21

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 228

Письмо Дидье Маруани от Кушелева

Dear Didier!

> Can you explain me better how did you find these 9 notes in the Human Genome?

Kushelev: Aminoacids has different long parts (radicals):

http://img-fotki.yandex.ru/get/6211/126580004.52/0_bcc22_c76df23e_S.gif http://img-fotki.yandex.ru/get/6301/126580004.52/0_bcc21_bcb086e6_S.gif

Details: http://nanoworld.org.ru/topic/301/

I calculated their own oscillation frequencies F=sqrt(1/(long*mass)):

http://www.nanoworld.org.ru/data/01/dat … 930219.htm

My programmer made program:
http://www.nanoworld.org.ru/data/01/dat … p/casp.zip

You can take the protein code from Protein Data Base:

https://www.ncbi.nlm.nih.gov/nuccore/556764592

Remove unnecessary characters:

LOCUS       XM_005977503            2950 bp    mRNA    linear   MAM 05-NOV-2013
FT   CDS 1..1425
     atgatgatga tgattatgat gaagaaggtg aagaagcgga tgaggccggg tggctcctcc
     ccggggaccc tccccctctg ggccgcgtca ttctccccac ccccgggtcc tgacccaggg
     agctggcctc gctgggacag ttctcagcca cctgctccgg agccggggag ccggggcgcc
     ggcagcccgt gagtcggtgc gagcgcccag agccccatgg agctgccggc cagcaactgc
     gagaacggtt ccctgatcag cctgtactgc tcctcccaaa aagtcctgtg ccagatcatc
     agtgacctcc agcctgaggt gcccagcaat gtcacctcca acagctggca ggagaggttc
     aggaagaact acagcttcta cgtcggtctg gggctggcca tcctgtccag cttcctcgtc
     ggcagcagcg tcatcctcaa gaagaagggc ctacagcgac tggtggcctc aggcgccacg
     cgggctgtgg atggaggcta tggctacctg aaggactcaa tgtggtgggc tggatttctc
     acgatggctg ctggggaagt tgccaacttc ggggcctacg cgttcgctcc tgccacagtc
     gtcacccctc tgggagcgct gagtatcctc ataagtgcca tcttttcctc gtatttcctg
     ggggagagtc tgaacctctt ggggaagctg ggctgtgtga tctgcgtggc tggcagcaca
     gtgatggtga tacatgcccc cgaggaagag aagatcacca ccatcatgga gatggctgcc
     aagatgaaag acacagggta catcgtgttc gctgtgtttc tgctggtgtc ctgcctcatc
     ctcatcttcg tcgtcgcccc acgttatgga caaaggaaca tcctcgtcta catcgtcatc
     tgctctgtga tcggggcctt ctccgtgccc gccagcaagg gtctgggcct gaccatcagg
     aacttcttcc aggggctgcc agtggtgcgg caccctctcc cctacgtcct gtccctcatg
     ctggcgcttt ccatcagcac tcaggtcaac ttcctcaaca gggcgctgga catcttcaac
     acctccctgg tgttccccat ctattacgtg ttcttcacca cgacggtgat gacctcctcc
     atcatcctct tcaaggagtg gtacaggatg tcggctgtgg acatcgtggg caccctctcc
     ggctttgtca ccatcatcct gggtgtattc atgcttcatg ctttcaaaga cctggacatc
     agccagagca gcctgccccg tatgcacaaa aacccacctg ccactcctgc cccagagccc
     agtgtcatta gacttggaga caagaatgtc ctagtggaca acatggaact ctccagcacc
     ccatcaccag aagagaagcc caaagtgttt atagcccatt cgtaaagcct gaagtagaga
//

And program CASP make for You midi-file: https://cloud.mail.ru/public/65r8/Ga1cxTamk

Then You may open midi-file in programe MuseScore:

https://img-fotki.yandex.ru/get/44819/158289418.3dd/0_175cd0_617cfa3b_XL.png

Music builds a protein XM_005977503 ("Magnesium transporter") starts with 9 notes from your song:

https://img-fotki.yandex.ru/get/172931/158289418.3dd/0_175ccf_bddbf127_orig.png

https://img-fotki.yandex.ru/get/243369/158289418.3dd/0_175cc1_73bc5fc1_XL.png

***
Kushelev: It is very interesting cooperation (collaboration) for me.

We can make not only forms. I have unusual cataphytes that aliens use to protect them from radiation weapons.

I can speak as a science consultant and an engineer.

Sorry my bad English...

Warm wishes,
Your Alexander Kushelev

http://nanoworld.narod.ru
Skype: kushelev2009
tel:
+7-926-5101703
+7-903-2003424
+7-916-8265031

22

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 230

Письмо Дидье Маруани от Кушелева

https://img-fotki.yandex.ru/get/243369/158289418.3dd/0_175cc1_73bc5fc1_XL.png

https://img-fotki.yandex.ru/get/97884/158289418.3de/0_175d35_170f89a4_orig.png

Full secondary structure:

https://img-fotki.yandex.ru/get/170815/158289418.3dd/0_175d34_ac78e837_orig.png

23

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Письмо Дидье Маруани от Кушелева

https://img-fotki.yandex.ru/get/97884/158289418.3de/0_175d35_170f89a4_orig.png

3D structure of this fragment:

https://img-fotki.yandex.ru/get/170815/158289418.3de/0_175d3c_39746aaa_M.gif
Original: https://img-fotki.yandex.ru/get/170815/ … a_orig.gif

https://img-fotki.yandex.ru/get/109344/158289418.3de/0_175d3d_8803977f_M.gif
Original: https://img-fotki.yandex.ru/get/109344/ … f_orig.gif

Full structure:

https://img-fotki.yandex.ru/get/225650/158289418.3de/0_175d3b_855eba21_M.gif
Original: https://img-fotki.yandex.ru/get/225650/ … 1_orig.gif

It is pre-protein model. It is necessary to correct automatic mode errors and refine the model in manual mode.

24

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Письмо Дидье Маруани от Кушелева

1. Design in space. ... can be assembled according to a scheme from the microcosm.

http://www.nanoworld.org.ru/data/01/dat … 01/big.avi

On this subject, I have an additional idea "for luck." In 1992, I experienced Microwave Engine (Emdrive): http://subscribe.ru/archive/science.new … 21707.html

The Microwave engine was tested at NASA in 2014 and in space in 2016 (China): http://www.popsci.com/emdrive-engine-sp … na-success

This Emdrive is weak, but I made Ruby Emdrive:

http://img-fotki.yandex.ru/get/5819/158289418.19d/0_fec91_d028a2c3_XL.gif

He must raise 1000 times his weight.

The first engine is difficult to turn on. We need a special magnetron. He is trained in a defense plant. The stand costs about 100 000 USD. If we manage to turn on Ruby Emdrive, It will be possible to replace the engines of the quadrocopter with ruby Emdrive. New engines do not rustle and operate without fuel:

http://img-fotki.yandex.ru/get/6843/158289418.12f/0_f4dbe_d820c7ad_orig.png
Details (rusiian): http://nanoworld.org.ru/topic/811/

2.

https://img-fotki.yandex.ru/get/107800/158289418.2b8/0_151be1_bd56fbd0_XL.jpg

http://img-fotki.yandex.ru/get/3513/nanoworld.102/0_2be74_427bc236_XL.jpg

http://img-fotki.yandex.ru/get/3514/nanoworld.102/0_2be71_ae443bb3_XL.jpg

Details: http://nanoworld.org.ru/post/71315/#p71315

Construction: http://nanoworld88.narod.ru/data/163.htm

Alien cataphots...

Warm wishes,
Your Alexander Kushelev

P/S

Films 1994-1995 :
Part 1: https://cloud.mail.ru/public/4MNL/afZbJzmAJ
Part 2: https://cloud.mail.ru/public/JJFG/6GypqKoJ6

Film 2013: http://www.youtube.com/watch?v=IH6kGaAFIBU

Introduction: http://nanoworld.org.ru/topic/1154/

25

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 238

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани от Кушелева

Кушелев: Что касается ситуации с песней "Жестокая любовь", то как это ни парадоксально, но именно она для меня явилась поводом снова выйти на контакт. Более того, в результате мне удалось сделать очередное научное открытие и создать технологию поиска генов по нотам.

Вообще, ситуация очень непростая. Дидье Маруани - гениальный композитор. Филипп Киркоров - гениальный певец. По существу Филипп оказался жертвой ... системы. 20 лет назад в России воровство интеллектуальной собственности было как бы нормой. На словах это осуждалось, но законного наказания не было. Поэтому воровство интеллектуальной собственности в России и многих других странах носило массовый характер. Но, времена меняются. Несколько лет назад Россия поднялась на новый уровень защиты авторских прав, поэтому многим придётся расплачиваться за старые грехи.

Кстати, мой отец, Юрий Николаевич Кушелев, тоже пострадал из-за того, что у него украли интеллектуальную собственность может быть даже больше, чем на миллион евро. У него были десятки секретных авторских свидетельств, по которым он мог получить законное авторское вознаграждение, но не получил. Его украли работники ВПК СССР.

Что касается Филиппа Киркорова, то я бы заплатил за него штраф типа миллиона евро, если бы у меня была такая возможность. А такую возможно в наше время реально организовать. Дело в том, что я могу ежедневно определять структуры десятков белковых молекул, что могло бы помочь зарабатывать типа миллиона евро в день на команду. В таком случае мне было бы нетрудно пожертвовать заработок нескольких дней.

Но для того, чтобы внедрить пикотехнологию и зарабатывать типа миллиона евро в день, нужно оплатить экспертизу NCBI, "международного минздрава", что может стоить от 100 000 до миллиона евро. Зато потом можно будет ежедневно выполнять заказы на миллион евро и даже больше.

Организовать это могут опытные менеджеры. Приглашаю! Уже сегодня все желающие могут ознакомиться с научным докладом по теме "Пикотехнология белков": http://nanoworld.org.ru/topic/301/

Кстати, на эту тему в прошлом году вышла книга: "Пикотехнология белков": http://nanoworld.org.ru/topic/1150/

https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_XL.jpg

26

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 239

For our overseas friends.

Письмо Дидье Маруани от Кушелева

https://www.facebook.com/Didier.Marouan … mp;theater

https://img-fotki.yandex.ru/get/49312/158289418.3de/0_175d47_85219d54_XL.jpg

Alexander Kushelev: It is symbolic foto smile

https://img-fotki.yandex.ru/get/15514/158289418.1a7/0_106b4a_df227d3c_XL.jpg

https://img-fotki.yandex.ru/get/17934/158289418.1a7/0_106b33_6df52d42_XL.jpg
Details: http://nanoworld.org.ru/topic/799/

27

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

https://img-fotki.yandex.ru/get/198998/158289418.3de/0_175d48_76375ea7_XL.png

28

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 242

Письмо Дидье Маруани от Кушелева

Кушелев: Кстати, о птичках...

Один из моих фантастических рассказов начинается с эпиграфа:

"Не хлопай ушами, на этой планете воруют даже птицы!"
Подробнее: http://www.nanoworld.org.ru/data/200511 … 05/059.htm

http://www.nanoworld.org.ru/data/20051104/20060705/erox0000.jpg

http://www.nanoworld.org.ru/data/20051104/20060705/resonat3.gif

29

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 245

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани от Кушелева

Дидье Маруани и Алан Парсон...

Кушелев. Одна из самых известных песен, визитка Space начинается с нот:

H1-C2-E1-A1-

https://img-fotki.yandex.ru/get/174352/158289418.3de/0_175e74_9565f8b7_XL.jpg

Space - Running In The City 1977 HQ: https://www.youtube.com/watch?v=bytEsP5TJ2g

Любопытно, что одна из известных песен Алана Парсона начинается с других нот:

H1-C2-E2-A1-

https://img-fotki.yandex.ru/get/40687/158289418.3de/0_175e75_727e9f08_XL.jpg

Alan Parsons Project - Eye In The Sky: https://www.youtube.com/watch?v=5-41tg_CS7s

Однако аминокислота, которая соответствует ноте ми (E) имеет разветвленный радикал, поэтому может соответствовать сразу двум нотам ми, т.е E1 и E2. При этом разные композиторы могли "услышать" разные ноты аминокислоты Thr.
нота аминокислота
A1    His H
H1    Asn N, Leu L, Asp D,
C2    Ile I
E2    Thr T, Cys C

Ну что же, давайте найдём белок, в состав которого входит аминокислотная последовательность типа:

Asp-Ile-Thr-His или в однобуквенном обозначении D-I-T-H-

Вместо D в последовательности может находиться N или L

Вместо T может быть C

Так что подходят следующие последовательности:

D-I-T-H-
N-I-T-H-
L-I-T-H-
D-I-C-H-
N-I-C-H-
L-I-C-H-

При этом эта последовательность нот у Дидье повторяется. Интересно посмотреть, есть ли белки, в которых такая последовательность аминокислотных остатков тоже повторяется.

Да! Есть такой белок в базе данных: https://www.ncbi.nlm.nih.gov/protein/50 … G6804RZ016

https://img-fotki.yandex.ru/get/48627/158289418.3de/0_175d5f_9949174f_orig.png

Здесь жёлтым цветом отмечены 8 нот из мелодии Дидье Маруани. При этом 4 последних аминокислоты - ноты из мелодии Алана Парсона. Но ... обратите внимание, что 9-я и 10-я аминокислоты L и E совпадают с 5-ой и 6-ой нотами из музыки Алана Парсона.

Другими словами непрерывная последовательность из 10 аминокислотных остатков совпадает с 8 (даже 9!) нотами из музыки Дидье Маруани и с 6 другими(!) нотами из музыки Алана Парсона. Каждое из этих совпадений имеет ничтожную вероятность, а двойное совпадение практически исключено, т.к. невероятно.

Любопытно, что ген принадлежит микроорганизмам, которые обычно живут в симбиозе с человеком. Может ли это означать, что у человека есть возможность "озвучивать" не только собственные гены, но и гены симбионтов?

Нуклеотидная кодирующая последовательность: https://www.ncbi.nlm.nih.gov/nuccore/50292924

https://www.ncbi.nlm.nih.gov/nuccore/50 … port=fasta

>XM_448895.1 Candida glabrata CBS 138 hypothetical protein partial mRNA
ATGTTGCACTCTAAGGATGAGGCTTTTGAAGATCTGCTGAAGCCGGTGTACAAGGGCAAGAAGCTGACCG
ATGAGGTGAACACTGCTGATGACAAGTGGAACTTGCTTCCTGCGTTTTTGAAAGTGAAGGGTCTTGTGAA
GCAGCACCTGGACTCCTTCAATTACTTTGTGGACGTTGACCTGAAGAAGATTATAAAGGCGAACCAGCTG
ATTTTGAGTGATGTCGATCCAGAGTTTTACCTCAAGTACGTGGACATCAGGGTCGGACAACGGTCCGGTA
GTCCCCACAAGGACCAGCTGGTGCCGCCTCATGAGTGTCGGCTGAGAGACATGACATACTCCGCGCCTAT
CTATGTTGATATCGAATACACGAGGGGACGCAACATTATCATGCACAAGAACGTCGAGATAGGTAGAATG
CCTATCATGTTGAGGTCTAACAAGTGTATCCTACATGGAGCTGATGAAAAGATGATGGCTAGGCTGAGCG
AGTGTCCCTTGGATCCAGGTGGCTATTTCATCGTGAACGGTACAGAAAAAGTTATTCTTGTCCAGGAACA
ACTTTCAAAGAATAGAATTATTGTCGAAGCTGATGAAAAGAAAGATATTGTACAAGCATCGGTGACCTCC
TCAACACACGAAAGAAAGTCCAAGACCTATGTTGTCACTAAGAATGGTAAAATCTATCTGAAACATAACT
CTATTGCTGAGGAAGTGCCCATCGTTATTGTATTGAAAGCCGCAGGTATCATTTCCGACTTGGAAATTAT
GCAGTTGGTTTGTGGTAATGATAGTAGTTATCAAGATATATTTTCTGTTAACCTAGAAGAAGCTGCCAAA
TTGAACATATGCACTCAGCAGCAAGCATTAGAATACATCGGTGCTAAGGTAAAGACAATGAGAAGACAGA
AACTGACTATTCTACAAGAAGGTATTGAAGCCATTGCAACCACAATCATTGCTCATTTAACTGTTGAAGC
CCTTGACTTTAGAGAAAAAGCTTTGTACATTGCTACAATGACTAGAAGAGTTGTGATGGCCATGCATAAT
CCAAAAATGGTCGATGATAGAGACTACGTTGGTAACAAGAGATTGGAATTAGCAGGGCAATTAATCTCCC
TTTTGTTTGAAGATTTGTTTAAAAAATTTAACAACGATTTCAAGCTAAGTATCGATAAAGTCTTGAAAAA
GCCTAATAGAGCCATGGAGTACGATGCATTATTGTCCATCAATGTCCATTCAAACAATATCACAAGCGGT
TTAAATAGAGCTATTTCTACTGGTAACTGGTCCTTGAAGAGATTTAAGATGGAAAGGGCTGGTGTCACAC
ATGTTTTATCGAGACTGTCCTATATTTCTGCTTTAGGTATGATGACCAGAATTTCTTCCCAGTTTGAAAA
GTCAAGAAAGGTTTCTGGTCCAAGAGCTTTGCAGCCTTCTCAATTTGGTATGCTATGTACTGCTGATACT
CCAGAAGGTGAAGCGTGTGGTCTAGTTAAGAACTTGGCACTTATGACACATATTACCACTGATGATGAAG
AAGAACCGATTAGAAAATTATGTTACGTTTTAGGTGTTGAACCGATAAGTTTATTGGACAGTGCCTCTCT
TCATTTAAATTACGGTGTGTACCTAAATGGTACACTGATTGGTACTACCAAATTTCCCTCAAATTTTGTT
TCTAGATTTCGTTTCTTAAGAAGAACAGGTAAGGTTTCTGAGTTTATTTCTATATATACAAATGATCATC
ACAATGCCGTCCATATTGCAACTGATGGTGGTAGAATTTGTAGACCATTGATTATTGTTAAGGATGGAAA
ATCGATGGTTGAAGCAGAACACTTAAAGAGATTACTTTCCGGTGAACTTGTTTTTGATGATTTCTTGAAA
TTGGGTTTGGTTGAATACCTTGATGTTAATGAAGAGAATGATTCTTATATTGCACTTTATGAAAAGGATA
TTACGCATGACATTACACATTTGGAAATTGAACCATTTACAGTTTTAGGTGCGGTTGCAGGTTTAATTCC
ATATCCTCATCATAACCAATCTCCAAGAAATACATACCAATGTGCGATGGGTAAGCAAGCCATTGGTGCT
ATTGCATACAATCAATTTAAAAGAATTGATACATTATTGTACTTGATGATATATCCTCAACAGCCTATGG
TGAAGACTAAAACTATTGAGTTAATCGATTATGATAAATTGCCCGCTGGACAAAATGCAACTGTTGCTGT
CATGTCTTATTCCGGTTACGATATTGAAGATGCCTTGGTTTTGAACAAATCATCGATAGATAGAGGTTTT
GGTCGTTGTGAAACGAGGCGTAAAACAACAACTGTGCTAAAGAAATATCCAAACCATACTAAAGATGCAT
TGTGCGGTATGAGAGTTGACGAAAATGGAGAAGCAATTTGGCAACATGAATCTTTAGGTCCTGATGGTCT
AGGTGAAGTCGGATTGAAAATACGAAGTGGTCAAATTTACATTAACAAGTCTGTTCCAGTACAATCCTCT
GATGCCATGGCTGTGAATCAAGCTCAGTATCGTGAGACACCTGTTATATACCGTGCTCCGGAACTATCTA
TTATAGACCAAGTAATGATGTCAACTTCTGATAATGACCAAGACTTGATCAAGGTTTTATTAAGACAAAA
CAGAAGACCGGAGTTGGGTGATAAATTCTCATCTCGTCATGGTCAGAAAGGTGTTTGTGGTATTATTGTA
CAACAAGAAGATATGCCATTCAATGATCAAGGTATTTGTCCAGATATTATTATGAATCCACACGGTTTTC
CTTCTCGTATGACTGTTGGTAAAATGATTGAATTAATTTCTGGTAAAGCAGGTGTTTTGAATGGATCCTT
AGAATACGGTACATGTTTCGGTGGGTCCAAGCTGGAAGATATGTCTAAAATATTAGTAGATCAAGGTTTC
AATTATTCTGGTAAAGACATGTTATATTCTGGTATTACCGGTGAATGTTTGCAAGCTTATATTTTCTTTG
GTCCGATTTACTATCAAAAATTGAAACATATGGTGCTGGATAAAATGCACGCGAGAGCAAGAGGTCCAAG
AGCAGTGCTAACTCGTCAACCAACTGAAGGTAGATCTCGTGATGGTGGTCTAAGATTGGGTGAAATGGAA
AGAGACTGTGTTATTGCATATGGTGCTTCACAGCTTCTTTTGGAGAGATTGATGATTAGTTCAGATGCTT
TTGAGGTTGATGTTTGTAGTAATTGTGGTTTGATGGGTTACAGTGGCTGGTGCTCAACATGTAAGAGTGC
AGAACATATTATCAAGATGACTATTCCATATGCAGCTAAGCTACTATTCCAAGAATTACTTGCCATGAAC
ATTGCACCCAGACTGAGACTGGAAGACATTTTCCAAGAGTGA

https://img-fotki.yandex.ru/get/172272/158289418.3de/0_175d60_24aeea79_XL.png

https://img-fotki.yandex.ru/get/196486/158289418.3de/0_175d61_82f00503_XL.png

https://img-fotki.yandex.ru/get/198786/158289418.3de/0_175d62_c9705111_XL.png

https://img-fotki.yandex.ru/get/47284/158289418.3de/0_175e05_31e825c6_XL.png

https://img-fotki.yandex.ru/get/223280/158289418.3de/0_175e06_65c27445_XL.png

Красным цветом показана последовательность из 9 нот музыки Дидье Маруани. Зелёным цветом показана 6-я нота музыки Алана Парсона. 5 предыдущих нот из этих двух мелодий условно совпадают.

Кстати, предшествующие три ноты (до красных) вполне вписываются в музыку Дидье Маруани и Алана Парсона! Интересно было бы создать композицию, в которую вошли бы все тринадцать нот удивительной гармонии музыки сборки белка Candida glabrata CBS 138

30

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 258

Письмо Дидье Маруани от Кушелева

Dear Didier!

Autotranslation:

There is an idea of new scenery. Static and dynamic fractal mirrors. Moving rays will create rhythmic lighting effects. It is necessary to do a reduced model of the scene and choose the right game for light.

http://nanoworld88.narod.ru/data/164_files/0_2c71f_217fbbf6_L.jpg

http://nanoworld88.narod.ru/data/164_files/0_2c726_ae96f07a_L.png

Details: http://nanoworld88.narod.ru/data/164.htm

Part of the scenery can be rebuilt during the concert, if you use a mirror designer:

http://nanoworld88.narod.ru/data/167_files/0_2ceb0_c553e63b_L.jpg

http://nanoworld88.narod.ru/data/167_files/0_2cebf_8681c8a2_L.jpg

http://nanoworld88.narod.ru/data/167_files/0_2cebf_8681c8a2_L.jpg

http://nanoworld88.narod.ru/data/167_files/0_2ceb3_6f4cf687_L.jpg

http://nanoworld88.narod.ru/data/162_files/0_2b1c9_34ad1cd6_L.png

You can use costumes-cataphytes (fractal color mirrors, plastic):

http://nanoworld88.narod.ru/data/162_files/772009.jpg

http://nanoworld88.narod.ru/data/162_files/0_2b262_d8229f66_L.png

Details: http://nanoworld88.narod.ru/data/162.htm

***
Original (Russian):

Есть идея новых декораций. Статические и динамические фрактальные зеркала. Движущиеся лучи создадут ритмические световые эффекты. Нужно делать уменьшенную модель сцены и выбирать удачные варианты игры света.

http://nanoworld88.narod.ru/data/164_fi … bbf6_L.jpg

http://nanoworld88.narod.ru/data/164_fi … f07a_L.png

Подробнее: http://nanoworld88.narod.ru/data/164.htm

Часть декораций можно перестраивать во время концерта, если использовать зеркальный конструктор:

http://nanoworld88.narod.ru/data/167_fi … e63b_L.jpg

http://nanoworld88.narod.ru/data/167_fi … c8a2_L.jpg

http://nanoworld88.narod.ru/data/167_fi … c8a2_L.jpg

http://nanoworld88.narod.ru/data/167_fi … f687_L.jpg

http://nanoworld88.narod.ru/data/162_fi … 1cd6_L.png

Можно использовать костюмы-катафоты (фрактальные цветные зеркала, пластик):

http://nanoworld88.narod.ru/data/162_files/772009.jpg

http://nanoworld88.narod.ru/data/162_fi … 9f66_L.png

Подробности: http://nanoworld88.narod.ru/data/162.htm

***
Warm wishes,
Your Alexander Kushelev