcccagttcagatgtatgtt
gacaccaggatagtacatggtttcattcaagaaggccatcatgatatttgtacacaaaat
ggtgactgtggtggtatgctattcacgctaaatggcgaattcctaggcttgcattgtgca
ggatccctagatgtcgtctttgcagataacaagaatccaacaatttggactggttataag
aatccgcaccctagtgagattatgattactttagatagtgacataaacttgccaggtgat
accaccgactacgattttacaagtacaaaagtgatatacaaacatcccctgcgtgctgtc
gtacctacattgcaaacactgcaacatatcaccaattcaagcaatgagtactacccatac
gacaagttgttatatcgcgatttttccatcactgaggaggactacctaaaacacaaattg
tatgtcaactacccctatttcgtcaacaacttcaagaccatcataaaccacacactaggt
tccaatagcttggaattctgcttgaaatatggcataaaacaaattcaatttgtacataga
cagttgcaaaatcatgcagctatagaggaaacatgtaaaaatacttggcttgtactttct
ttgaaggtcgcccttttcctctttatgtcatatgcccactattatgctagcggagatgga
caagcacccactttgagaaccattatgtgtggtcttatttggctactagttatcgctcta
caaacgtactacccaggtttgaccctcgtgttgtatattactgaattcattataatgacc
actcaattgtaccattacgctctatttatagggctgcactttggctacttccagttatgg
cctgtaaaaggagaacttttgtccctacggtcattctttagccaaatcaaggaggccatt
gtttattatacaatcacgaatcagaataccacagaagaagcacctcagcgcgcattggct
ctacggttaggtacaaaagaaaacctatgtgcccacctgtcaaccgtgctgaaaatcctc
aaacctaatagtgcattttccaaattaactagtgtgaccaatgaactcgatgatttacgt
gcaacatggggctctgacccacaagcatcaacaaagctggatagagccataacggagatt
tatgccttgtacccagtgttgtttacaattctcaccaaagttaccgattatgatactcaa
atacagctactcgcatcctatataggagaacgaggcgacttcgatttggacaacttcgaa
actaagtatcaaggtgacttggcaaaagctggttacactaccatcgagcgcgaactagtt
gaagaaagcgacgaaatagtaaacactattgacacccctgacatgcaaacctcattaacc
ttagtatccaaggcaaaagaaatgcaaaccattgatatctccacgatcgatgaccaacgg
ctcccagagctgatcacaaccttgataaattatactgaggatataaccaaagtcgatgtc
aaattgataaacaccttagctgatcgaatcgtatgcatcttgcaggcattacgtgcagat
aaggatgagattttgaaacaagactttgctgagtactttttgcaactccgtaagtataaa
gatttctttgctacaactgtgaccggtgacatgcgccaacgcaatatagtcggcaacacc
ttttcaaggattattgctcaactatcgcgttgtgttaatgcccaagaacaaacccgtgca
cagatagcagcagcagcagctaagattcgccagaaggaaagctcgcgcttaatccaagaa
gctaacaaaaatcggaaattacagcgccagaatcaaaatatagctgttgctattctgcat
atggtacatgcatgcctagcaaatcgctttatgctacaaaatcaggtttctataaacaat
tgggcaagtatactacctcgtatagccgcacaattacgccctcttggaatagaaactcta
accaacgaagacgatagtaatgtactcatcacaaatgaagtgcaaagaagtgacttcgta
accctgcaatcaactctgtggactggaaatgtgtacgccgttgttacctcaatttgtggt
aaaacaccatttgtctgctcaacagatcacaaacacagccactataactgcaacaagagc
cttttcccagtgtggtacaaacacgtatcctcctgtcaggagtgtatgtttatgtacaat
aacggaacacatccaatctgtggccgacgatacgacgatgaaattgtgaagcgcacaaag
cgcccaacctatctcaatttcctcgaacgctacaggtcatgcccagattgtattccctgc
acaacttgtgtagtaaaccgagatacacactgcgattccccctcttaccattttgaaggt
gacgaaacagcccctaaaatggcaaccaaccaatcatatctgacccccgttaccatcaac
cccgcaaaattggagtataacacctcacctggaaaaatcgatgcttgttttaacaataaa
cctattgttacacgctttacagcttgcccggtatccgtacctgcaaaatggcgtccatta
acaagaattcgttcagatccagacggtttttactatgtcacggagaattgtcctaatgac
attagtattctgaacgcaacaataaatgcgattatccagcgcttaggtgatataccccca
ctaccagctgatgatagtagtcgcttagatccagggttgatagaaaaccaagcccttgca
gagcctgaaaactatgcaacctttacgacaactctatccagcactgaactggccataaaa
ctcgatgaacacccgatcttggttaacgtaattctcaataaagactttcagacacaacag
aaacaattggtgtctgaacttcatgacatttgcccttctgcgcatattttgtgctattat
gatgctaaggcatctgtgaatgtcataaattattacgttaaccatgtatcggtttcacgc
ctccctcttacagatgaaaagggaatggcaactgcatttgacactctctctgctttgtac
gaaaacccaccggattttggatgagagtgcggccagatatcaccaacttcgtgttgtgac
aaaacccaagaagattcattacacaattgatcgctcctgcaacaaaacttccagaacatt
tggaactcccagtggtaatgttaatgttaaggttaagtcttcaacgcaacacgaattcac
cgtttaccaacatctcatcaaccaaaacgccgacctattcatattggcccacgaaataaa
aattcagaaatactttgtatacctgtaccgacacaacatcacttccataagtgtggcgga
catatacggtataataaagtacggcgattggaaacccttatacaacgcattgcgagaggt
aacatggcacaacattcgaaccgatattattgtcagcatccaggagcacaccaagcgacc
acagcatacctgctgtctactgtgccgccagttcttagccgagctaggccttttcatgca
caagttacatgaccgggtatttcaaacaacgaaatccatgtatcgcttctataattttgt
gttgaccgctgataatgtagatttgaatggtattttagattttgaagattacatacatag
agacacagtaatagagccaacggaactagcaatagttaaatgtatggcaccattctatca
gatgctgtactctttctatgaacatgtcggtatgtacttcatatctcatccaatctactc
tacctctgctattacctctgacaacttgttagccgaatatgaaaatgttgtgctagctat
gcgtcaagacccttcatctctcacaacccatatacagagaccccctatcacagaattctc
gaaattcctacaccttgatacctatgctatcgctcccacacccatttatgattctttcgc
tgatatagaactctttgaacgtgactctaggatcccagaaaaatttcatgttgctatcct
acctgtaacacgtgaatatgtggattgtgaaggtttcgatcagtatgaccaacttactga
cacgcagcagcacttcagagtggattatgaccacatgaattgtctcactaaacacttttg
gagtctgctagaacaatacaacatcacagtcctgtcactctatatcaaaaaccacccata
ccgtgactattatcataaacagaacttacgctcatgcttaaacatttgggtacacgcgct
ttatgacgcaaatgtcaatatttcacattttgactcgctcaattatgagaaaacccaacg
cgccaccttccccatagtaggagaagtaattgcaaaattgccctctgattgtgagctatg
ttcgtcaaaaatcccaccggatatactttctgtttatgattttggatctaatatacacgc
taaagctcagctttgcgatggttacggaatggaacgtaagaaccccttagctgaatttga
caccgcattgcagaaaataggtacttttaccgaaaattccgactatgcatacaatatgaa
aacacaacctccccttataattgataatcaatttatcaagaatctagaagaccaagggtt
gaatatcatagtcccacctgaaagaccgaacccagcaattcatgatcctgaatgtacata
ccatagcgaatattatatcaaaacaccttcgctaggctccattaaagaagatttggaact
cttcaatcagaatacagcaggatctatgtcacctacggttatgctaatggcacttgattt
cctaaatcagttgctatatgacgaactcttagcagccgatggtgcacctaattgcccata
tgtaccagatgaagtgcccattcgaaataaacataaatcagctggtactccttacagaaa
atacggtgattcagaattcatgcgtaatctattcgatgagtatcgcaacccacttgtaca
ccacaaacgccactctgcagatcaagcacttacgcttaccatcaacaaagtctcaatttc
agctaagcatcgcgatcgaaccatcctcgctattagtattttgaaatcagaagcaggtag
atctctcttccgacgctatctggaaaagattaaaaccatggcaaatgcaggaggttctat
tttgataggccttattgcacaatatggaggttgggacaaaatgtacaaaaacctttacgc
tgatttccctgtagatgacccaaaagtcctactaggaggtaaagattacccaaaatggga
tcgccgtataagtaatttgctccaacttttaacaacgaccaccttcttcaacttagtcga
ccctgtcacccaaatggaatacaacaacgcaactccaaacgaaacctggcatgaatatat
agccgaaacaaccaacattatgtttgattacctagtgtttggtgacgaattgtaccaaaa
acccggtggtgtcacctcaggaaacagtcgtacagccgatggcaactcattgttgcactt
actcatagatttctacgctattactatgcagttaattcaatctactgcagataattttaa
cgtggaacgtgatgttagaaatcgactggcacgtattgctcttgaggttataccatctga
atatattcaggatccccagatctacacacaaccagaaatcctaaagtacattcgtcgtaa
cattgctaaaggtgcatacctaagtgatgacggcttactattacatcgcacagacctgat
ccaatacaatgacttcatgcacgaatcattgctattgtcgacatatgatatccccaacaa
ttgtcacaaatatcatcaggaccccgtaaatcgttatgctcgcgaatttctatcccagga
tacattccagtttggtgacatggccttccctttgcctgaattcggtcgcatatacacagc
tatggttttaagtgacaataacaactcaaatgatccgcagattaacatcacgcggctcat
gtcactttatgccttcctatactgctactatttcaaatatgctgacaatcccaaccacaa
gtacattaaatttctagacgcagttagaaagtacttggatgaacatctcaccacctatga
tgacacgttcctcgactgcataccacttcaaattcaagagagcgagcaagtttttaactt
ccgtaattgcgatatgtttgagaacttcgaccatctctggggctttgaccaaagcaatgc
ctatgaagcatatctgatgaaatacagacaccgctatcccagactctcgcaatataaact
cgcatatctctatgaattacagccagaggcagccaaccagttgcaaaatgaaagtcaata
cattctcactttttgctatgtttgtggcggaaatgcttacattacttgtgccatttgtta
caagtctttttgtaatagcatcgataacaatcacggttctcaccttgaacaacactatta
cctctcacaccatgagcggtatactgttaattcaagagcaatttcatgttctcattgtta
tgagaatgacatctcgaagttgtatcgagttaccccagaaaagtacgcttgtgaacaaca
caagccagcgaacgctagtgctcttgttacgccaacaaatactgctacacctaagcatat
caacttatgtgtagttagatccccagccacaaacatatacgaagaatctcttcgtgcata
taatgagacacacagggactttcaactaacaccccaacaatatagtacggctgtctaccg
tctactacaatatgactacacgctgcgcgatagtcaagtggacggccatatacgttgcac
aatgaaattgtgttcatatggcatcgtacgaccatactaccaattggtaatgtcactcac
acacaaggaaagcaaagcccttgatgactacactgtggatattcccgtgctcaactctta
cactgaacacaccaactcatctgagctcactattctggaagtaccccaagtctataaatt
cgatcagcattcgacttacagtttggtaacaccagacaatcgggaaattccaataatgcc
acagtaccacaaccttagcgttaccaaaacccatttatggtcactggatctaccaccaac
aattccacctaagataatacgccaaaaacgcctaaacattttaagcacaatcctccgcac
atcaacacgccacattccagtatatctgaaacttcttatgtcctgggacactagactatc
tacaatggacgaatcttatccgttatgcaacccccagtactttaaaccatcctttatagt
acctcggataaatgacgttttgtctttactgaataagcgccgctttcaggttatttttgg
tggtccaggtactggcaagtcaaccttgttagcacacctggtacaccatgtccattcaga
aaacaaacgagtcctaatttacacgccatcgcatcaatcagcgaattcattactgtataa
gatagcagatatctttcagcagtatcgtgtaagtaaaccaggcttagtacgtataacaac
agaagggatgaaagatttgaaactcaaaaatcaccctgctataacttaccgcgatagcat
gcacatgaatgacaggattgtagtcactacaatacaaagctattccgctgtaaattttat
agaaaagatcgacctcgttatactagatgagtttagcctgaccgcagatagctatttggt
tgctggatttgcacactttaaaccacgaactcgcgtactattcaccggtgatcctaggca
acttagcaccgtagatgatgtacgtagagatttagacccacgcttccataccttgattaa
cttctataccgaaacattccctacagaagtatatgtattacgagaacattaccgatgcca
ccctgacatatttgatatgtttaagaatctttattacaaagataaagacatggtctgtaa
aactactgctgagcagcgtgcaatacgaccatacatgccggtaaatacaatacatgtcga
gtcttgtagctataagaatcaaggcgtctatttgaataatgacgagcgagaacaagtcca
gaaaatcctccgcgatgtagttgaggttttacaatattgcccaacttacacagcggatgg
tcgcagcgtacctaaaaccattgctattatctgtagttatagttcacaattgcaagcatt
taaggcagagcagcgggctggtaatattccctctgatgtcaatttaacaacaattgactc
tgctcaaggggatgaattcgacatagtcatcttatgtctcacagaaattaacaacttcac
gttaaaccccaaccgctttaatgtagcaatttctcgaacccgttccgttttgtttatcac
agtacccaaagtgcaaagtatgtatacattacgttacaaggaactatatacagagttgta
ccttcgaaaatgtttcgaatccttctcaatgtacaacacaggtcatagcatggaatactt
cgaattccaaaatcttttacaaaatcacgcacagccaacggaagaatacaaaccatcaga
ttacatcaacctgcgggacatacatactgaatctgctgtcacattgccaattaatgttgt
gcaatcggactacatattctttgacgcagaattcttaaatcctcatgtccgaacatcaga
agctgtaaatattgcgtttggctttgttcatggaaattcgacccgctcagtgtctggaac
accaaggcgttttgttaaaaatcgtttaggccatattaaacccattgaatggccctatcc
atccggacgtgatccatttagagtctacagttgccactggctaaacaaaaagcctgagta
tctcgcagcactccgtaaacttgttgatcaaggcttacaattcggctcacatgtagactt
aaaacatcttcttgtatattgccgtgacaacatacatgttcgccctgtaattgtcactta
tagcggaaaaacagacctcacatttttcaaggcatatacattatatccacccgctaacac
cacatgtagtgtaatacgttgcttatcatcccctatctacgctgctcaaaacgatttaag
tacccaatacctatgttcgtaccatgcacaacaactaacgtacatagagctaacccactt
cgtcaatctcgaaactatcgatttgtcaccagtgacttctgatggagtgagaggaatcaa
ggttacgcacaataacaagttacttacgcacgtagagatccctgaggagataccaacgaa
taaattacaagatttgcatgaccacttttgcaaatcaggccatgtttgcactgcacatga
tcccaaggatgacgcgcttatgacacaatgtctgtacaagaatttcatttaccctaacat
cgagtacataatcaatgatccccaaggtaatatgaaatatttcttgtctacaaaatatcg
gcttaagaacttcaatccaagcctttgcacaatcagacgtacacttcaacaagtctggta
caacaagtataagcaaaaattcatctcgcattgcaatatgggctgtggcaaaaacacact
cgattttgcagtccacaatgtagacattacccgtggaaaagacccgcaaaataacatgaa
tacacacatttgcgaatcagaagaagacatctattttgattcacattggtataaaataac
accatacacgaaaccatcgtatatcttttacgataacaatcctgaacattattatagcat
tgggaataccggtaaattactatatctcaatagtaagtatgccatatatcaacatgaagt
accaagcttgttgggctccgatgtatttcctgaatacttcacacaatgtactacagaggt
agtatttcacaccatgttgactcccacaaataagtccctaccaaaatgctataaacccgc
aaccaagaatggatctgacgtttttgttggtacagtatgtactgaacataacttgcagtt
agacttaatcgaccagatatatcaggctattgagtacggttacagattccaaaagattga
accaattcctgataaagccagcatcaacaatcatactcttcaactggtaccacacagctt
cgaccccaccacattagaaattccaggctatactactcgtcctatgccgtttagtaacca
catggagttgaaagctaaaggtgttttacacatgttgcaagatgctatgatctatacagg
tatcgctttagatcctacaaaacctgttatcaatgctggagccgctggcaagctaggtaa
tacgcctatggccgatgtcttcgctaagtacctcacacagcaggttataataaatgtcga
tccaagattggttccaaataaggataataacaactatcctatcacaattgctgaaatgta
tgacattggttttcgaacccagcttataatttctgacatacacaacaacgatagtccctg
gcttgaagacctcttcgcctatgctgatcgctacctactatccgaaggtgtactaatctt
caagttgactagtcgtattgctacgctagacaacctgcagttaatcaactcgtatagtaa
aggttttacatacgtcaaagtattaaaccttggtgtcgttccgagctcctctgaattgtg
ggtgatctttgctaacaaatctaacccgcctgtaaatgggtggatctctcacaacctcat
tcaggacctcaggcaacattggtataaaatccaaaccgctacagaaccgatcaagccaaa
ctaccagatatttaaactctcaaagtttaaatacattcccaagaaatcataa

Результат:

https://cdn1.savepice.ru/uploads/2017/11/25/b8f150b4e76ebcd99e4b3f5c24fd75bc-full.png

Развернуто:

Оригинал: https://cloud.mail.ru/public/F4Fp/zf8q9Q8jm

Фрагмент:

https://cdn1.savepice.ru/uploads/2017/11/25/73f97987e0704b973d8d236124d82d2a-full.png

Фрактальная программная 55353-спираль.

Вторая половина кода данного белка в базе данных приведена со сдвигом рамки считывания, т.е. с ошибкой.