41

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170910_025:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>ENA|XM_016303689.1 PREDICTED: Ficedula albicollis basic proline-rich protein-like (LOC107604154), partial mRNA
ATGCTGGGGGACCCCCGGCCCGTGCAGCTCCCCGCTGCCAGGGGCACTCTGAGCACCCAGCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
CCCCCCCCCCCCCCCCC

Результат:

https://img-fotki.yandex.ru/get/509885/158289418.477/0_181b88_bac5d01_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/516998/158289418.477/0_181b87_e300c32d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/516998/ … d_orig.png

Прямая преимущественно полипролиновая спираль насчитывает 503 аминокислотных остатка

42

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170910_026:

https://www.ncbi.nlm.nih.gov/nuccore/59 … mask=65536

>ENA|EYC12612.1
atggcgcataagaactacacaatatactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactactactactactactactactactactactactactactactac
tactactactactactaa

Результат:

https://img-fotki.yandex.ru/get/202385/158289418.477/0_181b8a_4fc28e9_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/369434/158289418.477/0_181b89_d4c7ed72_XL.png
Оригинал: https://img-fotki.yandex.ru/get/369434/ … 2_orig.png

Прямая альфа-спираль политирозина образована 317 аминокислотными остатками Tyr

43

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170911_009:

https://www.ncbi.nlm.nih.gov/nuccore/LS … mask=65536

>ENA|OLP79356.1
atgtttcactctgtcgctgaggccctggcaacagaacgggaagacacacacacgacgccc
acaacgacgacgccgacgacaccagcagcagcagcagcagaagcagcagcagcagcagca
gcagcgcagcagcagcagcagcagcaggaggaggagcaggaggaggagcaggaggaggag
caggaggaggagcaggaggaggagcaggaggaggagcagcaggagaacgggaagacacac
acacgacgcccacaacgacgacgccgacgacaccagcagcagcagcagcagaagcagcag
cagcagcagcagcagcgcagcagcagcagcagcagcaggaggaggagcaggaggaggagc
aggaggaggagcaggaggaggagcaggaggaggagcaggaggaggagcaggaggaggagn
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctacttctacttctacttc
tacttctacttctacttctacttctacttctacttctacttctactactactactactac
tactactactactactactgtcggaggtttttttcccgaacgctggcggtccccgatctc
atttgctaa

Результат:

https://img-fotki.yandex.ru/get/767483/158289418.478/0_18249f_abf042a8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/769623/158289418.478/0_18249e_f502108e_XL.png
Оригинал: https://img-fotki.yandex.ru/get/769623/ … e_orig.png

44

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170911_012:

https://www.ncbi.nlm.nih.gov/nuccore/607353209

>ENA|EZA48018.1
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggataaatagatag

Результат:

https://img-fotki.yandex.ru/get/759574/158289418.478/0_1824a5_3d1fd1e5_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/370378/158289418.478/0_1824a4_5159591d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/370378/ … d_orig.png

45

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170911_013:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>ENA|XM_001892334.1 Brugia malayi hypothetical protein partial mRNA
ATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGAT
GGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGG
ATGGATGGATGGATGGATSGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGAT
GGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGG
ATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGAT
GGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGG
ATGGATGGATGGATGGCTGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGAT
GGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGG
ATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATGG


Результат:

https://img-fotki.yandex.ru/get/749077/158289418.478/0_1824a7_bb0d4210_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/508505/158289418.478/0_1824a6_c6918665_XL.png
Оригинал: https://img-fotki.yandex.ru/get/508505/ … 5_orig.png

46

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170911_014:

https://www.ncbi.nlm.nih.gov/nuccore/CP … =181622287

>ENA|CP012850
atggatggatggatggatggatggatggatggatggatggatggggatggatggatggat
ggatggatggatggatggatggatggatggatggatggatggatggatggatggatggat
ggatggatggatggatggatggatggatggatggatggatggatggatggatggatggat
ggatggatggatggatggatggatggatggatggatggatggatggatggatggatggat
ggatggatggatggatggatggatggatggatggatggatggatggatggatggatggat
ggatggatggatggatggatggatggatggatggatggatggatggatggatggatggat
ggatggatggatggatggatggatggatgggatggatggatggatggatggatggatgga
tggatggatggatggatggatggatggatggatggatggatggatggatggatggatgga
tggatggatggatggatggatggatggatggatggatggatggatggatggatggatgga
tggatggatggatggatggatggatggatggatggatggatggatggatggatggatgga
tggatggatggatggatggatggatggatggatggatggatggatggatggatggatgga
tggatggatggatggatggatggatggatggatggatggatggatggatggatggatgga
tggatggatggatggatggatgggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggaacaaatgcactcttgacttatcatactggagtaactaataatactcatatg
tctttaaattcaaaatcagttcatagtcttcgtgtatttacctatttgaagatcatctaa

Результат:

https://img-fotki.yandex.ru/get/510105/158289418.478/0_1824a9_d21c4b01_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/468374/158289418.478/0_1824a8_1c8646d3_XL.png
Оригинал: https://img-fotki.yandex.ru/get/468374/ … 3_orig.png
Фрактальная программная спираль

47

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ: 20170911_015:

https://www.ncbi.nlm.nih.gov/nuccore/1129188588

>ENA|OLP94254.1
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatca
ccgacgatgtga

Результат:

https://img-fotki.yandex.ru/get/402270/158289418.478/0_1824ab_3e9c5f08_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/518060/158289418.478/0_1824aa_15d1ff94_XL.png
Оригинал: https://img-fotki.yandex.ru/get/518060/ … 4_orig.png

48

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 90 245

Открываем экзотические структуры белков

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ: 20170911_016:

https://www.ncbi.nlm.nih.gov/nuccore/1129188588

>ENA|OLP94260.1 fragment
atgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctac
cagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatg
tcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccag
aagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcg
cagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaag
ggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcag
ggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggc
gtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggt
cagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtc
gggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcag
agctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcggg
cttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagc
taccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggctt
atgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctac
cagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatg
tcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccag
aagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcg
cagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaag
ggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcag
ggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggc
gtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggt
cagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtc
gggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcag
agctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcggg
cttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagc
taccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggctt
atgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctac
cagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatg
tcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccag
aagggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcg
cagggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaag
ggcgtcgggcttatgtcgcagggtcagagctaccagaagggcgtcgggcttatgtcgcag
ggtcagagctaccagaagggcgtcgggcttatgtcgcagggtcagagctaccagaagggc
gtcgggcttatgtcgcagggtcagagctacctgaagggcaacgaaggcatccaggttttg
tcaatggcacagatcgggaagggtcctttgctttgcctcgtagacaagaacgacgcaggt
cctggtcccaaggccgtgatgttgatcctcagggcgcccgtgaaggtgatgatggtcagc
ag

Результат:

https://img-fotki.yandex.ru/get/467315/158289418.478/0_1824ad_e6219f8f_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/762837/158289418.478/0_1824ac_b9a1378a_XL.png
Оригинал: https://img-fotki.yandex.ru/get/762837/ … a_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/762837/158289418.478/0_1824ae_e54e857a_orig.png

Программная 5553111111143-спираль, образованная последовательностью аминокислотных остатков (MSQGQSYQKGVGL)*n.
Длина программной спирали 670 аминокислотных остатков. Собирается под музыку с размером 13/8. Очень интересно увидеть пространственную модель...

https://img-fotki.yandex.ru/get/508985/158289418.478/0_1824f5_90a30e27_XL.png
Обратите внимание на взаимодействия радикалов Met и Tyr

https://img-fotki.yandex.ru/get/483127/158289418.478/0_1824f6_1f927801_XL.png

https://img-fotki.yandex.ru/get/233740/158289418.478/0_1824f7_8643ad22_XL.png

https://img-fotki.yandex.ru/get/245409/158289418.478/0_1824f8_20d9a226_XL.png

https://img-fotki.yandex.ru/get/372429/158289418.478/0_1824f9_dd46fc77_XL.png
Программная спираль имеет ось симметрии ~5-го порядка

https://img-fotki.yandex.ru/get/237726/158289418.478/0_1824fa_f519f947_XL.png
Очевидно взаимодействие радикалов Met66-Tyr72 и Gln57-Lys61

https://img-fotki.yandex.ru/get/246987/158289418.478/0_1824fb_627490b0_orig.gif

https://img-fotki.yandex.ru/get/246987/158289418.479/0_1824fc_837465ad_orig.gif

49

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 91 558

Рекорды сверхдлинных спиралей белковых молекул

Skype, 2017-10-26:

[14:13:03] Zoldrax: Привет!

Синхронизация возраста через кодовую модуляцию активирующих РНК в экзосомах кажется все более правдоподобной. Первым делом хотим повторить опыт Бельмонте, но только в гипоталамусе. Т.е. откатить эпигенетические часы в гипоталамусе через временное активирование генов коктейля Ямонаки, переводящих клетки в стволовые, и посмотреть последует ли за гипоталамусом возраст всего организма.

[14:14:51] Zoldrax: По поводу белков, пока не будет совпадения с экспериментальными данными (пусть и “неправильными”) никто из тех кого я знаю пользоваться не будет.
[14:32:51] Кушелев Александр Юрьевич: ЗдОрово! Что касается онлайн-сервиса по определению белковых структур, то он выдал фантастические результаты по сверхдлинным альфа, 310, пи, бета и программным спиралям: http://nanoworld.org.ru/topic/1656/page/3/ И те кто это проигнорируют, проигнорируют здравый смысл, согласись smile

[14:34:50] Zoldrax: Так где подтверждение экспериментом? Без этого никто не будет разговаривать, или нужны реально профи по белкам, но я с такими не знаком.
[14:37:15] Кушелев Александр Юрьевич: Есть в метрологии понятие "самоповерка". Случай со сверхдлинными спиралями белков - это тот самый случай. Мы видим корреляцию между первичной и вторичной структурами белка. Причём на протяжении тысяч аминокислотных остатков. Корреляция 100%-ная.

[14:38:45] Кушелев Александр Юрьевич: А корреляция с данными РСА была обнаружена и достоверно продемонстрирована ещё в статье 1993 года, которая была в переработанном виде опубликована позже. По ней меня и нашла Виктория Соколик
[14:39:06] Кушелев Александр Юрьевич: А в книге "Пикотехнология белков" дана ещё более развёрнутая картина корреляции Пикотех и РСА
[14:39:16] Zoldrax: Так тогда нужно на картинках сразу приводить экспериментальную вторичную структуру, чтобы смотреть корреляцию.
[14:39:51] Кушелев Александр Юрьевич: Сверхдлинные спирали показывают правильность пикотехнологии в режиме самоповерки
[14:40:45] Кушелев Александр Юрьевич: Можно, конечно, поискать данные РСА для сверхдлинных спиралей, но этих данных может не найтись, иначе не было бы в энциклопедиях утверждений о том, что 310-спираль и пи-спираль обычно бывает не более 2 виктов
[14:41:12] Кушелев Александр Юрьевич: Ещё один режим самоповерки - программные спирали и вязь.
[14:42:03] Кушелев Александр Юрьевич: РСА не может заметить ни то, ни другое в принципе, т.к. интерпретаторы РСА пытаются заполнять модель кусками альфа-спиралей. Про программные спирали и вязь они просто ещё не знают.
[14:43:01] Кушелев Александр Юрьевич: Если пикотех может работать в режиме самоповерки, то РСА даже сам себе противоречит. В разные годы структура одного и того же белка может "оказаться" разной smile
[14:43:28] Zoldrax: К сожалению, пока не появится новых методов получения экспериментальных данных о структурах будет трудно.
[14:43:54] Кушелев Александр Юрьевич: Поэтому нужно уговорить специалистов заказать за мой счёт структуры их исследуемых белков и посмотреть, что они скажут после сравнения Пикотех с РСА
[14:44:42] Кушелев Александр Юрьевич: Например, профессор Туманян В.Г. был сильно удивлён, когда по коду я получил структуру его "любимого" белка панкреатической железы
[14:45:05] Кушелев Александр Юрьевич: Он сказал, что кроме него никто не знает, что это два противонаправленных участка альфа-спирали
[14:45:21] Кушелев Александр Юрьевич: Правда, он удивился, что обе половинки правые, когда он считал, что одна из них левая
[14:46:15] Кушелев Александр Юрьевич: Ты объясни своим знакомым, что они ничего не потеряют, если бесплатно получат вторичные, а может и третичные структури интересных для них белков.
[14:46:27] Кушелев Александр Юрьевич: Всегда же можно проигнорировать любые данные.
[14:46:34] Zoldrax: Пикотех можно подтвердить только экспериментальным методом, а его нет, как я понимаю. Вот и пусть он докажет это на эксперименте и опубликует предсказанную структуру, подтвержденную экспериментом, который покажет эти две спирали.
[14:46:41] Кушелев Александр Юрьевич: Но вдруг они увидят, что Пикотех дала ценную информацию
[14:47:07] Кушелев Александр Юрьевич: Пикотех подтверждена методом РСА на уровне сильной и достоверной корреляции.
[14:47:34] Кушелев Александр Юрьевич: Но корреляция с РСА не может быть 100%-ной по определению, т.к. данные РСА разных лет противоречат друг другу smile
[14:48:25] Кушелев Александр Юрьевич: Я не стал бы ждать публикации профессора Туманяна, когда уже вышла книга "Пикотехнология белков"
[14:48:34] Кушелев Александр Юрьевич: В книге дана обширная статистика
[14:49:12] Zoldrax: У меня нет знакомых, которые занимаются именно струкрурами белков.
[14:49:34] Кушелев Александр Юрьевич: Там исследованы 100 белков, данные из которых сведены в таблицу:
https://img-fotki.yandex.ru/get/9803/158289418.20f/0_129778_35eeac24_orig.png
[14:50:08] Кушелев Александр Юрьевич: Есть рецензии профессоров: http://nanoworld.org.ru/topic/1150/
Этого вполне достаточно, чтобы вызвать интерес у специалистов к новой технологии
[14:50:38] Кушелев Александр Юрьевич: Если у тебя нет специалистов по структурам белков, то это меняет дело.
[14:50:54] Zoldrax: Видимо, нужно показывать взаимодействие модели активных центров белков с малыми молекулами с известной структурой и показать, что модели пикотех лучше предсказывают взаимодействие.
[14:52:03] Кушелев Александр Юрьевич: Что касается взаимодействия белков с микромолекулами, то это более сложная задача, чем продемонстрировать корреляцию.
[14:53:52] Кушелев Александр Юрьевич: Что касается экспериментов с гипоталамусом, как ты относишься к сотрудничеству с дополнительными инвесторами?
[14:55:36] Кушелев Александр Юрьевич: Инвестор S собирается организовать акционерное общество...

50

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 91 605

Рекорды сверхдлинных спиралей белковых молекул

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 90 110

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ: 20170908_007:

https://www.ncbi.nlm.nih.gov/nuccore/11 … mask=65536

OLQ12821.1

>OLQ12821.1
atgtgcgatccagtgtacacgttgggcgtcgtgggtattctggacagcgagtatcttcca
gcatctatctacacggggaagtggtggtggttgttggtggtggtggtggtgctgctgctg
ctgctgctgctgctgctggtgctggtggtggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtggtggtggtggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtggggtgcgaagcgcactggcag
ttgatcggacaccttttacaccgcaacatgcaaaagtga

Результат:

https://img-fotki.yandex.ru/get/368408/158289418.472/0_1819be_e42c2fa6_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/245409/158289418.472/0_1819c8_7ebc8f8e_orig.gif

Обнаружена рекордной длины (4014-33+1=3982) 310-спираль Кушелева, образованная аминокислотной последовательностью (VL)*n

Попробуем ещё разок найти этот белок через BLAST:

https://www.ncbi.nlm.nih.gov/protein/12 … 9J28MDS014

https://www.ncbi.nlm.nih.gov/nuccore/12 … mask=65536

https://img-fotki.yandex.ru/get/509063/158289418.492/0_185049_8a612eef_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/898391/158289418.492/0_185048_b5f5b1cd_XL.png
Оригинал: https://img-fotki.yandex.ru/get/898391/ … d_orig.png

Кушелев: "... а случись оно что, вот вам и пожалуйста..." BLAST не смог найти второй раз тот же самый белок, но зато нашёл другой, тоже интересный...

Надо будет обязательно посмотреть его 3D-модель, но пока попробуем найти длинную 310-спираль через BLAST, если он ещё не разучился искать такие белки smile

https://img-fotki.yandex.ru/get/896349/158289418.492/0_18504a_8cd56dc0_XL.png
Когда я запустил поиск по 48 символам: "vlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvlvl", BLAST вообще ничего не нашёл. Это уже напоминает сказку про золотую рыбку, где каждый раз получался новый результат smile

***
Вот, что сообщает банк белковых структур по поводу белка OXA54355: https://www.ncbi.nlm.nih.gov/protein/OL … port=graph

https://img-fotki.yandex.ru/get/370744/158289418.492/0_18504b_2dbb2f88_orig.png

Нашлись несколько белков по авторам.

http://www.rcsb.org/pdb/explore/explore … ureId=5HUD

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-10-28_02:

https://www.ebi.ac.uk/ena/data/view/BAB … play=fasta

>ENA|BAB98246|BAB98246.1 Corynebacterium glutamicum ATCC 13032 Chorismate mutase
GTGTGCATGACTAATGCAGGTGACAACTTCGAGATCAGGATGCCTTCTGGCACGGATGAC
CCATTGTCCGATGCGGAGATCCAAAAGTATCGCGAGGAGATCAACCGCTTGGACCGCGAA
ATCCTCGATGCGGTGAAACGCCGCACGAAGATTTCCCAAACCATCGGAAAAACACGCATG
AGCTCGGGCGGAACACGTCTCGTGCACACCCGAGAAGTAGCAATCATCAACCAATTCCGT
GAAGAGATCGGCGAGGAAGGCCCTGCCCTCGCTGGAATTTTGCTGCGCATGGGACGCGGA
AAACTCGGATAA

Результат:

https://img-fotki.yandex.ru/get/897810/158289418.492/0_18504e_b10a8eb2_XL.png

Развёрнуто:

https://img-fotki.yandex.ru/get/962386/158289418.492/0_18504d_443f2d98_XL.png
Оригинал: https://img-fotki.yandex.ru/get/962386/ … 8_orig.png