Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 263

Письмо Дидье Маруани от Кушелева

Salutations de la Russie, Didier Marouani! 1977 - 2017:



Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 265

Письмо Дидье Маруани от Кушелева


Кушелев: Сначала я обнаружил в геноме человека ноты из произведений Штрауса, Шуберта,  Верди, Моцарта. Недавно я обнаружил в геноме и ноты из двух произведений Дидье Маруани: http://nanoworld.org.ru/topic/1603/
Получается, что Маруани - классик smile


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 267

Письмо Дидье Маруани от Кушелева

Часть таблицы "нота - аминокислота":

H1    Asn N, Leu L, Asp D
A1    His H
G1    Met M, Gln Q, Glu E, Phe F
C2    Ile I
E2    Thr T, Cys C
A2    Ser S
G2    Val V

Попробуем найти белок по  нотам Дидье Маруани:



Ура! Все 12 нот совпали!

https://www.ncbi.nlm.nih.gov/protein/10 … JY50XN801N

По американским стандартам совпадение 11 нот уже считается плагиатом smile


https://www.ncbi.nlm.nih.gov/nuccore/10 … port=fasta

>XM_018011975.1 PREDICTED: Drosophila arizonae heterogeneous nuclear ribonucleoprotein L (LOC108616631), transcript variant X1, mRNA

Это - код белка мухи дрозофилы. Аналогичная последовательность встречается в белке паутинного клеща: https://www.ncbi.nlm.nih.gov/protein/10 … JY50XN801N

Попутно подвернулись интересные белки:

https://www.ncbi.nlm.nih.gov/protein/72 … JZEZRWD013

https://www.ncbi.nlm.nih.gov/protein/76 … JZEZRWD013

В микробах встречается последовательность из 11 нот: https://www.ncbi.nlm.nih.gov/protein/11 … K0F7PH7016

Кстати, речь идёт снова о Candida, но на этот раз tanzawaensis NRRL Y-17324: https://www.ncbi.nlm.nih.gov/protein/11 … K0F7PH7016

Учитывая, что по 9 нотам нашлись 11, причём другая музыка Дидье Маруани в том же самом микробе, можно предположить, что у человека есть технология проигрывания чужих генов. Это позволяет "сплагиатить" гены, например, у микробов или у тех организмов, которые являются пищей для человека.

Любопытно, что с тех же 9 нот начинается песня ... "Миллион алых роз"! Правда у Дидье Маруани ударение приходится на каждую третью ноту, а в песне "Миллион алых роз" - на каждую первую из трёх.

Мир тесен! И тут можно было подумать, что 9 нот взяты у Дидье, ведь он исполнил свою музыку в 1977-ом, а Алла Пугачёва - в 1982-ом. Но Алла Пугачёва пела песню, музыка которой была написана не Раймондом Паулусом, как это писали на пластинках и объявляли на концертах. На русский язык песня переведена с Иранского. А на иранском она звучала уже в 1969-ом году: https://www.youtube.com/watch?v=rCx8NjASwOs
Но на самом деле это ... фейк!

На иранском песню спела вовсе не Гугуш, а вот кто: https://www.youtube.com/watch?v=ePY6nxbXMAY

http://mp3pn.biz/song/34246105/Farzaneh … ose_farsi/

И вовсе не в 1969-ом! И вовсе не на иранском...
Эта песня записана в 2008 году. Подробности: https://translate.google.ru/translate?h … rev=search

Так что 10 нот без учёта ударения мир впервые услышал всё-таки от Дидье Маруани. У Раймонда Паулуса эти 10 нот появились на несколько лет позже. На плагиат это совсем не похоже. И формально плагиатом считается повторение 11 нот. 10 нот - ещё не плагиат smile

Меня заинтересовало не только повторение 10 нот у двух гениальных композиторов (Дидье Маруани и Раймонда Паулуса), которые обнаружились в геноме Candida. На мой взгляд ещё более интересным является другое совпадение. Ведь другая музыка Дидье Маруани тоже обнаружилась в геноме  Candida. А это может означать наличие у человека технологии прочтения генов, которые каким-либо способом попали в организм человека. То ли это микроорганизмы, которые находятся в симбиозе с человеком, как Candida, то ли это биообъекты, которые являются для человека пищей. Известен же опыт, когда лабораторных червей обучали в лабиринте, а потом измельчали и скармливали другим червям, которые после этого вели себя в лабиринте так, как будто прошли обучение.


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Письмо Дидье Маруани от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 269

Денис пишет:
Kushelev пишет:

Любопытно, что с тех же 9 нот начинается песня ... "Миллион алых роз"! Правда у Дидье Маруани ударение приходится на каждую третью ноту, а в песне "Миллион алых роз" - на каждую первую из трёх.

Я нот не знаю, но это тоже очень похожая музыка
Ben E King - Spanish Harlem. Released on the last day of 1960.

Кушелев: Да. 10 нот совпадают и с музыкой Маруани, и с музыкой Паулуса. Но у Маруани есть совпадение 11 нот с музыкой сборки белка из организма Candida. При этом из другой мелодии совпадает 9 нот с музыкой сборки белка из того же организма Candida!

Так что три гениальных композитора могли "сплагиатить" музыку из генов, так же, как Штраус, Шуберт, Верде, Моцарт...

Похоже, что оригиналы гениальных наборов нот хранятся именно в генофонде. При этом некоторые ноты хранятся в генофонде уже миллиардами лет...


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Письмо Дидье Маруани от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 277

Денис пишет:

Рандомное унылое бряцание типа ваших треков

Кушелев: Похоже, Вы не в курсе, что означает слово "унылое". И что значит "ваших"? Если Вы имеете в виду музыку сборки белка, то ей миллиарды лет. Это не моя музыка.

И я не называю музыкой случайный переход тонов. Музыкой я называю лишь фрагменты, которые содержат узнаваемые ноты из известных музыкальных произведений. Я предполагаю, что эти фрагменты соответствуют активным центрам белковых молекул.

Подробнее: http://nanoworld.org.ru/topic/1603/


Ноты, полученные по упрощённой программе имеют одинаковую длительность. Реальная музыка сборки белковых молекул имеет разную длительность, т.к. есть "быстрые и медленные" кодоны. А это значит, что в зависимости от угла поворота аминокислоты зависит длительность её звучания или паузы между нотами.


И число нот, соответствующих одной аминокислоте может быть больше 1. Так что Ваша критика относится не к реальной музыке белков, а к упрощённой модели. Не забывайте об этом.


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 282

Письмо Дидье Маруани от Кушелева

Кушелев: Давайте посмотрим вторичную, третичную и музыкальную структуру белка, сборка которого сопровождается музыкой, 11 нот которой совпадает с музыкой Дидье Маруани.

https://www.ncbi.nlm.nih.gov/protein/11 … K0F7PH7016

https://www.ncbi.nlm.nih.gov/protein/11 … port=fasta

>XP_020067029.1 hypothetical protein CANTADRAFT_19515 [Candida tanzawaensis NRRL Y-17324]



Locus XM_020206455.1 Candida tanzawaensis NRRL Y-17324 hypothetical protein partial mRNA
FT   CDS             1..1860
     atgtcctact acgaccctta tcaaggcata cctcagcagt atatggccca gccttactac
     ccgcaatact accagcagaa cccagaggat caattgatcc ttgaaggtaa catgcctcct
     tcgctcgaca ccaggcaaaa ctcgttcgag cagtaccctc agtaccagaa cgatgcctcc
     ttcgggtttc aagacgacgt ttcctctact gtcggtactg ggaacgagtt ttacaatgaa
     gacggtgtgt tcatcaacgg caacacgggc gccccagggc aatcctccat gcctcaggtt
     aaccaaggta tggtaaacca aaaccaatcc caatacgctc aaatgaacaa tggtgctaac
     catcaaggcg ccaatatgcc accagtctca aacatgcaat cgcaaaccca atcccaccaa
     ggtgaaatgg tctacggtca gaacagtggg cctgctaact ccaatgcggc tccttctaga
     actgtgtact tgggcaatat tccttctgat atccaaccaa atgaattgtt ggattacgtc
     agatcgggta ttttggaaag tgtcaagatt ttgcctgcca agaactgtgc tttcatttcc
     ttcatagacc atcaatcagc tttgttattc cattctgatt gtatcttgaa aaagttaagt
     atcaagggtc atgacatcag aattggctgg ggtaagaata gtccaatttt gcctgctgtt
     ttggaatcta ttcaaaggga tggagccact agaaacgttt acttgggtaa tttgaacaac
     ccagtcaatg gagaaattat aactgaacaa gaattgagag aagacttgtc ttgttatggt
     gtaattgact gtatcaaaat cattccagaa aaaggtattg catttattca tttcttatct
     atattgagtg ctatcagatg tgttgctaat ttgccattga aagaaaagta tttggataag
     aaatgctttt acggaaaaga tagatgtgca tttatcacaa agacccagca acacaatgct
     gcacaatatt taggattggc tccagggatg gaacacatcg ttactgctgc cgaccgggaa
     tttatttctt ctgcattagt tcaacaatct gctgctgctg ctcaaattgc cactcaagct
     ggtggagcca acaatttagg taacagaacc gtttatttgg gaaacttaca tcaagactct
     tctgtcgaag agatttgtaa cgttgtcaga ggtggtttgt tacaaagtat tagattcttg
     aaggagagac atgtttgttt catcaccttc attgatccca ttgctgctgc tcaattcttt
     gctatgtgtc aattacatgg tttgaccatt cacaaccgta gaatcaaggt tggatggggt
     aagcattccg gtccattgtc taacgctttg tcgttagctg tttccaatgg tgcttctaga
     aacatttata ttggaaacat cattgatttt gattactaca atcctcaaaa gttgagagaa
     gatttctcca aatttggtga tatcgaacaa atcaactact tggaagaaaa gaattgtgcc
     ttcatcaact ttgtcaacat tgccaatgct atcaaggcta tcgatggaat caaatctttc
     aatgattaca agaatttaaa gatcaacttt ggtaaggaca gatgtggtaa cttaccaaga
     caattccaaa gtcaaaatgc tcaagttggg ttcaatggac ttgaaaacgt ctccaatcca
     tcattttccg ataatgaatt tatgaatgaa gagccacacc aacaacacct ccagaacctt
     caccatcatc aacagcaaca tcatcaccaa caacagcaac aaaaccagca acagcaatag





Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 283

Письмо Дидье Маруани от Кушелева

Что это?!


Возможно, что ролик на ютубе скоро будет недоступен. В этом случае Вы сможете посмотреть копию: https://cloud.mail.ru/public/LupW/DjiEtaBMP

Начну с моей реакции. Я был в шоке. Моя любимая певица спела ворованную моим любимым композитором музыку. И такая реакция была у сотен тысяч людей. Я сам показывал ролик многим знакомым и видел, что они испытали такой же шок, как и я.

Ролик был выложен в инет 5 декабря 2016 года. Вчера, 16 марта 2017 года я наткнулся на обсуждение этого ролика в инете. Там знатоки музыки написали, что музыка "от Гугуш" исполняется на известном синтезаторе, который появился сильно позже 1969 года. Это так называемая сэмплированная музыка. Другие эксперты обратили внимание на то, что Гугуш на этом ролике не открывает рот, т.е. видео не соответствует аудио. Наконец, кто-то дал ссылку на запись реального исполнения: https://www.youtube.com/watch?v=ePY6nxbXMAY

Итак, ролик "1969" назвали фейком, но ... фейк ли это?

Давайте рассуждать. Цель фейка (подделки) заключается в том, чтобы обмануть. Но если "фейк" сделан очень грубо, а на обман поддалось подавлюющее большинство зрителей/слушателей, то это уже больше смахивает на розыгрыш.

В данном случае я склоняюсь к мысли, что это даже не розыгрыш, а социальный эксперимент, который показал, как легко большинство людей ведутся на технически грубые, но психологически безупречные розыгрыши.

Вам стало обидно? Стыдно? Скучно?

Не переживайте. Сейчас будет продолжение, которое Вас обрадует.

В школьные годы я восхищался полётами человека в космос и на Луну. Каково же было моё удивление, когда я лично обнаружил подделку в официальных телевизионных передачах про полёты Аполлонов на Луну. Кого интересует эта тема, смогут подробно изучить её по этой ссылке: http://nanoworld.org.ru/topic/878/

Если ссылка будет недоступна, то можно посмотреть материал из рассылки "Новости лаборатории Наномир": http://nanoworld88.narod.ru/data/339.htm
Остальной материал можно посмотреть в более поздних выпусках рассылки: http://nanoworld88.narod.ru/data/index.htm

А теперь перейдём к главному, ради чего я написал этот текст.

Большинство людей в инете развлекается. Ищет сенсации, натыкается на фейки, розыгрыши, приколы, социальные эксперименты...

Мне самому иногда хочется переключиться, отдохнуть от напряжённой научной работы. Но на этот раз я понял, что праздное времяпрепровождение сотен миллионов людей в инете можно использовать ... на общее благо!

Дело в том, что я знаю, как вернуть молодость всей планете. И это не фейк, не розыгрыш и не социальный эксперимент. Но я не могу это сделать в одиночку. "Один в поле не воин".

Зато я могу доступно рассказать, как это можно сделать сообща: http://nanoworld88.narod.ru/data/393.htm

Суть проблемы заключается в том, что практически каждый житель нашей планеты хочет жить "долго и счастливо". Конечно, вечная молодость по большому счёту не решает эту проблему, т.е. не гарантирует, что жизнь будет долгой и/или счастливой. Более того, не гарантирует даже того, что Вы не умрёте от старости. Ведь для поддержания биологического возраста на уровне репродуктивного возраста (20-40 лет) нужно ежедневно принимать препарат, который отключает механизм старения. Если бросить приём, то примерно через полгода организм снова выйдет на запрограммированный возраст, и если он больше 120 лет, то это означает запрограммированную смерть "от старости". Но ... хватит о грустном.

После того, как удастся прочесть сигнал отключения механизма старения, а это зависит в т.ч. от Вас, люди получат вечную молодость по цене ложки кваса, которую нужно будет принимать ежедневно. Пенсионерам бесплатно будут выдавать, чтобы через полгода отменить пенсии. Только на пенсиях "хозяева жизни" сэкономят примерно 2.5 триллиона долл. ежемесячно в масштабах планеты.

Теперь о главном. Как приблизить дату создания средства, возвращающего молодость?

По оценкам разных экспертов, четвёртый этап эксперимента, в котором старые лабораторные животные омолодятся и станут снова рожать, обойдётся примерно в миллион долл., если действовать по этой схеме: http://nanoworld.org.ru/post/76970/#p76970

Подробности: http://nanoworld.org.ru/post/80304/#p80304

Детали 4-го этапа эксперимента ещё прорабатываются, но принципиальная возможность вернуть молодость для меня уже очевидна. Она стала очевидной на стадии, когда я узнал, что органы, которые уже перестали правильно функционировать в старом организме, будучи пересаженными в молодой организм, снова начинают полноценно функционировать. Старые лабораторные животные умирают от старости, а пересаженные из них органы продолжают полноценно функционировать в молодых организмах, живя "вторую, третью и т.д." жизнь.

Возвращаясь к "цене за вечную молодость", кажется парадоксальным, почему 7 миллиардов людей до сих пор не собрали 1 миллион долл. для того, чтобы жить вечно-молодыми?

А тут как раз и возникают психологические проблемы, которые мешают людям скооперироваться и омолодиться за копейку.

Большинство вообще всё непонятное воспринимает за фейк. А те, кто понял, что вечная молодость - реальность, не знает, как себе помочь.

Нужен организатор, который сможет собрать "с миру по нитке", и организовать совместную работу этих лабораторий:

Может быть именно Вы и есть тот организатор, которого мы ждём "всем миром"? smile

В таком случае выходите на связь: http://nanoworld.narod.ru
На сайте есть мой скайп и телефоны.
Можно написать своё предложение и в этой теме на форуме лаборатории Наномир: http://nanoworld.org.ru/topic/1620/


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 290

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Вальс постарел на ... 3 000 000 000 лет!

Кушелев: Продолжим исследование белка, фрагмент которого собирается под музыку Дидье Маруани / Didier Marouani, Раймонда Паулуса и Ben E King


>ENA|XM_020206455|XM_020206455.1 Candida tanzawaensis NRRL Y-17324 hypothetical protein partial mRNA

Вторичная структура фрагмента, который собирается под музыку Дидье Маруани / Didier Marouani, Раймонда Паулуса и Ben E King:

Структура полностью: https://img-fotki.yandex.ru/get/108697/ … 9_orig.png

В полной структуре белка из организма Candida обнаружился ещё несколько музыкальных фрагментов:


Это узнаваемые аккомпанементы вальсов. Здесь виден не только размер вальса 3/4 (3/8), но и характерный тональный переход, например, H1-E2 и G0-A3-A3 (реальные звуки не являются тональными, а напоминают нетональные ударные инструменты (басовый барабан и другой барабан соответственно)

Оригинал: https://img-fotki.yandex.ru/get/9931/15 … 9_orig.gif
Примерно так выглядит третичная структура целого белка из организма Candida.

Оригинал: https://img-fotki.yandex.ru/get/195637/ … 2_orig.gif
А это - пространственная модель предполагаемого активного центра белка, музыка сборки которого совпадает с музыкой Дидье Маруани (11 нот подряд!), Раймонда Паулуса (9 нот подряд) и Ben E King (9 нот подряд).

Что касается аккомпанемента вальса, то возраст этой музыки сборки белка легко датируется возрастом организма Candida. Это примерно 3 000 000 000 лет до нашей эры smile


"Вальс постарел на ... 3 000 000 000 лет!" smile


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 303

Письмо Дидье Маруани / Didier Marouani от Кушелева

Повторяющийся несколько тактов аккомпанемент музыкального произведения Дидье Маруани:


H1    Asn N, Leu L, Asp D
A1    His H
G1    Met M, Gln Q, Glu E, Phe F
C2    Ile I
E2    Thr T, Cys C
A2    Ser S
G2    Val V


https://www.ncbi.nlm.nih.gov/protein/54 … P44C8X101N

LOCUS       CCX32584                 362 aa            linear   PLN 23-SEP-2013
CDS             1..362
        1 mapkpvlnvq iptsdkmkft ehdicidihg lgeimqimfr chsdlihssf lsaldesgfd
       61 annfdfsyav ngeagtesyk fedeqawkdf tikveegkaw rnhrngtivi ygeekkpeva
      121 deenmenigi keqpevteqv eeqteiqeqs evteeaeeqt eideqsgvse eaeelteiee
      181 qsevteeaee smenmeiqeq sevseqveeq tedmgieeqs evseqaeeqt eieeqsevve
      241 eakekmeiee qpeiteeaee qtevaeevee smeieeqpei teeveenmei eevsnpaeeq
      301 aedikteeqs tvtkeakeri enigieeqse ateeaeerte nmeteeqsev teeadektei
      361 ev


FT   CDS             292849..293937
atggctcccaaacccgttttaa acgtacagat ccctacatct gacaagatga aattcacaga acacgacatt
   292921 tgcatagata tccacggtct cggtgagatc atgcagatca tgttccgttg ccactcggac
   292981 ctaatccact cctcatttct gtctgcgctc gatgaatctg gcttcgatgc aaacaacttt
   293041 gacttcagtt atgcagtgaa tggggaggcg gggacggagt catataagtt tgaagatgaa
   293101 caggcatgga aagattttac catcaaggta gaggagggga aggcttggag aaaccacaga
   293161 aatggaacga ttgttattta tggagaggag aaaaagccgg aggtagcaga cgaagagaac
   293221 atggagaaca tcgggattaa ggagcaacct gaagttaccg agcaggtgga agagcagacg
   293281 gaaatccagg agcagtctga agttactgag gaggcagaag agcagaccga gattgatgaa
   293341 cagtctgggg tttccgagga agcagaagag ttgacggaaa ttgaggaaca atctgaagtt
   293401 actgaggagg cagaagagag tatggagaac atggagattc aggagcagtc tgaagtttcc
   293461 gagcaagtgg aagagcagac ggaggatatg gggattgagg agcagtctga agtttccgag
   293521 caggcagaag aacagacgga gattgaggag cagtctgaag ttgtcgagga ggcaaaagag
   293581 aaaatggaaa ttgaggaaca acctgaaatc actgaggagg cagaagagca gactgaagtt
   293641 gccgaggagg tagaagagag catggaaatt gaggaacaac ctgagatcac tgaggaggta
   293701 gaagagaaca tggaaattga ggaagtttcc aatccagcgg aagagcaggc agaggacata
   293761 aaaactgaag aacaatctac agtcaccaag gaggcaaaag agaggataga gaacataggg
   293821 attgaggagc agtctgaagc caccgaggag gcagaagaga ggacggaaaa catggagact
   293881 gaggagcagt ctgaagttac cgaggaggca gacgagaaga cggagattga ggtatagtct
   293941 gaagttgccg aggaggcgga agacaggaca gagaacatca atgaggcaga ggagaa


Отметим ноты из аккомпанемента Дидье Маруани красны цветом:


Обратите внимание на окружающие ноты в музыкальной структуре белковой молекулы.

Если их добавить в аккомпанемент, то будет неплохо, правда?


И это ещё не плагиат, т.к. из произведения Дидье присутствуют лишь 8 нот.


Так будет звучать аккомпанемент, если использовать ноты из музыкальной структуры белка, расположенные с другой стороны от аккомпанемента Дидье.

А здесь я объединил оба варианта. Понятно, что оригинальные ноты сборки белка можно заменить "по вкусу музыканта". При этом может получиться неплохой аккомпанемент для музыки будущего smile


Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 305

Письмо Дидье Маруани / Didier Marouani от Кушелева

Знакомьтесь, "Чижик-Пыжик"

Кушелев: Первую часть "Чижика-Пыжика" мы нашли в геноме. А как быть со второй частью?


D1    Arg R
H1    Asn N, Leu L, Asp D
A1    His H
G1    Met M, Gln Q, Glu E, Phe F
C2    Ile I
E2    Thr T, Cys C
A2    Ser S
G2    Val V


С первой попытки одна из 8 нот не совпала:

https://www.ncbi.nlm.nih.gov/protein/51 … RBYM2P1016

        1 mtlqfpllek aqnvshyisr lsgskpemve kvmndiqtpm skavfqqwwr alpavtsdeq
       61 laaqlrqlrq rmmmhliird vnnlapldev vksvswfaef vietaldyhh qmlvsvhgep
      121 vgedtrthqs laivgmgklg geelnvssdi dlifvypedg dtegprvirn sefftrlgqr
      181 vikalndata dgfvfrvdmr lrphgdsgpl vashamleny litqgrewer yawmkarvlt
      241 gdetslmqlv kpfvfrkyld ygayssirdl hsqirrevtr rdksddiklg pggireiefi
      301 aqifqlirgg rtpklqvrst rqafaeiatl glmpeqavde llaayeflrr lehriqyldd
      361 qqtqtlprnp edqhrlamam dtpsynalla eldthrhlvs rhfeqvfiap mdnashplda
      421 vwldcdnqet tvdalatigy rdpkgtqqll ismknshryl nlptnckrrf dtlvppllav
      481 aarqpqpdtt lhrlmnllea isrresylal lvehpqtlqk latlysaspw vseyltrhpi
      541 lldelldgri lyqnpdkerl rqelnellde aagdteqimh ilrhvhhtqv frlvaqdlag
      601 mhsvealgdy lsdladvild tcvyrcwkei kqrhietpkf avigygklgg kelgyatdld
      661 iiflyddnhp daaenyarla krlsswlttp taggtvyeld lrlrpngesg llvssveafa
      721 eyqsksawiw ehqaltrarf vagdalvgqq fddikmnvls qkrdlkalkd evmamrqkmh
      781 dahpphagef dvkhdaggli dvefcvqylv lalapqypdl trnsgniall naagalgvmp
      841 pdialaasna yrslrhqqhv lrlsgqqnnr ideherkkeq qairalwqqv fgqar

Однако ноты перед второй частью "Чижика-Пыжика": qlrqlrqrmmmhliir впечатляют!

Файл fasta:

>WP_018150904.1 glutamine-synthetase adenylyltransferase [Leeia oryzae]

Нуклеотидную последовательность найти не удаётся.

Попытка number two


Это нечто!

https://www.ncbi.nlm.nih.gov/protein/55 … RDEGDFP016

     CDS             1..2329
        1 mkaktaaans ssraellqel kiieeaatrl dislpphiva aaagnsssss snssssssss
       61 mktdedaaaa svapaavaaa aaapaapaas aaaaaaaepe aaddmamqla sdlgessvav
      121 aaaaaaaaaa aaagpaaaag ggafvplsta aaaaaaaaag gparrvllql silrefdvsc
      181 gglrpavycm qppaaaaaaa ttaattaaaa attaadnhre rqivrtdatd tamaldadvd
      241 aaaaataata aataaataaa taaadsdtvq ndeqqqqqqq qqqqqqqqqq cegatlrfsl
      301 diinfeelhv nvwplhslme llqqqqqqqq qqqqqqqqqy lltaadvfal rvlqqqccwr
      361 wlqrwggekl qlqqwlaaaa aalsllqllt lafyltpkrs aaaaavaaat aaaaattapp
      421 ppaaalaaaa apddlklifn ettiplspqq qqqqqqqqqq qqqqqqqqqq qqqqeedivf
      481 dggaclqliy sgyrcdisls msrgalllqc mwlppllqql lqaaaaqsva dlllllpllr
      541 rlafstrfae aaaaagvsvv saadvgaatw svpaaaaaaa aageaapaaa ddddddddga
      601 eaaaaaaaaa ahpksvlate aidvlqqllh cgdrpaaaaa aaaaaaaksp qqqpraaaaa
      661 aaasctatlf lriplqqqqq qqqqqqqqqq qqqqqqqeav vaavvdgrrr itasyllvav
      721 gagdpataaa aaaaataarl glpaaaaaag sssssrlkqh nnifgtvkia hpplklehlq
      781 qqqqqqqqqq eqqqqqqgyl rvtvqqyvra lqqllqqqqh liillqrlsq qlpysircfl
      841 kplnptdaaa aaaataaaaa aaaaagehet aaaelslvea lqqqtgkcvg akveqqqqqq
      901 qqqqqqqqqq glllqwclqq qpavllrsna gdvaeggaaa aaaaaaaaaa aaaacsqdde
      961 taqqqqqqqq qqqqpwlvyi hrnkpqvsfi sfcrsaadas cftlllqqqe adrctllpsn
     1021 lqqqqqqqqq qrllllptar rdvsvscvlq paikeqqqqq qqqqqqqqll wfscsssaat
     1081 aplgcdtaaa aaaagaaaaa vepqqqqqql qqqqqqqqqq leeqqqqdav laaaaaaeel
     1141 avfsllqqea aalqqkwgdl lqqqhtkpfs lqlrllllha ramkhtvaaa aaeedeavaa
     1201 aaaaareaei qqeavylrft vcrqqqqqqq qqqqqqqqqq qqqqhtvvei sssnvllqql
     1261 lqqllqhllg taaaaehihr sgrplqqllr lllcgaeflc ccyrlpasll cyksfpqqqq
     1321 qqqqqqqqqq qqqqqlvlqq wchaaeaaka ggvsllplyl etsaaaraaa aaaaaaaaga
     1381 gaagaaaggg gaaaagggga aadiqglppl llrqhsrcra lvsvhivlee trlvrqqqqq
     1441 qqqqqqqqqq qqqqlsgata keqsthtity ftphkpssss ssnssssssn ssssssssss
     1501 snessslyse efivgfchvl qqfaaaasaa vvdqvsptpq dsssssssss saaaaaaaaa
     1561 aagsvqhlig gqgrrclstv ykftssksaa astcvcctit aaaatvlvwp glllqqlllp
     1621 llqtcklyav faaaaasdss rkivyaaaar kqltssssss sssngvpvai ldispslqqq
     1681 qqqqheqqqq qqqqqqqqqq qrstqlvlsl sltplqevlv lpgepeqqqq qqqqqqeeqq
     1741 qqqqqeeqqq qqqqqqqqqq qstevylhws esltealpln ellpnpqpaa aaaaaaaaaa
     1801 aaakscssll ikteettadm qqqllqqqqq qqqqqqqrcv ccgvrcsstp lllqgarlas
     1861 snrlarrapf vrlllqtnye grgiavlqqf vrflcpllps nniilfiiyl rrqleaaaaa
     1921 aaaaaaaaaa aaaantaaga aaaplppgga patnstssss ssssssssss sssssrgssk
     1981 datqefacwl lqplrslfsh lllhaalaaa arrwqhggss aarccsssss sssssssngs
     2041 issggdtaag sseaatataa tataaaataa aaaaaaaaea eagitataaa detieeeyev
     2101 rrviatkkit irgpdapaaa aapaaaaaaa geeastaapa aaaaaaaaaa aadslqgegl
     2161 ffaayygvhl nnsptihrva vlllhyllpl lqqpllqrkf kraqvavaaa vaaaaaaaaa
     2221 pgsgvvlqqq qqqlllslrr eppsraaata ataattaaaa aagpaaaaaa apglagqqqq
     2281 qqqqqqqqqq qqmllqqqla agssstldll lpqqpfvflq flptqspng


>HG695324.1 Eimeria praecox Houghton genomic scaffold, Eph_scaff631, whole genome shotgun sequence

Первая часть (до символов NNN):


После терминирующего кодона как раз и начинается самое интересное smile