991

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

http://nanoworld88.narod.ru/data/325_files/0_926f6_87483509_M.gif
Details: http://nanoworld88.narod.ru/data/325.htm

992

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-20_001:

lkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkj

>XM_014025634
atgaagttccaccgtctgataaagtttcaccgtctgataaagttccactgtctgataaag
ttacaccgtctgataaagtgccactgtctgataaagttcccccgtctgataaagttccac
tgtctgataaattaccaatgtctgataaagttccaccatttgataaagttccactgtctg
ataaattaccaatgtctgataaagttccatcgtctgataaagttccactgtctgataaag
ttccaccatctgataaagttccaccgtctgataaagttccaccgtctgataaagttccac
tgtctgataaagttacaccgtctgataaagtgccactgtctgataaagttccaccgtctg
ataaagttccactgtctgataaagttccaccgtctgataaagttccaccatctgataaag
ttccaccatatgataaagttccaccgtctgataaagttccaccgtctgataaagttccac
catctgattaagttccaccatctgataaagttccaccatctgataaagttccaccatctg
attaagttccaccatctgataaagttccaccgtctgataaagttccaccgtctgattaag
ttccaccgtctgatgaagttccactgtctgataacgttccactgtctgatgaagttccac
cgtctgattaagttccactgtctgataaagttccactgtctgataacgttccactgtctg
atgaagttccaccctctgataaagttccaccgtctgattaagttccactgtctgatgaag
ttccaccgtctgataaagttccactgtctgataacgttccactgtctgataacgttccac
tgtctgataaagttccactgtctgatgaagttccaccgtctgattaagttccactgtctg
ataaagttccaccatctgataaagttccactgtctgataacgttccactgcctgatgaag
ttccaccctctgataaagttccaccgtcttgataaagttccaccgtctgataaagttcca
ccctctgataaagttccactgtctgataaagttccactctatggaacattctga

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/DZsSw8a3_oPTjw
Развернуть: https://yadi.sk/i/a6x4A62j8Z796A

Музыка сборк (MIDI): https://yadi.sk/d/y-bU251GhflIMA
Готовое музыкальное произведение с вариациями. Вполне подходит для анаржировки.

993

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-20_002:

ghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfr

https://blast.ncbi.nlm.nih.gov/Blast.cgi

>XM_001626628.1 Nematostella vectensis predicted protein (NEMVEDRAFT_v1g125447) partial mRNA
GGTGGGTACAGGGGTCACATAGCTAGGGGTGGACACACGGGTCACATAGCTAGGGGTGGGAACAGGGGTC
ACATAGCTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTGTAGGGTTCACAAAGCTAGGGGTGG
GTGTAGGGGTCACATAGCTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTACAGGGGTCACATA
GCTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTACA
GGGGTCACATAGCTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTCTAGGGGTGGGTACAGGGG
TCACATAACTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTACAGGGGTCACATAACTAGGGGT
GGGTACAGGGGTCACATAGCTAGGGGTGGGTACAGGGTTCACATAGCTAGGGGTGGGTACAGGGGTCACA
TAGCTAGGGGTGGGTACAGGGGTCACATAACTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTA
CAGGGGTCACATAACTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTGTAGGGGTCACATAACT
AGGGGTGGCCACAGTGGTCACATAGCTAGGGGTGGCCACAGGGGTCACATAGCAAGGGGTGGGTACACGG
GTCAAATAACTAGGGGTGGGTACAGGGGTCACATAGCTAGGGGTGGGTACAGGGGACACGTAGCTAGGGG
TGGGTACGGGTGCATAGCTGGGGGTTGA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/EEcyREmn2RfyeA
Развернуть: https://yadi.sk/i/QFv33V6sGTOGHg

Слушать музыку сборки (MIDI): https://yadi.sk/d/V9YziKhcy3TdCA

Музыка любопытная...

Кстати, строку поиска набирал ... котёнок лапой smile Я просто повторил то, что он набрал 10 раз smile

994

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-20_003:

ghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfr

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/IT5HTmyBsUVCcw
Развернуть: https://yadi.sk/i/F98UqqkqATKTxA
Типичная схема вторичной структуры белка с большим содержанием пи-спиральных участков.

Остальные 730 структур, полученных по файлу GBK можно получить бесплатно по заявке в этой теме.

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/cG6GFzrfeUUzug

995

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-20_004:

lkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkjlkjhkj

https://www.ncbi.nlm.nih.gov/nuccore/160361034

6040 вторичных структур по этому GBK файлу определятся за ночь...

996

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-20_005:

ghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfr

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/WRLq6Xvbp3cIGA
Развернуть: https://yadi.sk/i/6KR_UmZUQaUT-w
Слушать музыку сборки (MIDI): https://yadi.sk/d/1qoLbCClhxS69g

Музыкальный размер 3/4 слышен на протяжении почти всей сборки белковой молекулы.

997

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-20_006:

ghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfr

>YP_009173439
atgttaacatattctcaatttaatagaaaaattgctggacaattatgttgttgcccagga
ccacaaggcgctcaaggagcaacaggggctcaaggtgcccaaggagcaactggatcacag
ggcgcccaaggagcaacaggatcacaaggtgctcagggagccactggatcacaaggagca
caaggtgcccaaggacatacaggagcacaaggctgtaaaggaccccaaggagcaactgga
tcacagggcgcccaaggagcaacaggatcacaaggtgctcagggagccactggatcacag
ggcgcccaaggagcaaccggatcacaaggtgctcagggagccactggatcacaaggagca
caaggagcacaaggcgccactggatcacagggcgcccaaggagcaacaggatcacaaggt
gctcagggagccactggatcacaaggagcacaaggcgccactggatcacaaggagcacaa
ggcgccactggatcacaagggcacactggagctcaaggtgcaacaggcgcacaaggacat
acaggtgcaacaggcgcacaaggacatacaggtgcaacaggcgcacaaggacatacaggt
gcaacaggtgcacaagggcacactggagctcaaggtgcaacaggcgcacaaggacataca
ggtgcaacaggtgcacaagggcacactggagctcaaggtgcaacaggcgcacaaggacat
acaggagcaactggtgcacaaggagcaacaggagcccaaggagcaacaggagcccaagga
gcaactggtgcccaaggagcaactggtgcacaaggagcaacaggagcccaaggagcaact
ggagctcaaggagcaacaggagcccaaggagcaacaggagcccaaggagcaactggagcc
caaggagcaacaggagcccaaggagcaacaggagcccaaggagcaaccggagctcaagga
gcaactggtccagccagtttacaaactttaaatgttacaactggtataacaggaaatcac
gaaccccatagggtagcatatgatttaactaatataaatttactatcttttagtaataca
agcgatggatttaatataaaatttgttgataatacacattttccagttttaccatttgga
ggagattcaagtaataatgctccattagatagttcaggtaatccagttcaattaaatcat
tcatcttggttaaaaatagaattacaagatacagattggaataatattcataatttaaaa
ccaggtgataatatagcatatataccaatttattggtataaatcttga

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/os67q7W2fKq60Q
Развернуть: https://yadi.sk/i/SzgG1m3xNxrwNw
Слушать музыку сборки (MIDI): https://yadi.sk/d/lg9mBuZuM28hvA

998

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-21_001:

ghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfrghbuitgfr

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/pi6lNsaQGIGcrw
Развернуть: https://yadi.sk/i/KGtIo4N2wzjR4g
Слушать музыку сборки (MIDI): https://yadi.sk/d/9gzsnCyPL3psQQ

999

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-21_002:

gfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkyteph

https://blast.ncbi.nlm.nih.gov/Blast.cgi

>XM_002952123.1 Volvox carteri f. nagariensis hypothetical protein, mRNA
ACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTA
AGTACATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATGTACACA
CCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTAC
ATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGT
ACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATG
TACACACCAGTACCCTAAGTACATATGTACACACCAGTACCCTAAGTACATATGTACACACCAGGTTTAC
AGTGATGCTAATCCATGTGTCATGTAA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/Jt2ebiIkoC_BIQ
Развернуть: https://yadi.sk/i/HmqIZe3PrCGqTQ
Слушать музыку сборки (MIDI): https://yadi.sk/d/K1d1XJI1EU76YA

Программная 272555755-спираль строится под музыку с музыкальным размером 9/8

Некая отрешенная музыка...

1,000

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-21_003:

gfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkytephgfpkyteph

https://blast.ncbi.nlm.nih.gov/Blast.cgi

>SJU36761
gtggcttcttccacaactaatgcattcatatctccttctgcatttcctgcattagaatct
tcttctgcatttcctgcattagaatcttcttctgcatttcctgcattagcatctccttct
gcatttcctgcattagcatcttcttctgcatttcctgcattagcatctcctcctgcattt
cctgcattagcatctccttctggatttcctgcattagtatctcctcctgcatttcctgca
ttagcatcccctcctgcatttcctgcattagcatccccttctgcatttcctgcattagca
tcccctcctgcatttcctgcattagtatctccttctgcatttcctgcattagtactttct
tctatagtatctgcgaaagtatttgacgcattaaatgatgctactgatccaagtcccatt
gagatacttaaaatcattgatagtgctttctttttacatttttgttgcataaattccccc
tccccttaa

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/DKLCL-D3Dtp_jg
Развернуть: https://yadi.sk/i/-a3PWNBKOO3IOw
Слушать музыку сборки (MIDI): https://yadi.sk/d/EbtUvRSGs5NXqQ

277727727-спираль строится в музыкальном размере 9/8

***
Continue: http://nanoworld.org.ru/topic/2078/