1

Тема: Открыта программная трехлопастная 323321321-белковая спираль

Формы, механизмы, энергия наномира. Сообщение 87 086

Пикотехнология белков, ДНК, РНК - 2

Открыта программная трехлопастная 323321321-белковая спираль

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 86 688

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/38 … S2MAE0A01R

https://www.ncbi.nlm.nih.gov/nuccore/388058434

>ENA|EIK81335|1215 nucleotides
atgaatatgagtgtagtaacgacgcgatacgttgaggctgctggcggaattatttatcgc
aagcgaaatacaatagacagctcaaacacaagtgacttgaaaaagacaagcaatcaagcg
agcatgataagcgatgacgactttgagctttgccttgtttaccgaccaaaatatgacgat
tggagctggccaaaaggcaagaatgaagacaatgagtcgcatcgccacactgccgtgcgc
gaagttggcgaagagactggctacgcagtcacactcggacctcacattgcccaaatagaa
tatccgcttgaaaacgaaggcaaaaaatcaatctcaaaaagcggtgcgaaaaacagttca
caaaacaacaataaaacagaagtagttaagcgaattcactactggatgatgcgcgaaata
gacgaaaattctgcaatgaggcgactaccagcatttggcccaataaaaccagcaaaacct
actgaaattggcaatgttatatggcttactccttctaaagctcgcaaaaaactcacacac
gatagcgatagaaaagttttagatgcttttcttgaaaagctacacgcttgtcaaactgaa
tataaaacattaatactagtacgacatggaaaagctgaatcccgtaaatcatggcaaggc
agcgaagcaactcgtccaatcactcctcttggatctgcagcatcctacgctctaggtcgt
gagcttgcttgctatgctccaaatcgaattgtttcgtcaccttggaaacgttgcgtagaa
actgttgcaacttttgcacacgattcttctcttcctatagaacagattgcggaacttact
gaagatcatcatgagaataaaccaaaatctacattatctgttcttataagtgaaatacaa
aatcttgattgcaacgtaaaaaacacacaaaacacacaaaacacacaaaacacacaaaac
acacaaaacacacaaaacacacaaaatgcagaagaaaacattaacaattcaacagttatg
tgtttgcaccgccctattatcggcactttctttgactatttgcgaggaatcacaaaaccg
cgggcgcataaacgtatacttagccaaaaatctccatacatgcctactggtagcgcaata
gttttgcatattagcaatacttctaaaggcgctcgcattattgatattgaaaaggtgtta
ccaattgtctactag

Locus EIK81335
FT   CDS 1..1215
     atgaatatga gtgtagtaac gacgcgatac gttgaggctg ctggcggaat tatttatcgc
     aagcgaaata caatagacag ctcaaacaca agtgacttga aaaagacaag caatcaagcg
     agcatgataa gcgatgacga ctttgagctt tgccttgttt accgaccaaa atatgacgat
     tggagctggc caaaaggcaa gaatgaagac aatgagtcgc atcgccacac tgccgtgcgc
     gaagttggcg aagagactgg ctacgcagtc acactcggac ctcacattgc ccaaatagaa
     tatccgcttg aaaacgaagg caaaaaatca atctcaaaaa gcggtgcgaa aaacagttca
     caaaacaaca ataaaacaga agtagttaag cgaattcact actggatgat gcgcgaaata
     gacgaaaatt ctgcaatgag gcgactacca gcatttggcc caataaaacc agcaaaacct
     actgaaattg gcaatgttat atggcttact ccttctaaag ctcgcaaaaa actcacacac
     gatagcgata gaaaagtttt agatgctttt cttgaaaagc tacacgcttg tcaaactgaa
     tataaaacat taatactagt acgacatgga aaagctgaat cccgtaaatc atggcaaggc
     agcgaagcaa ctcgtccaat cactcctctt ggatctgcag catcctacgc tctaggtcgt
     gagcttgctt gctatgctcc aaatcgaatt gtttcgtcac cttggaaacg ttgcgtagaa
     actgttgcaa cttttgcaca cgattcttct cttcctatag aacagattgc ggaacttact
     gaagatcatc atgagaataa accaaaatct acattatctg ttcttataag tgaaatacaa
     aatcttgatt gcaacgtaaa aaacacacaa aacacacaaa acacacaaaa cacacaaaac
     acacaaaaca cacaaaacac acaaaatgca gaagaaaaca ttaacaattc aacagttatg
     tgtttgcacc gccctattat cggcactttc tttgactatt tgcgaggaat cacaaaaccg
     cgggcgcata aacgtatact tagccaaaaa tctccataca tgcctactgg tagcgcaata
     gttttgcata ttagcaatac ttctaaaggc gctcgcatta ttgatattga aaaggtgtta
     ccaattgtct actag
//

22 ноты Лунной Сонаты звучат больше миллиарда лет!

https://img-fotki.yandex.ru/get/150569/158289418.3e6/0_176ed3_4604e462_XL.png

https://img-fotki.yandex.ru/get/117896/158289418.3e6/0_176ed5_59cf72b9_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.3e6/0_176ed4_634e7cb3_XL.png

22 ноты Лунной сонаты (отмечены красным) звучат в гиперзвуковом диапазоне в процессе сборки белковой молекулы EIK81335 более 1 000 000 000 лет!

Кушелев: А теперь давайте посмотрим, не найдутся ли комплементарные ноты Лунной сонаты?

Вместо n(QNT) нужно найти n(TNQ)

https://blast.ncbi.nlm.nih.gov

Итак, ищем TNQTNQTNQTNQTNQTNQTNQTNQTNQTNQTNQTNQTNQ

https://www.ncbi.nlm.nih.gov/protein/56 … TJUM2XZ016

https://www.ncbi.nlm.nih.gov/nuccore/564280748

>ENA|ETB62429|1713 nucleotides
atgatttttagtaaaatatttaataatatatcaagacatcacatagaacaaattattcaa
ttaaaaagaaataaattccgattaacgagaagaaattttaataattataaatgtgaaaat
atgaaggatcaaaatcatgtagttaaggaaaacgctacaccattatacaaaagctacaaa
ggtcatgatttaaaaatagaatatgaaaatgattatttcttagttgtaaataaaccatat
gatattaaattagagaaggggaagcttgatgatatttatccgtctgtagaaacactgctt
cgaaaaaaaagaaatttaaatacgttcagaatgtgtggtcaactggattatgctacaagt
ggacttttaattattgcgaaagataaattaagctcgaatattttaaattataatatcgaa
agtaaaaatataagcaagatatatctagctatattatatgggcatttaccgcttgatgtt
ttacatataaatgttccaataagtaaagttaaaaatgaatttaaaatgaaattatgttat
aattacaatgattattatgatactggaaaatattgttatagtttaatttatccatataag
catacatatttaaaaaatgaaaaagtaactctatgtgagcttcgaacaatcacaggaaga
agacatcaattaagattacattccatatgcttaggtagtggaatagttggggatgaaaca
tattttgaagatatgattgaaaataaatataaaattaattatatgaacagttcaggtaaa
aatattactactaacaattataatattacagattatatagataataaaaaggatgaaatt
aatattgaaaaattgaatatggaaaaatatgtaaaaaacaaaattgatgcagaaaggatg
atgttacattgttggataataataaaaaatgaaaatataaaagtagaaaataaattaaat
aaaagtgagaatataaatattctagaacaaaaaatttttgataaagattatataatatgt
gatgatgtgttaagtgaatttgtaaatgaaaaaccacgaacgtttgatgattgtttttta
aaaaataattatttaattaatcataattttattaattataatgttaaaaatattaataaa
aatattcaaaaagttgataggaagttaaaaaaagaaaaatacgcatatgatgctttatta
cataattctttaatccttgaaaattcaagacaggaaaagttcgaaaattttgtaaaagaa
aataaaaaatatcaaacaaatcaagcaaatcaaacaaatcaagcaaatcaaacaaatcaa
acaaatcaaacaaatcaaacaaatcaaacaaaccaaacaaatcaaacaaaccaaacaaac
caaacaaatcaaacaaaccaaacaaaccaaacaaatcaaacaaaccaaacaaaccaaaca
aatcaaataaatatggaatatggaaaatcagaaaattgtaaaactgaaataattgtagaa
aattttcaaaaatttgaaaaaaaaaaacacgaaaataattccaaggatttaaaatctgag
aatattgaaaaagttgatgtaacagaaacatttataaataacaaagtgatagatcaaaat
agtatttattctgttaaaaatgataaatatcaaaatccgaataatttatttgatgacatt
catgatagtgtcaataagtttaattgggggtaa

Вообще-то это не комплементарное преобразование, а фрактальный реверс, но ... тоже интересно!

https://img-fotki.yandex.ru/get/172017/158289418.3f6/0_177d39_6ca91899_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/218579/ … 0_orig.png

Разметка триплетов:

https://img-fotki.yandex.ru/get/195431/158289418.3f6/0_177d3a_4aa9bfb0_orig.png

Интересно посмотреть этот фрагмент:

https://img-fotki.yandex.ru/get/174613/158289418.3f6/0_177d89_50965d5e_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3f6/0_177d3c_3898bdca_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.3f6/0_177d3d_69bf9721_orig.png
Программная 233-спираль переходит в очень необычную трёхлопостную программную спираль.

https://img-fotki.yandex.ru/get/198361/158289418.3f6/0_177d43_f74d2081_orig.png
Так выглядит 233-спираль (7 витков, 60 аминокислотных остатков)

https://img-fotki.yandex.ru/get/225029/158289418.3f6/0_177d45_2d908279_orig.png
Примерно 8.5 аминокислотных остатков на виток.

https://img-fotki.yandex.ru/get/233608/158289418.3f6/0_177d44_5e7845ae_orig.png
Вид вдоль оси симметрии.

https://img-fotki.yandex.ru/get/225029/158289418.3f6/0_177d42_a8059090_orig.png
Это, как и 35-спираль (Q-спираль) может быть пикотехнологическим реактором. Только меньшего диаметра (раза в полтора) и соответственно большего давления (раза в два).

https://img-fotki.yandex.ru/get/233044/158289418.3f6/0_177d40_51982051_orig.gif

***

https://img-fotki.yandex.ru/get/195648/ … 4_orig.png

https://img-fotki.yandex.ru/get/225029/158289418.3f6/0_177d3f_1aafb705_orig.png
Циклическое повторение 30 аминокислотных остатков соответствует такой структуре.

***
https://img-fotki.yandex.ru/get/197102/158289418.3f6/0_177d8a_474441c_orig.png

https://img-fotki.yandex.ru/get/244791/158289418.3f6/0_177d3b_d6b6148e_orig.png
Трёхлопостная система кодируется тридцатью триплетами, точнее, цикл состоит из 27 аминокислотных остатков.

>ENA|ETB62429_fragment_27_n
ACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA
ACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAAACAAATCAAACAAACCAAACAAACCAA

https://img-fotki.yandex.ru/get/164839/158289418.3f6/0_177d8f_f66f7ca4_orig.png
Сделаем несколько циклов по 27 аминокислотных остатков.

Раскрашенные триплеты нуклеотидной последовательности:
https://img-fotki.yandex.ru/get/104700/158289418.3f6/0_177d91_a8e620a3_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/205820/ … a_orig.png

https://img-fotki.yandex.ru/get/196142/158289418.3f6/0_177d8c_c3724a62_orig.png
"Красота форм в природе" smile

https://img-fotki.yandex.ru/get/194858/158289418.3f6/0_177d8d_76b47271_orig.png
Атомы изображены шариками

https://img-fotki.yandex.ru/get/244154/158289418.3f6/0_177d8e_f39bd714_orig.png
Межатомные связи изображены трубками

https://img-fotki.yandex.ru/get/93917/158289418.3f6/0_177d92_deea5300_orig.png
Электронные оболочки изображены точками

https://img-fotki.yandex.ru/get/195648/158289418.3f6/0_177d93_f3f55237_orig.png

https://img-fotki.yandex.ru/get/99813/158289418.3f6/0_177d94_30f83753_orig.png

https://img-fotki.yandex.ru/get/196600/158289418.3f6/0_177d95_ef7a8257_orig.png

https://img-fotki.yandex.ru/get/197923/158289418.3f7/0_177d96_deb29ed9_orig.png

https://img-fotki.yandex.ru/get/366459/158289418.3f7/0_177d97_99223f91_orig.png

https://img-fotki.yandex.ru/get/196600/158289418.3f7/0_177d98_cd84b30d_orig.png

https://img-fotki.yandex.ru/get/172684/158289418.3f7/0_177d99_497fcf6_orig.png

https://img-fotki.yandex.ru/get/171919/158289418.3f7/0_177d9a_b05e6f03_orig.png

https://img-fotki.yandex.ru/get/44819/158289418.3f7/0_177d9b_dc2b2679_orig.png

https://img-fotki.yandex.ru/get/362774/158289418.3f7/0_177d9c_fdd9128c_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.3f7/0_177d9d_df47ccf5_orig.png

https://img-fotki.yandex.ru/get/196161/158289418.3f7/0_177d9f_dd6ee792_orig.png

https://img-fotki.yandex.ru/get/225029/158289418.3f7/0_177d9e_8804aa3b_orig.png

https://img-fotki.yandex.ru/get/244791/158289418.3f7/0_177da0_b58790aa_orig.png

https://img-fotki.yandex.ru/get/196548/158289418.3f7/0_177da1_be116ab9_orig.png

https://img-fotki.yandex.ru/get/171919/158289418.3f7/0_177da2_c91be39a_orig.png
Такая необычная трехлопастная программная спираль встречается в белковых молекулах...