1

Тема: Online service PROTEIN PICOTECHNOLOGY

X-ray diffraction analysis does not help determine the structure of these proteins, even for a trillion dollars

Формы, механизмы, энергия наномира. Сообщение 88 042

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

You can get the structure of any protein here and now.
The first 100 orders for the account of Nanoworld Laboratory.
For example, in this form:

Order.

https://www.ncbi.nlm.nih.gov/nuccore/749158428

Закажите структуру белка сейчас! Первые 100 заказов за счёт лаборатории Наномир.

Для заказа достаточно опубликовать в этой теме ссылку на кодирующую нуклеотидную последовательность интересующего Вас белка. Например, в таком виде:

Заказ.

https://www.ncbi.nlm.nih.gov/nuccore/749158428

или так:

https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

Можно просто задать саму последовательность:

atgcccggaatgatggccattaactcagggactggtggacccatgtctggtggtcccatg
tctggtggtcccatgtccggtggccccatgtccggtggtcccatgtccggtggccccatg
tccggtagtcccatgcctggtggtcccatgtccggtggtcccatgtccggtggtcccatg
cctggtggtcccatgtctggtggacccatgccgtacaaccaacaaggaatgatgggccca
ggaatgttcatgaatcccgcccaggtaccgccaggggtcatgcatccaggagcgatgcat
ggaatgccgccgggcatgatgcagatggccgggatgtcatctcagggcgggccgttgggt
ccaatgagcataggctccggcggccacctcggaggcatgggccagccgggcggaggaggc
tccaatacaatgggcatgatgcaagccatggggcaaggtccgggatcgaaccacggacct
atggctaaccgcatgcccccaggccagatgccgggaccgggccaaatgccccctggaccg
ggtcaaatgccccctggaccaggtcaaatgccacctggaccgggtcaaatgcctcctggg
cccagtcctggccagctgcctcctggatccggtgcaggacagcagcagtcgtcgggcggc
caacagcccacttcaggccagcccaatggttcgcagcaggggggaacggcgagtccttct
ggaatggtgacgccgaacatgaacggagggaaccccactccgcccgctcaggacggtcag
cgatttcctttctcagtggaggcacggcggttcgcagtggagtcctttacaggtactggt
cggtgcaactttaacaaggccgcgctcaaaaagggatcggaatgcttcttcatggatcga
cgagtacgcaaactatgtccggttttaacgcacgctccggttgaacgcacactgatgaat
accctacacaaataa

Результат, т.е. вторичная структура белка будет опубликована в этой же теме в таком виде:

https://img-fotki.yandex.ru/get/218038/158289418.408/0_1789ea_a6723a52_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/117896/ … 6_orig.png

Если интерес заказчика возрастёт, и он захочет увидеть третичную структуру, то буду пробовать определить и её, хотя 3D-версия Пикотех пока до конца не настроена. Тем не менее, для большого класса белков она показывает адекватные модели.

Сервис постоянно совершенствуется, поэтому результаты будут улучшаться.

"Нет предела совершенству" smile

http://img-fotki.yandex.ru/get/5506/126580004.42/0_b37ab_6493b0b7_S.gif http://img-fotki.yandex.ru/get/9116/158289418.af/0_ae267_2d0606e3_orig.gif

Цены по старой технологии: http://nanoworld.org.ru/topic/1702/

***
For our overseas friends.

Что такое программа "Пикотехнология белков", и как её грамотно использовать

kushelev20120@yandex.ru
2D and 3D protein structures up to the picometer
The Picotech program can not completely replace  X-ray structural analysis. However, it greatly strengthens the weakest points of the X-ray diffraction, namely, it shows reliably the secondary structure and the short-range order of the arrangement of the atoms of the tertiary structure at the time of assembly of the protein molecule by the ribosome.
The sensitivity of X-ray structural analysis is such that it does not notice not only individual atoms, but also individual amino acid residues. Moreover, the "tails" of protein molecules that do not crystallize, the PCA generally "does not see", and these "tails" can consist of up to 50 amino acid residues.
A special class is formed by 97% of protein molecules that do not crystallize. About them, the PCA simply does not know anything, and the Picotech program also reliably shows their secondary structure and short-range order of the arrangement of atoms in the tertiary structure.
Your application must contain only the code of the protein of interest to you from the PDB database, or mRNA for it
We will model your protein complex with ligands of any nature
The lead time for the order is 1-7 days, depending on the complexity of the project.
Digest https://picosoft.nethouse.ru/
Online service PROTEIN PICOTECHNOLOGY  http://nanoworld.org.ru/topic/1699/

2

Re: Online service PROTEIN PICOTECHNOLOGY

https://img-fotki.yandex.ru/get/228174/158289418.41b/0_17a8ab_20d9f8d7_orig.gif

Формы, механизмы, энергия наномира. Сообщение 88 044

Пикотехнология белков, ДНК, РНК - 3

Онлайн сервис белковых структур уже функционирует!

Ну что же, пока заказчики не в курсе, продолжим тестировать онлайн-сервис.

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34243|complement 270 nucleotides
atgccaactctgatgccaaagattcgtgtcaccgtcctttattttgccttcatacatgaa
ataactagaaaaaaggaggaaataatggagttgtccacaaatacttcaataaaggaacta
atattaattatactaacccggtatccaaacataaaaaacataaagaacataaaaatttct
gtcaattaccgcattgtcaattcgaactcaaacttaattctaaaaaatgctgacgaagta
gcccttctaccaccgatttctggaggatag

Результат:

https://img-fotki.yandex.ru/get/177902/158289418.422/0_17abd4_bc2ddfcd_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/3014/15 … 4_orig.png

3

Re: Online service PROTEIN PICOTECHNOLOGY

https://img-fotki.yandex.ru/get/198860/158289418.3e0/0_176329_6d9df850_L.gif

Формы, механизмы, энергия наномира. Сообщение 88 045

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34281|complement 1116 nucleotides
atgaatgatttcattactgtaaacaaagctttaatgactttcgccgtattagcagtatca
tttgtactacttgtaggtccaacttcaatgaccgtgaatgtatttgctacaatcaataca
gctaaccaaggcataggccaatcacaatcctctaaccaaaacgcactatgtgtatcaggt
accggaactttagtttcttgtaataacttgaatgcacaaaaccaagcaaacagcggaaac
aatgcagccgcacaacaaggaggtactggtaaaggcggtaacaaggctaaccaaggcata
ggccaatcacaatcctctaaccaaaacgcagcatgtttgtcaggtaccggaactatagtt
tcttgtaataacttgaatgcacaaaaccaacaaaacaccggaaataacgcattagcacaa
caaggtggcagtggaagcggaaaaggtaaaagtggtggcaacacagctaaccaagcaatc
ggtcaatcacaatcctctaaccaaaacgcactatgtgtatcaggtaccggaactttagtt
tcttgtaataacttgaatgcacaaaaccaacaaaacaccggaaataacgcattagcacaa
caaggtggcagtggaagcggaaaaggtaaaagtggtggtaacacagctaaccaagcaatc
ggtcaatcacaatcctctaaccaaaaaagcggtgtagtatctggtggcaacactgctggt
tcaggaaacaacgcaaacacacaaagtcaaaataacaccggtagtaacgcagcagcacag
agcggtggtagtggaaaaggtggcaacacagctaaccaaggcataggccaatcacaatcc
tctaaccaaggtagtggtgtagtatctggtggcaacactgctggttcaggaaacaacgca
aacacacaaagtcaaacaaacactggaaacaatgcagcagcacaacaaggtggtagtggt
agtggtggcaacacagctaaccaaggcataggccaatcacaatcctctaaccaaggtagt
ggtgtagtatctggtggcaacactgctggttcaggaaacaacgcaaacacacaaagtcaa
acaaacaccggtagtaacgctgtcggacaacaataa

Результат:

https://img-fotki.yandex.ru/get/6311/158289418.423/0_17abee_2ddc6346_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/201221/ … 2_orig.png

В исследуемом белке обнаружена программная спираль:

https://img-fotki.yandex.ru/get/16167/158289418.423/0_17abef_c9f52e91_orig.png
Программная 53235352-спираль строится под музыку с размером 8/8

4

Re: Online service PROTEIN PICOTECHNOLOGY

https://img-fotki.yandex.ru/get/16130/158289418.41d/0_17a942_7ca5bc28_XL.gif

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34296|complement 447 nucleotides
atgaataaaacaaatattcacaacaaaaacaagaacaaaaacaacaagctctttgtcgca
tccattgcaatagtggtagcattagccctatttgtcagtccaatgctcaatgtagatgat
gctttagccacacacaacaagaaaaataaagcaaaacagtccatagaccaatcacaatca
tcaaaccaaaatgcacaatgtgtatcaggtgtaacaacctttatctcatgcaacaatgtc
agcttccaacaccaaaagaacagtggaaacaatgcattagcacaaggtggacagggtgga
aactctgcagaacaaggtatcagtcaatctcaatcttctagccaaaacagccaagtagta
tctggtggagacacaatcggttctggtaacaacattaacgtccaaagtcaagaaaacaca
ggaagtaacgcattagcacaaagctaa

Результат:

https://img-fotki.yandex.ru/get/196102/158289418.423/0_17abf1_840794b2_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/9809/15 … 2_orig.png

В исследуемом белке обнаружен один виток альфа-спирали NNKL и один виток пи-спирали SQSQSS

5

Re: Online service PROTEIN PICOTECHNOLOGY

https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Формы, механизмы, энергия наномира. Сообщение 88 047

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34365|complement 1830 nucleotides
ttgagtcttacagaaaaatgtgatatttatgcagctcttcatgatgcaggaattaataga
gtggttaaacatcttatgcaacagcgcccgtctctttttaattttggtacttccttttta
gcatcaaatccaaatctattgtgtgaaaaaattatagctgtgcaagaagtaaacagacaa
cagaatcctcttttaacaatactagaaccaattcctgtcattggtctaccattaagccaa
tctagttcaaacaatttggcaataaattttgcaattcaactttctaaagctgaaatagat
ttccatgaagggaatgtatttcctttaccttcagaacttgtcccattggcaaatcaacgt
ttggctactcatttcaaagtttgtgccggcttggattgtctcggggacttgcctgttctt
agaaggcctccaaataccagaccgtctacttccaaactagaatgtttttgtctagatttg
tatgctataggtggatgcaaaatctctggattagcagaaaaccaaaaaatagggctcaaa
attgatgggatagagatagtggatttaaaaccccaaggattggaaaatgcaatcgaatgt
tatgcaaaatctgtacttaatcatggaatttttccccatgttgctgagattatttccaaa
ttgacatttgggataattactattcctccatccaatggtaacttccaagtatcaggaaat
ttgcagctttcaggaactacgaccgttcctagtaatcctgcaatcgaagatgatcaatta
aaaacatttatcaatttagacaatttggacttggatatcgtattctcaccaaatggtggc
ggtagtggcggtagtggcggtagtggcggcagtggcggcagtggcggtagtggcggcagt
ggaacaataacaagaacagtgaggccgcgatcaagaacaggcacctttgatctaaccgct
gctatatccgaaactacatttaaaaaaatatatggtgcccttcttgaaggatttaaattt
tcagtatcagacacgggcggctctggtatattctcagtaggttatacagtttcggctcat
ttagagaatggcacaatcgatctgcggaataatggttctattctaataagtgaattagac
gtgaaatgggacacattgcagcttaacataggcatagatattccaacacaaactattggt
ggcttttgcctcgttccaaatccatttggtggatgtttgattcgtgctccgtcaattgat
ctttttgaagcatcacctgatatttctttacccttgaacttgggtggactaataacatct
gaaattactttgagtgtaattccaaaggtgttttatggagttggctctggaattccaaac
agatggcaacttaccttagtccctacgcttccaatcgacttggatataattgacgtagca
gacacaattggagatttatttcataatctgattacaaatgcaattgtcagtcttcttagt
tctttgggactccctgattgggctatatcttttatagataccgtgcttggtggaatagaa
ggaataatccgaaacattctagatattggagacgatgtgggtgaatttattttaagtttg
attagtaatgttggtctattccaggatttgattgataagctggctcaattcatagcgctt
acgattctggaactcaaggatcccttggaagttcttgagggaaattctgccataccttta
attccagtaaagttaccaattgaatttttggatgttcggatcgatggtaatggtaatgag
ttgatccttgaaggggatgtgggtaattag

Результат:

https://img-fotki.yandex.ru/get/6109/158289418.423/0_17abfe_d7a43aa6_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/97884/1 … 0_orig.png

https://img-fotki.yandex.ru/get/196102/158289418.423/0_17abff_1e4e2a21_orig.png
В исследуемом белке обнаружен переход программной 335-спирали, характерной для коллагена первого типа в программную 553-спираль, которые строятся под музыку с размером 3/8 (в темпе вальса, точнее в темпе коллагена). Далее программная спираль переходит в бета-спираль длиной 4 аминокислотных остатка.

6

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 88 048

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34379

Результат:

>ENA|ALI34379|complement 1002 nucleotides
gtggtagttagtacaactcatgcaggagttcaagatagtgaagaacaatcaaatgccagt
gatccagtatggcataatcactatgtaacattgagccaagattctgataattgcggaaat
gattcaaaggtagaatctataacttttgaatcccccggagaggtcgatattagagatgac
aatgctgacctgacaaaacttccatcttcattctcaggcacagatgccttgagtggagct
gacctgacaataaaacctggaaccagcgttaaagacgtagtgtcttttaaactggcacca
caatttaacgataatggtgagttggaagctgtatgtgtaactaatctccaatccgccgag
aatattgtattcgataataacaatggcaatagtaatagtgacagtagtaatagtgacagt
agtaatagtgacagtagtaatagtgacagtagtaatagtgacagtagtaacgacgatagt
tctagttctagttccaatgatgatagtaacgaagcatctcaaggaatacgccaatcacaa
atatcaacccaactcggtgtttgtgtatcaggtgacggcacctttttttcatgtaacaat
ctaagtgaccaaagtcaaacaaacactggaaacaacgcagcagcacaaagtggtggcagc
gatgacgatgacgatgatgacaacacagctaaccaaggaatagatcaagcacaatcttct
gaccaaaatgctctatgtgtatcaggttcgggaacttttgattcttgtaacaatttcaat
gcacaaaaccaacaaaatagcggaaacaatgcactggcacaacaagatggtagtggtagt
ggtggcaattcagccaatcaaggcataggccaatcacaatcctctaaccaaggtagtgat
gtagtatctggtggcaatactgctggttctggaaacaacgcaaacatacaaagtcaaaca
aacactggaaacaacgcagcagcacaaaaaggcggtagatag

https://img-fotki.yandex.ru/get/196142/158289418.423/0_17ac01_ee1c43e2_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/177849/ … 1_orig.png

https://img-fotki.yandex.ru/get/196245/158289418.423/0_17ac02_a306a5d5_orig.png
В исследуемом белке обнаружена программная 53333-спираль

7

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 88 050

Рекорды сверхдлинных спиралей белковых молекул

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34573

Результат:

https://img-fotki.yandex.ru/get/41743/158289418.423/0_17ac04_831ca574_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/177849/ … 4_orig.png

https://img-fotki.yandex.ru/get/196070/158289418.423/0_17ac05_aab676ed_orig.png
В исследуемом белке обнаружена программная 53323-спираль рекордной длины (124-69+1=56 аминокислотных остатков), которая строится под музыку с размером 5/8

https://img-fotki.yandex.ru/get/41743/158289418.423/0_17ac07_c96cd3e6_XL.png

https://img-fotki.yandex.ru/get/98619/158289418.423/0_17ac08_8070de12_XL.png

https://img-fotki.yandex.ru/get/3705/158289418.423/0_17ac09_140a4330_XL.png

https://img-fotki.yandex.ru/get/99813/158289418.423/0_17ac0a_443c4c8_XL.png

Это - "пятиугольная спираль"

https://img-fotki.yandex.ru/get/17835/158289418.423/0_17ac06_92392ac_orig.png
Ещё обнаружена программная 52532225333-спираль, которая строится под музыку с размером 11/8

https://img-fotki.yandex.ru/get/167717/158289418.423/0_17ac0b_86d7b16c_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.423/0_17ac0c_e41b8ba6_XL.png

https://img-fotki.yandex.ru/get/196245/158289418.423/0_17ac0d_32e0a68d_XL.png

https://img-fotki.yandex.ru/get/194869/158289418.423/0_17ac0e_b16c9081_XL.png

https://img-fotki.yandex.ru/get/167717/158289418.423/0_17ac0f_ab80e0eb_XL.png

Фрактальная программная 52532225333-спираль состоит из участков простых альфа-, бета- и пи-спиралей. На вид трудно определить, что это - спираль

8

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 88 056

Рекорды сверхдлинных спиралей белковых молекул

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34611

Результат:

>ENA|ALI34611|complement 966 nucleotides
atgtattacaataaattaacttcgggtttcatatctgcaattttcttattattagttata
agttcagttaacttttcgtcaatcaaattggttaatgctgctacaggtgatctggtaaat
tataacaataactttcaaatgtatacatccccaaatgatcctaataaagactctgccatg
caaaatgctgattgtgtagtgaatttcatgacaagttatgtgtacacagcttcttcagct
gaaaattgtaacaatagtggtagtggcatgagtagtagcagtagcaatagtccatcatca
atgtctccttctacaccaagtagccaaagtcaaggtttaacgtcaactgatggtcctcaa
acaggggtgaaagatggttctggtgtaggtgtagttcgagtcgtggatacaaattctaac
actggcagctacactcctgtacaatcctcttcatttgttacaaataatagcaatcctatt
gatactaacaatatgaatgtaaatgtaaatgatgataacaatgataacgacaaagatgca
aaagacaataacaacgataatgataacaatgataacgacaaagatgcaaaagacaataac
aacgataatgataacaatgataacgacaaagatgcaaaagacaataacaacgataatgat
aacaatgataacgacaaagatgcaaaagacaataacaacgataatgataacaatgataac
gacaaagatgcaaaagacaataacaacgataatgataacaatgataacgacaaagatgca
aaagacaataacaacgataatgataacaatgataacgacaaagatgcaaaagtatacaac
gaaaacactgtgaataaacaagagcgcaaattattgcttactacctgcttcgaacgagca
tatgacaatggagattatttgtccactggtgaaattgtagattgcgccagcaactacaac
agctaa

https://img-fotki.yandex.ru/get/196245/158289418.424/0_17ac50_855b4793_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/196102/ … 5_orig.png

https://img-fotki.yandex.ru/get/54787/158289418.424/0_17ac51_6fa63a20_orig.png
В исследуемом белке обнаружена программная 5533235355333533-спираль рекордной длины (277-170+1=108 аминокислотных остатков), которая собирается под музыку с размером 16/8

https://img-fotki.yandex.ru/get/6304/158289418.424/0_17ad04_d9642ce1_XL.png
Без предварительной коррекции углов

https://img-fotki.yandex.ru/get/99813/158289418.424/0_17ad05_57ff6901_XL.png

https://img-fotki.yandex.ru/get/109878/158289418.424/0_17ad06_3bae8933_XL.png

https://img-fotki.yandex.ru/get/50388/158289418.424/0_17ad07_1006b00d_XL.png
С предварительной коррекцией углов

https://img-fotki.yandex.ru/get/99813/158289418.424/0_17ad08_4f914574_XL.png

https://img-fotki.yandex.ru/get/174352/158289418.424/0_17ad09_4c05284b_XL.png

https://img-fotki.yandex.ru/get/196600/158289418.424/0_17ad0a_e83ab8ef_XL.png

https://img-fotki.yandex.ru/get/196142/158289418.424/0_17ad0b_d78de34e_XL.png

https://img-fotki.yandex.ru/get/109878/158289418.424/0_17ad0c_7efdee04_XL.png

https://img-fotki.yandex.ru/get/174352/158289418.424/0_17ad0d_d729d460_XL.png

https://img-fotki.yandex.ru/get/145691/158289418.424/0_17ad0e_4f755abe_XL.png

9

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 88 068

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures is already functioning!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34671

Результат:

>ENA|ALI34671|complement 714 nucleotides
atgacacttccaaaaggttacgtaaaacccaataaagaagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccattccacaaaattcacaaaatgattccttgattacaaataacttgaattca
aacaggctcgatggaaaacaaggaaatgtcgataaaactttggaaaataatttcaactat
tttctgatatgggaacaattacaagaggcataccttcataccatgaaagaagcaacttca
tcttatttcaggttattagatttttggttacagcaaaagaaccaagaagaataa

https://img-fotki.yandex.ru/get/196070/158289418.424/0_17ad11_965f0968_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/3603/15 … 6_orig.png

https://img-fotki.yandex.ru/get/3103/158289418.424/0_17ad12_8b2fb14d_orig.png
В исследуемом белке обнаружена программная 55323233-спираль рекордной длины, которая строится под музыку с размером 4/8

https://img-fotki.yandex.ru/get/174352/158289418.424/0_17ad13_100536f6_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.424/0_17ad14_fa386024_XL.png

https://img-fotki.yandex.ru/get/170749/158289418.424/0_17ad15_63cd4463_XL.png

10

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 88 083

Online service of protein structures is already functioning!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34696

Результат:

>ENA|ALI34696|complement 765 nucleotides
atgtctttagaagttcaacattttcctattattgataataaaaaagagaaaataatagca
gctgatgatcgcgttctatctactgatgatgacacttcgaaatctgataatttagataat
aacgaagataaaaaagaagaattagaaaaggaattagaaaaggaattagaagaggatgat
gaagaggaagaggatgatgaattagaattagaagaggatgatgaattagaattagaagag
gatgatgaagaggatgatgaagaggatgatgaagaggatgatgaagaggatgatgaagag
gatgatgaagaaaaatcgaatcgcacaaatagaaaggaaacggtgaaaaagagttctgat
catagggacatcgatttaactcctataactaaaaacttagagatcattagtaaaaatgtg
gataaactatttaaagaaattcaaaagatacaaaaagtaacgcaaccattacaaaaaggt
ctcagttctattgaaaaacagtccgtatctattaaacagactcaatctttacttaaggaa
atggataaaagaatactaaaaatagagaaaaatgttgccaccaaaacaacaaaaaatacc
tctagttctaggacgtcccccaaacccaaaacaacaaaaaatacctctagttctaggacg
tcccccaaacccaaaacaacaaaaaatacctcttctagttctaggaaatcaactcctaca
tcttcaaagaaatcggacgataataaaaaaaagagaaataaatag

https://img-fotki.yandex.ru/get/3312/158289418.424/0_17ad1e_a872017e_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/170815/ … 0_orig.png

https://img-fotki.yandex.ru/get/194869/158289418.424/0_17ad1f_554baeeb_XL.png
В исследуемом белке удалось обнаружить программную 5333-спираль.

Нам она уже встречалась:

https://img-fotki.yandex.ru/get/102548/158289418.41b/0_17a8aa_3f772a6f_XL.png

https://img-fotki.yandex.ru/get/6104/158289418.41b/0_17a8a9_a5f2a24_XL.png

https://img-fotki.yandex.ru/get/195771/158289418.41b/0_17a8a8_4a8c30e7_XL.png

https://img-fotki.yandex.ru/get/228174/158289418.41b/0_17a8ab_20d9f8d7_orig.gif
Модель с предварительной коррекцией композиционных углов.