991

Re: Формы, механизмы, энергия наномира - 85

Kushelev пишет:

Но если народ готов платить за шоу, я готов в этом шоу участвовать

Можно обойтись без шоу, не проблема. Забирайте двигатель Лиманского, который валяется под лестницей в ИКС Сити, и ковыряйте его, пока не наковыряете КПД 500%, как вы хотели.

992

Re: Формы, механизмы, энергия наномира - 85

Формы, механизмы, энергия наномира. Сообщение 85 992

Kushelev пишет:
Kushelev пишет:

Фрактальное ускорение

Завтра я планирую написать музыкальное произведение "Фрактальное ускорение".

Как оно будет звучать, я пока не знаю, но скоро мы это услышим и сможем оценить...

Музыкальный размер произведения 840/8=105

Первая попытка представить в нотах ритмический рисунок произведения "Фрактальное ускорение":

https://img-fotki.yandex.ru/get/225029/158289418.3da/0_175377_fb3a70fe_XL.png

Это сокращённый вариант, т.к. мне пока не удалось разобраться, как в программе задавать текущий размер, например, 7/4 или 7/8 и корректно вводить ноты ударных инструментов.

До мелодии пока не дошло, пока не удалось корректно изобразить ритмический рисунок.

Пока удалось изобразить основную идею: "При смене музыкального размера длина тактов остаётся неизменной".

993

Re: Формы, механизмы, энергия наномира - 85

Денис пишет:
Kushelev пишет:

Но если народ готов платить за шоу, я готов в этом шоу участвовать

Можно обойтись без шоу, не проблема. Забирайте двигатель Лиманского, который валяется под лестницей в ИКС Сити, и ковыряйте его, пока не наковыряете КПД 500%, как вы хотели.

Кушелев: Без финансирования это не имеет смысла.

994

Re: Формы, механизмы, энергия наномира - 85

Формы, механизмы, энергия наномира. Сообщение 85 994

Пикотехнология белков, ДНК, РНК - 2

В темпе коллагена

Ноты, которым больше миллиарда лет!

Музыка сборки коллагена P20908

https://img-fotki.yandex.ru/get/104083/158289418.3da/0_17537c_1641812b_XL.png

https://img-fotki.yandex.ru/get/97201/158289418.3da/0_17537d_219b5269_XL.png

https://img-fotki.yandex.ru/get/195132/158289418.3da/0_17537e_1e85c882_XL.png

https://img-fotki.yandex.ru/get/195132/158289418.3da/0_17537f_2f56e630_XL.png

https://img-fotki.yandex.ru/get/62989/158289418.3da/0_175380_24f7a9b5_XL.png

995

Re: Формы, механизмы, энергия наномира - 85

https://img-fotki.yandex.ru/get/195561/158289418.3da/0_175409_4a4aa0bc_XL.gif
Оригинал: https://img-fotki.yandex.ru/get/195561/ … c_orig.gif

996

Re: Формы, механизмы, энергия наномира - 85

Кушелев:
планирую написать музыкальное произведение "Фрактальное ускорение"

творчество невозможно запланировать.
произведения рождаются только при вдохновении.

997

Re: Формы, механизмы, энергия наномира - 85

Формы, механизмы, энергия наномира. Сообщение 85 997

Пикотехнология белков, ДНК, РНК - 2

Виртуальные "кирпичи" для музыкального плагина программы "Пикотех"

Skype, 2017-03-07:

[13:06:43] Кушелев Александр Юрьевич: Привет! Хорошо бы первую и вторую серию "фасты" обработать новой версией программы, т.е. с крупными символами.
[13:07:18] Кушелев Александр Юрьевич: Ну и конечно же миди-файлы интересно для всех белков вывести.
[13:08:14] Va12220(Valqwa): Сейчас занят. Вечером буду разбираться
[13:11:11] Кушелев Александр Юрьевич: ОК
[13:13:16] Va12220(Valqwa): По миди, ты пока что подумай.
там 7 столбцов. Что такое столбец каждый - я тебе написал.
образец того, как заполняет столбцы неделько - тоже перед тобой.

ты вчера сказал, что совсем не так там все как надо заполнено. попробуй написать - как должно быть заполнено )
а я уж заполню.
[14:40:20] Кушелев Александр Юрьевич: Я же написал, что Неделько всё правильно сделал. Точно так же нужно сделать в твоей программе.
[14:40:41] Кушелев Александр Юрьевич: В программе Неделько я пока ошибок не обнаружил.
[14:41:35] Кушелев Александр Юрьевич: Ты можешь скормить программе Неделько таблицу из 64 триплетов и посмотреть, что за миди-файл она выдаст. Твоя программа должна выдать такой же миди-файл.
[14:54:35] Va12220(Valqwa): Ну расскажи как он сделал )
[14:54:38] Va12220(Valqwa): Не могу
[14:54:59] Va12220(Valqwa): И не хочу смотреть что там внутри наворотил Неделько
[15:48:25] Кушелев Александр Юрьевич: Я не знаю, как он сделал, но я знаю, как увидеть отображение таблицы:
[15:48:49] Кушелев Александр Юрьевич:

00 AAA 66
01 AAC 71
02 AAG 66
03 AAT 71
04 ACA 76
05 ACC 76
06 ACG 76
07 ACT 76
08 AGA 62
09 AGC 81
10 AGG 62
11 AGT 81
12 ATA 72
13 ATC 72
14 ATG 67
15 ATT 72
16 CAA 67
17 CAC 69
18 CAG 67
19 CAT 69
20 CCA 93
21 CCC 93
22 CCG 93
23 CCT 93
24 CGA 62
25 CGC 62
26 CGG 62
27 CGT 62
28 CTA 71
29 CTC 71
30 CTG 71
31 CTT 71
32 GAA 67
33 GAC 71
34 GAG 67
35 GAT 71
36 GCA 93
37 GCC 93
38 GCG 93
39 GCT 93
40 GGA 55
41 GGC 55
42 GGG 55
43 GGT 55
44 GTA 79
45 GTC 79
46 GTG 79
47 GTT 79
48 TAA 115
49 TAC 62
50 TAG 115
51 TAT 62
52 TCA 81
53 TCC 81
54 TCG 81
55 TCT 81
56 TGA 115
57 TGC 76
58 TGG 62
59 TGT 76
60 TTA 71
61 TTC 67
62 TTG 71
63 TTT 67

[15:49:35] Кушелев Александр Юрьевич: Надо просто "скормить" эту таблицу программе Неделько и она сохранит midi-файл. И ты увидишь, что в этом midi-файле должно быть.
[15:51:05] Кушелев Александр Юрьевич: Подготовить тебе файл fasta с таблицей?
[15:55:02] Кушелев Александр Юрьевич: Вот все 64 триплета подряд: AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATTCAACACCAGCATCCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTTGAAGACGAGGATGCAGCCGCGGCTGGAGGCGGGGGTGTAGTCGTGGTTTAATACTAGTATTCATCCTCGTCTTGATGCTGGTGTTTATTCTTGTTT
[15:58:43] Кушелев Александр Юрьевич: Вот файл fasta с таблицей композиционного генетического кода:
[15:58:45] Кушелев Александр Юрьевич: >ENA|TKGK|TKGK Homo sapiens (Kushelev)
AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATTCAACACCAGCAT
CCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTTGAAGACGAGGATGCAGCCGCGGCT
GGAGGCGGGGGTGTAGTCGTGGTTTAATACTAGTATTCATCCTCGTCTTGATGCTGGTGT
TTATTCTTGTTT
[16:04:11] Кушелев Александр Юрьевич: Вариант для программы  Неделько (dne):
[16:04:12] Кушелев Александр Юрьевич: ID   TKGT; Kushelev; linear; mRNA; STD; HUM; 192 BP.
FT   CDS             1..192
     AAAAACAAGA ATACAACCAC GACTAGAAGC AGGAGTATAA TCATGATTCA ACACCAGCAT
     CCACCCCCGC CTCGACGCCG GCGTCTACTC CTGCTTGAAG ACGAGGATGC AGCCGCGGCT
     GGAGGCGGGG GTGTAGTCGT GGTTTAATAC TAGTATTCAT CCTCGTCTTG ATGCTGGTGT
     TTATTCTTGT TT
//
[16:06:40] Кушелев Александр Юрьевич: Вот, вполне разумный миди-файл, который сохранила программа Неделько. Каждая нота соответствует триплету, который подан на вход.
[20:20:20] Кушелев Александр Юрьевич: Кстати, ты можешь по кодам глицина формировать удары в барабан-1 (бас), а по кодам пролина формировать удары в барабан-2 ?
[20:22:35] Кушелев Александр Юрьевич: GGA, GGC, GGG, GGT - Басовый барабан, а CCA, CCC, CCG, CCT - барабан-2

998

Re: Формы, механизмы, энергия наномира - 85

http://globalwave.tv/forum/viewtopic.ph … 827#p23827

искатель пишет:

да ексель моксель , вы спектр отдельного элемента видели?
Это уже аккорд , они как минимум из 3-5 " нот" состоят , только протий это одна красная полоска .
Обратите внимание на углерод .

Кушелев: Собственные частоты радикалов аминокислот лежат в более низкочастотной области. В ней и формируется музыка сборки белковых молекул.

999

Re: Формы, механизмы, энергия наномира - 85

diprospan пишет:

Кушелев:
планирую написать музыкальное произведение "Фрактальное ускорение"

творчество невозможно запланировать.
произведения рождаются только при вдохновении.

Кушелев: Да Вы не переживайте. Вдохновение будет smile

1,000

Re: Формы, механизмы, энергия наномира - 85

Продолжение темы: http://nanoworld.org.ru/topic/1610/