91

Re: Формы, механизмы, энергия наномира - 32

Готовится экспедиция в Севастополь и в Одессу ...

https://lh4.googleusercontent.com/-sDeptARHlVI/ScZPz9sO7qI/AAAAAAAABFo/gN58ESz1hGs/s640/_...046.jpg
Кушелев: Очень похоже на остатки выпаривательного комплекса. Особенно впечатляют крупные качественные блоки справа и камни, похожие на камни Храма Солнца на дальнем плане. Учитывая, что камни расположены не по кругу, можно предположить, что либо они работают независимо, т.е. в режиме менгиров, либо они образуют необычную резонансную систему...

Похоже, что Игорь нашёл "брата" или "сестру" храма Солнца smile

92

Re: Формы, механизмы, энергия наномира - 32

В этом компьютерном фильме показан уровень знаний современных молекулярных биологов. Там и про микротрубочки, и про рибосому и пр.

93

Re: Формы, механизмы, энергия наномира - 32

http://www.iumsc.indiana.edu/graphics/images/protein_small.jpg
Так представляют себе структуру тубулина нанотехнологи...
Подробнее: http://www.iumsc.indiana.edu/graphics/X … shots.html

94

Re: Формы, механизмы, энергия наномира - 32

Информация о тубулине в структурном банке: http://www.ebi.ac.uk/pdbsum/1tub
А нам нужно найти его нуклеотидную последовательность...

95

Re: Формы, механизмы, энергия наномира - 32

LOCUS       1TUB_A                   440 aa            linear   MAM 14-OCT-1998
DEFINITION  Chain A, Tubulin Alpha-Beta Dimer, Electron Diffraction.
ACCESSION   1TUB_A
VERSION     1TUB_A  GI:3745821
DBSOURCE    pdb: molecule 1TUB, chain 65, release Jun 18, 2009;
            deposition: Sep 23, 1997;
            class: Microtubules;
            source: Mol_id: 1; Organism_scientific: Sus Scrofa;
            Organism_common: Pig; Organism_taxid: 9823; Organ: Brain; Mol_id:
            2; Organism_scientific: Sus Scrofa; Organism_common: Pig;
            Organism_taxid: 9823; Organ: Brain;
            Exp. method: Electron Crystallography.
KEYWORDS    .
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (residues 1 to 440)
  AUTHORS   Nogales,E., Wolf,S.G. and Downing,K.H.
  TITLE     Erratum. Structure Of The Alpha Beta Tubulin Dimer By Electron
            Crystallography
  JOURNAL   Nature 393, 191 (1998)
REFERENCE   2  (residues 1 to 440)
  AUTHORS   Nogales,E., Wolf,S.G. and Downing,K.H.
  TITLE     Structure of the alpha beta tubulin dimer by electron
            crystallography
  JOURNAL   Nature 391 (6663), 199-203 (1998)
   PUBMED   9428769
  REMARK    Erratum:[Nature 1998 May 14;393(6681):191]
REFERENCE   3  (residues 1 to 440)
  AUTHORS   Nogales,E., Downing,K.H., Amos,L.A. and Lowe,J.
  TITLE     Tubulin and FtsZ form a distinct family of GTPases
  JOURNAL   Nat. Struct. Biol. 5 (6), 451-458 (1998)
   PUBMED   9628483
REFERENCE   4  (residues 1 to 440)
  AUTHORS   Nogales,E. and Downing,K.H.
  TITLE     Direct Submission
  JOURNAL   Submitted (23-SEP-1997)
COMMENT     SEQRES.
FEATURES             Location/Qualifiers
     source          1..440
                     /organism="Sus scrofa"
                     /db_xref="taxon:9823"
     Region          1..440
                     /region_name="PTZ00335"
                     /note="tubulin alpha chain; Provisional"
                     /db_xref="CDD:185562"
     Region          2..435
                     /region_name="alpha_tubulin"
                     /note="The tubulin superfamily includes five distinct
                     families, the alpha-, beta-, gamma-, delta-, and
                     epsilon-tubulins and a sixth family (zeta-tubulin) which
                     is present only in kinetoplastid protozoa. The alpha- and
                     beta-tubulins are the major components of...; cd02186"
                     /db_xref="CDD:100015"
     Site            order(2,199,253..254,256..258,260..261,326,352)
                     /site_type="other"
                     /note="beta/alpha domain interface [polypeptide binding]"
                     /db_xref="CDD:100015"
     SecStr          3..10
                     /sec_str_type="sheet"
                     /note="strand 1"
     Site            order(10..12,15..16,69..71,74,99..101,140..146,171,
                     173..174,182..183,206,210,224,227..228,231)
                     /site_type="other"
                     /note="nucleotide binding site [chemical binding]"
                     /db_xref="CDD:100015"
     SecStr          11..24
                     /sec_str_type="helix"
                     /note="helix 1"
     SecStr          64..70
                     /sec_str_type="sheet"
                     /note="strand 2"
     Site            order(72..73,100..102,105,181,183,224)
                     /site_type="other"
                     /note="alpha/beta domain interface [polypeptide binding]"
                     /db_xref="CDD:100015"
     SecStr          91..95
                     /sec_str_type="sheet"
                     /note="strand 3"
     SecStr          115..127
                     /sec_str_type="helix"
                     /note="helix 2"
     SecStr          133..141
                     /sec_str_type="sheet"
                     /note="strand 4"
     SecStr          148..161
                     /sec_str_type="helix"
                     /note="helix 3"
     SecStr          164..172
                     /sec_str_type="sheet"
                     /note="strand 5"
     SecStr          185..193
                     /sec_str_type="helix"
                     /note="helix 4"
     SecStr          199..205
                     /sec_str_type="sheet"
                     /note="strand 6"
     SecStr          206..215
                     /sec_str_type="helix"
                     /note="helix 5"
     Het             bond(224)
                     /heterogen="(GTP,1000 )"
     SecStr          228..238
                     /sec_str_type="helix"
                     /note="helix 6"
     SecStr          252..259
                     /sec_str_type="helix"
                     /note="helix 7"
     SecStr          265..274
                     /sec_str_type="sheet"
                     /note="strand 7"
     SecStr          290..297
                     /sec_str_type="helix"
                     /note="helix 8"
     SecStr          311..322
                     /sec_str_type="sheet"
                     /note="strand 8"
     SecStr          325..334
                     /sec_str_type="helix"
                     /note="helix 9"
     SecStr          350..357
                     /sec_str_type="sheet"
                     /note="strand 9"
     SecStr          372..382
                     /sec_str_type="sheet"
                     /note="strand 10"
     SecStr          384..397
                     /sec_str_type="helix"
                     /note="helix 10"
     SecStr          418..435
                     /sec_str_type="helix"
                     /note="helix 11"
ORIGIN     
        1 mrecisihvg qagvqignac welyclehgi qpdgqmpsdk tigggddsfn tffsetgagk
       61 hvpravfvdl eptvidevrt gtyrqlfhpe qlitgkedaa nnyarghyti gkeiidlvld
      121 rirkladqct glqgfsvfhs fgggtgsgft sllmerlsvd ygkksklefs iypapqvsta
      181 vvepynsilt thttlehsdc afmvdneaiy dicrrnldie rptytnlnrl igqivssita
      241 slrfdgalnv dltefqtnlv pyprghfpla tyapvisaek ayheqlsvae itnacfepan
      301 qmvkcdprhg kymaccllyr gdvvpkdvna aiatiktkrt iqfvdwcptg fkvginyepp
      361 tvvpggdlak vqravcmlsn ttaiaeawar ldhkfdlmya krafvhwyvg egmeegefse
      421 aredmaalek dyeevgvdsv
//

96

Re: Формы, механизмы, энергия наномира - 32

LOCUS       1TUB_B                   427 aa            linear   MAM 14-OCT-1998
DEFINITION  Chain B, Tubulin Alpha-Beta Dimer, Electron Diffraction.
ACCESSION   1TUB_B
VERSION     1TUB_B  GI:3745822
DBSOURCE    pdb: molecule 1TUB, chain 66, release Jun 18, 2009;
            deposition: Sep 23, 1997;
            class: Microtubules;
            source: Mol_id: 1; Organism_scientific: Sus Scrofa;
            Organism_common: Pig; Organism_taxid: 9823; Organ: Brain; Mol_id:
            2; Organism_scientific: Sus Scrofa; Organism_common: Pig;
            Organism_taxid: 9823; Organ: Brain;
            Exp. method: Electron Crystallography.
KEYWORDS    .
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (residues 1 to 427)
  AUTHORS   Nogales,E., Wolf,S.G. and Downing,K.H.
  TITLE     Erratum. Structure Of The Alpha Beta Tubulin Dimer By Electron
            Crystallography
  JOURNAL   Nature 393, 191 (1998)
REFERENCE   2  (residues 1 to 427)
  AUTHORS   Nogales,E., Wolf,S.G. and Downing,K.H.
  TITLE     Structure of the alpha beta tubulin dimer by electron
            crystallography
  JOURNAL   Nature 391 (6663), 199-203 (1998)
   PUBMED   9428769
  REMARK    Erratum:[Nature 1998 May 14;393(6681):191]
REFERENCE   3  (residues 1 to 427)
  AUTHORS   Nogales,E., Downing,K.H., Amos,L.A. and Lowe,J.
  TITLE     Tubulin and FtsZ form a distinct family of GTPases
  JOURNAL   Nat. Struct. Biol. 5 (6), 451-458 (1998)
   PUBMED   9628483
REFERENCE   4  (residues 1 to 427)
  AUTHORS   Nogales,E. and Downing,K.H.
  TITLE     Direct Submission
  JOURNAL   Submitted (23-SEP-1997)
COMMENT     SEQRES.
FEATURES             Location/Qualifiers
     source          1..427
                     /organism="Sus scrofa"
                     /db_xref="taxon:9823"
     Region          1..427
                     /region_name="PLN00220"
                     /note="tubulin beta chain; Provisional"
                     /db_xref="CDD:177801"
     Region          2..426
                     /region_name="beta_tubulin"
                     /note="The tubulin superfamily includes five distinct
                     families, the alpha-, beta-, gamma-, delta-, and
                     epsilon-tubulins and a sixth family (zeta-tubulin) which
                     is present only in kinetoplastid protozoa. The alpha- and
                     beta-tubulins are the major components of...; cd02187"
                     /db_xref="CDD:100016"
     Site            order(2,131,245..247,251,256,258..260,322..324,327,
                     347..351)
                     /site_type="other"
                     /note="beta/alpha domain interface [polypeptide binding]"
                     /db_xref="CDD:100016"
     SecStr          3..10
                     /sec_str_type="sheet"
                     /note="strand 11"
     Site            order(10..12,15..16,67..69,72,97..99,138..144,169,
                     171..172,180..181,204,208,222,225..226,229)
                     /site_type="other"
                     /note="nucleotide binding site [chemical binding]"
                     /db_xref="CDD:100016"
     SecStr          11..23
                     /sec_str_type="helix"
                     /note="helix 12"
     Het             join(bond(15),bond(141),bond(141),bond(141),bond(176))
                     /heterogen="(GDP,1001 )"
     Site            order(22..23,215,224,227..228,231,234..235,270,272)
                     /site_type="other"
                     /note="Taxol binding site [chemical binding]"
                     /db_xref="CDD:100016"
     SecStr          63..69
                     /sec_str_type="sheet"
                     /note="strand 12"
     Site            order(70..71,98..100,103,179,181,222)
                     /site_type="other"
                     /note="alpha/beta domain interface [polypeptide binding]"
                     /db_xref="CDD:100016"
     SecStr          88..92
                     /sec_str_type="sheet"
                     /note="strand 13"
     SecStr          111..125
                     /sec_str_type="helix"
                     /note="helix 13"
     SecStr          131..139
                     /sec_str_type="sheet"
                     /note="strand 14"
     SecStr          146..158
                     /sec_str_type="helix"
                     /note="helix 14"
     SecStr          164..170
                     /sec_str_type="sheet"
                     /note="strand 15"
     SecStr          181..191
                     /sec_str_type="helix"
                     /note="helix 15"
     SecStr          197..203
                     /sec_str_type="sheet"
                     /note="strand 16"
     SecStr          206..214
                     /sec_str_type="helix"
                     /note="helix 16"
     SecStr          223..236
                     /sec_str_type="helix"
                     /note="helix 17"
     Het             join(bond(227),bond(227),bond(359),bond(359))
                     /heterogen="(TXL,1002 )"
     SecStr          250..257
                     /sec_str_type="helix"
                     /note="helix 18"
     SecStr          263..272
                     /sec_str_type="sheet"
                     /note="strand 17"
     SecStr          286..293
                     /sec_str_type="helix"
                     /note="helix 19"
     SecStr          311..319
                     /sec_str_type="sheet"
                     /note="strand 18"
     SecStr          322..330
                     /sec_str_type="helix"
                     /note="helix 20"
     SecStr          331..338
                     /sec_str_type="helix"
                     /note="helix 21"
     SecStr          348..354
                     /sec_str_type="sheet"
                     /note="strand 19"
     SecStr          363..371
                     /sec_str_type="sheet"
                     /note="strand 20"
     SecStr          376..387
                     /sec_str_type="helix"
                     /note="helix 22"
     SecStr          395..402
                     /sec_str_type="helix"
                     /note="helix 23"
     SecStr          407..423
                     /sec_str_type="helix"
                     /note="helix 24"
ORIGIN     
        1 mreivhiqag qcgnqigakf wevisdehgi dptgsyhgds dlqlerinvy yneaagnkyv
       61 prailvdlep gtmdsvrsgp fgqifrpdnf vfgqsgagnn wakghytega elvdsvldvv
      121 rkesescdcl qgfqlthslg ggtgsgmgtl liskireeyp drimntfsvv pspkvsdtvv
      181 epynatlsvh qlventdety cidnealydi cfrtlklttp tygdlnhlvs atmsgvttcl
      241 rfpgqlnadl rklavnmvpf prlhffmpgf apltsrgsqq yraltvpelt qqmfdaknmm
      301 aacdprhgry ltvaavfrgr msmkevdeqm lnvqnknssy fvewipnnvk tavcdipprg
      361 lkmsatfign staiqelfkr iseqftamfr rkaflhwytg egmdemefte aesnmndlvs
      421 eyqqyqd
//

97

Re: Формы, механизмы, энергия наномира - 32

http://www.uniprot.org/uniprot/P61316

98

Re: Формы, механизмы, энергия наномира - 32

Код в стандарте FASTA:

GGATCCGTTGTTCGATCAGGCGGTGCAGTTTGTCACTGAAAAACGCAAAGCGTCAATTTC
TGGCGTACAGCGTCAGTTCCGCATTGGTTATAACCGTGCAGCGCGTATTATCGAACAGAT
GGAAGCGCAGGGGATTGTCAGCGAACAGGGGCACAACGGTAATCGTGAAGTGCTGGCCCC
ACCGCCGTTTGACTAACTAATGCATCGTATGCCGGATAAGGCGCGGTAGCGTCGCATCCG
GCACTCTATCAACTGAAAATTCAGTATTTTCTTCTTTCCTCAAGCTGATTATTAGCCTGG
AATAGAGAGTAGAGGGAACTCCCGATCGGGAGTGACGTAATTTGAGGAATAATGATGAAA
AAAATTGCCATCACCTGTGCATTACTCTCAAGCTTAGTAGCAAGCAGCGTTTGGGCTGAT
GCCGCAAGCGATCTGAAAAGCCGCCTGGATAAAGTCAGCAGCTTCCACGCCAGCTTCACA
CAAAAAGTGACTGACGGTAGCGGCGCGGCGGTGCAGGAAGGTCAGGGCGATCTGTGGGTG
AAACGTCCAAACTTATTCAACTGGCATATGACACAACCTGATGAAAGCATTCTGGTTTCT
GACGGTAAAACACTGTGGTTCTATAACCCGTTCGTTGAGCAAGCTACGGCAACCTGGCTG
AAAGATGCCACCGGTAATACGCCGTTTATGCTGATTGCCCGCAACCAGTCCAGCGACTGG
CAGCAGTACAATATCAAACAGAATGGCGATGACTTTGTCCTGACGCCGAAAGCCAGCAAT
GGCAATCTGAAGCAGTTCACCATTAACGTGGGACGTGATGGCACAATCCATCAGTTTAGC
GCGGTGGAGCAGGACGATCAGCGCAGCAGTTATCAACTGAAATCCCAGCAAAATGGGGCT
GTGGATGCAGCGAAATTTACCTTCACCCCGCCGCAAGGCGTCACGGTAGATGATCAACGT
AAGTAGAGGCACCTGAGTGAGCAATCTGTCGCTCGATTTTTCGGATAATACTTTTCAACC
TCTGGCCGCGCGTATGCGGCCAGAAAATTTAGCACAGTATATCGGCCAGCAACATTTGCT
GGCTGCGGGGAAGCCGTTGCCGCGCGCTATCGAAGCCGGGCATTTACATTCTATGATCCT
CTGGGGGCCGCCGGGTACC

99

Re: Формы, механизмы, энергия наномира - 32

Вторичная структура и композиционный код тубулина:

http://img-fotki.yandex.ru/get/5314/126 … d_orig.gif

100

Re: Формы, механизмы, энергия наномира - 32

Ну что же, первый фрагмент одной из субъединиц тубулина смоделирован...

http://img-fotki.yandex.ru/get/5314/126580004.37/0_af66b_ef10f525_S.gif
Оригинал: http://img-fotki.yandex.ru/get/5314/126 … 5_orig.gif