1

Тема: Дидье Маруани "украл" 11 нот у ... микроба!

Формы, механизмы, энергия наномира. Сообщение 86 290

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Вальс постарел на ... 3 000 000 000 лет!

Кушелев: Продолжим исследование белка, фрагмент которого собирается под музыку Дидье Маруани / Didier Marouani, Раймонда Паулуса и Ben E King

https://img-fotki.yandex.ru/get/169608/158289418.3de/0_175f19_63be4753_orig.png

>ENA|XM_020206455|XM_020206455.1 Candida tanzawaensis NRRL Y-17324 hypothetical protein partial mRNA
atgtcctactacgacccttatcaaggcatacctcagcagtatatggcccagccttactac
ccgcaatactaccagcagaacccagaggatcaattgatccttgaaggtaacatgcctcct
tcgctcgacaccaggcaaaactcgttcgagcagtaccctcagtaccagaacgatgcctcc
ttcgggtttcaagacgacgtttcctctactgtcggtactgggaacgagttttacaatgaa
gacggtgtgttcatcaacggcaacacgggcgccccagggcaatcctccatgcctcaggtt
aaccaaggtatggtaaaccaaaaccaatcccaatacgctcaaatgaacaatggtgctaac
catcaaggcgccaatatgccaccagtctcaaacatgcaatcgcaaacccaatcccaccaa
ggtgaaatggtctacggtcagaacagtgggcctgctaactccaatgcggctccttctaga
actgtgtacttgggcaatattccttctgatatccaaccaaatgaattgttggattacgtc
agatcgggtattttggaaagtgtcaagattttgcctgccaagaactgtgctttcatttcc
ttcatagaccatcaatcagctttgttattccattctgattgtatcttgaaaaagttaagt
atcaagggtcatgacatcagaattggctggggtaagaatagtccaattttgcctgctgtt
ttggaatctattcaaagggatggagccactagaaacgtttacttgggtaatttgaacaac
ccagtcaatggagaaattataactgaacaagaattgagagaagacttgtcttgttatggt
gtaattgactgtatcaaaatcattccagaaaaaggtattgcatttattcatttcttatct
atattgagtgctatcagatgtgttgctaatttgccattgaaagaaaagtatttggataag
aaatgcttttacggaaaagatagatgtgcatttatcacaaagacccagcaacacaatgct
gcacaatatttaggattggctccagggatggaacacatcgttactgctgccgaccgggaa
tttatttcttctgcattagttcaacaatctgctgctgctgctcaaattgccactcaagct
ggtggagccaacaatttaggtaacagaaccgtttatttgggaaacttacatcaagactct
tctgtcgaagagatttgtaacgttgtcagaggtggtttgttacaaagtattagattcttg
aaggagagacatgtttgtttcatcaccttcattgatcccattgctgctgctcaattcttt
gctatgtgtcaattacatggtttgaccattcacaaccgtagaatcaaggttggatggggt
aagcattccggtccattgtctaacgctttgtcgttagctgtttccaatggtgcttctaga
aacatttatattggaaacatcattgattttgattactacaatcctcaaaagttgagagaa
gatttctccaaatttggtgatatcgaacaaatcaactacttggaagaaaagaattgtgcc
ttcatcaactttgtcaacattgccaatgctatcaaggctatcgatggaatcaaatctttc
aatgattacaagaatttaaagatcaactttggtaaggacagatgtggtaacttaccaaga
caattccaaagtcaaaatgctcaagttgggttcaatggacttgaaaacgtctccaatcca
tcattttccgataatgaatttatgaatgaagagccacaccaacaacacctccagaacctt
caccatcatcaacagcaacatcatcaccaacaacagcaacaaaaccagcaacagcaatag

Вторичная структура фрагмента, который собирается под музыку Дидье Маруани / Didier Marouani, Раймонда Паулуса и Ben E King:

https://img-fotki.yandex.ru/get/108697/158289418.3de/0_175f37_6bb72e50_orig.png
Структура полностью: https://img-fotki.yandex.ru/get/108697/ … 9_orig.png

В полной структуре белка из организма Candida обнаружился ещё несколько музыкальных фрагментов:

https://img-fotki.yandex.ru/get/99562/158289418.3de/0_175f39_36efaf75_orig.png

https://img-fotki.yandex.ru/get/114758/158289418.3de/0_175f38_2eeab96_orig.png
Это узнаваемые аккомпанементы вальсов. Здесь виден не только размер вальса 3/4 (3/8), но и характерный тональный переход, например, H1-E2 и G0-A3-A3 (реальные звуки не являются тональными, а напоминают нетональные ударные инструменты (басовый барабан и другой барабан соответственно)

https://img-fotki.yandex.ru/get/9931/158289418.3de/0_175f34_5187c629_M.gif
Оригинал: https://img-fotki.yandex.ru/get/9931/15 … 9_orig.gif
Примерно так выглядит третичная структура целого белка из организма Candida.

https://img-fotki.yandex.ru/get/195637/158289418.3de/0_175f36_3d4dc822_M.gif
Оригинал: https://img-fotki.yandex.ru/get/195637/ … 2_orig.gif
А это - пространственная модель предполагаемого активного центра белка, музыка сборки которого совпадает с музыкой Дидье Маруани (11 нот подряд!), Раймонда Паулуса (9 нот подряд) и Ben E King (9 нот подряд).

Что касается аккомпанемента вальса, то возраст этой музыки сборки белка легко датируется возрастом организма Candida. Это примерно 3 000 000 000 лет до нашей эры smile

Следовательно

"Вальс постарел на ... 3 000 000 000 лет!" smile