1

Тема: Программирование многоуровневых фракталов в Геноме человека

Формы, механизмы, энергия наномира. Сообщение 94 029

Программирование многоуровневых фракталов в Геноме человека

https://img-fotki.yandex.ru/get/768433/158289418.4bb/0_18a407_6515a742_L.png
Когда выгоднее тактика "шаг вперед, два шага назад"?

Формы, механизмы, энергия наномира. Сообщение 94 022

Фрактальные структурные/архитектурные перевертыши

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-01_01:

Монстр третьей хромосомы

Monster of the third chromosome

>NP_060876.5 fragment
atg
acccctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccat
cccttccgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggt
caggccacctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtca
ctagcacttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccac
aggtcacgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcct
gtcactagcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtat
ccacaggtcacaccacccctcttcatgtcactgatgcttcctcagcatccacaggtcaggccacccctct
tcctgtcaccagcctttcctcagtatccacaggtgacaccacgcctcttcctgtcactagcccttcctca
gcatccacaggtcacgccacccctcttcttgtcaccgacacttcctcagcatccacaggacacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccatcccttc
cgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtcaggcc
acctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtcactagca
cttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccacaggtca
cgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcctgtcact
agcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtatccacag
gtcacaccacccctcttcctgtcaccagcccttcctcagcatctacaggtcacaccacccctcttcctgt
caccgacacttcctcagcatccaaaggtgacaccacccctcttcctgtcaccagcccttcctcagcatct
acaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtgacaccacccctcttc
ctgtcaccaatgcttcctcattatccacaggtcacgccacccctcttcatgtcaccagcccttcctcagc
atccacaggtcacgccacccctcttcctgtcaccagcacttcctcagcatccaccggtcacgccacccct
cttcctgtcaccggcctttcctcagctaccacagatgacaccacccgtcttcctgtcaccgacgtttcct
cggcatccacaggtcaggccacccctcttcctgtcaccagcctttcctcagtatccacaggtgacaccac
gcctcttcctgtcactagcccttcctcagcatccacaggtcacgccagccctcttcttgtcactgacgct
tcctcagcatccacaggtcaggccacccctcttcctgtcaccgacacttcctcagtatccacagctcacg
ccaccccacttcctgtcaccggcctttcttcagcttccacagatgacaccacccgtcttcctgtcaccga
cgtttcctcggcatccacaggtcaggccatccctcttcctgtcaccagcccttcctcagcatccacaggt
gacaccacccctcttcctgtcaccgacgcttcctcagcatccacaggtgacaccacctctcttcctgtca
ccatcccttcctcagcatcttcaggtcacaccacctctcttcctgtcaccgacgcttcctcagtgtccac
aggtcacgccacctctcttcttgtcaccgacgcttcctcagtatccacaggtgacaccacccctcttcct
gtcaccgacactaactcagcatccacaggtgacaccacccctcttcatgtcaccgacgcttcctcagtat
ccacaggtcacgccacctctcttcctgtcaccagcctttcctcagcatccacaggtgacaccacgcctct
tcctgtcactagcccttcctcagcatcctcaggtcacaccacccctcttcctgtcaccgacgcttcctca
gtacccacaggtcacgccacctctcttcctgtcaccgacgcttcctcagtgtccacaggtcacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacaggtcatgccacccctcttccggtcaccgacacttc
ctcagtatctacaggacaggccacccctcttcctgtcaccagcctttcctcagcatccactggtgacacc
acgccgcttcctgtcaccgatacttcctcagcatccacaggtcaggacacccctcttcctgtcaccagcc
tttcctcagtatccacaggtgacaccacgcctcttcctgtcactaacccttcctcagcatccacaggtca
cgccacccctcttcttgtcaccgacgcttcctcaatatccacaggtcacgccacctctcttcttgtcacc
gacgcttcctcagtatccacaggtcacgccaccgctcttcatgacaccgatgcttcctcattatccacag
tga

Результат:

https://img-fotki.yandex.ru/get/508799/158289418.4bc/0_18a503_a013567f_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a504_b4065481_XL.png
Оригинал: https://img-fotki.yandex.ru/get/900241/ … 1_orig.png

3D модель:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a502_98c45a81_XL.png

Кушелев: Мы видим фрагмент "монстра" третьей хромосомы, который по существу является ... фрактальным структурным (архитектурным) перевертышем! Его структура возвращается не только на фрактальном уровне вторичной структуры, но и на фрактальном уровне программной спирали! Тут уже о случайных совпадениях не может быть и речи, т.к. вероятность случайного образования фрактального перевертыша такого размера порядка 4^-900 = 10^-540, т.е. ноль целых и 540 нулей после запятой smile

2

Re: Программирование многоуровневых фракталов в Геноме человека

Формы, механизмы, энергия наномира. Сообщение 94 030

Программирование многоуровневых фракталов в Геноме человека

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 аминокислотных остатков).

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

3

Re: Программирование многоуровневых фракталов в Геноме человека

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 АО)

Скрипт Кушелева, с помощью которого был построен фрагмент "монстра" первой хромосомы человека.

-- Monster of the first human chromosome (fragment. 4500 amino acids)
-- Nanoworld Lab. Alexander Kushelev
-- http://nanoworld.org.ru
p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,3,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,
1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,
4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,
1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,
3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,
1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,
3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,
3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,
1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,
3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,
4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,
3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,
1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,
1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,
3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,
3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,
3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,
1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,
2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,
3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,
3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,
3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,
1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,
3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,
3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,
3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,
2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,
3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,
3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,
1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,
4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,
3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,
1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,
1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,
3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,
2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,
1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,
3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,
2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,
1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,
1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,
1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,
3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,
1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,
3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,
1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,
3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,
1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,
2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,
3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,
3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,
1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,
1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,
1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,
1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,
2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,
1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,
1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,
3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,
3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,
3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,
1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,
3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,
3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,
1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,
1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,
3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,
3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,
3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,
2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,
3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,
3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,
2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,
1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,
3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,
3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,
1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,
3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,
4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,
4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,
1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,
3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,
1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,
1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,
1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,
1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,
3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,4,4,1,3,4,3,1,3,3,1,3,1,1,2,4,3,2,3,3,3,
3,4,2,1,1,3,3,2,3,1,2,1,1,1,1,3,3,4,3,1,2,3,1,3,1,1,1,1,1,1,3,1,4,1,3,1,3,3,3,1,4,4,2,3,1,1,4,4,1,1,
1,2,1,2,1,2,3,0)
peptide = box length:1 width:1 height:1  position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 4500 do(
element = box length:1 width:1 height:1 pos:[0,0,0]; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

4

Re: Программирование многоуровневых фракталов в Геноме человека

Программирование многоуровневых фракталов в Геноме человека

Что такое программа "Пикотехнология белков", и как её грамотно использовать?

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 033

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 АО)

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

Кушелев: 3D модель "монстра" первой хромосомы хороша тем, что её можно проверить, рассматривая молекулу белка в подходящий микроскоп. Дело в том, что "Монстр" первой хромосомы такой крупный, что его просто видно в микроскоп в отличие от мелких белков. В частности, диаметр начальной фрактальной петли (правая часть) примерно 100 нанометров,  т.е. 0.1 микрона. Такие объекты можно увидеть даже в флуоресцентный микроскоп.

5

Re: Программирование многоуровневых фракталов в Геноме человека

Формы, механизмы, энергия наномира. Сообщение 94 081

3D модель "монстра" первой хромосомы (5207 АО)

https://img-fotki.yandex.ru/get/476282/158289418.4bc/0_18a56a_5930b399_orig.gif

Скрипт Кушелева, с помощью которого был построен фрагмент "монстра" первой хромосомы человека.

-- Monster of the first human chromosome (5207 amino acids)
-- Nanoworld Lab. Alexander Kushelev
-- http://nanoworld.org.ru
p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,3,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,
1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,
4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,
1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,
3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,
1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,
3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,
3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,
1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,
3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,
4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,
3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,
1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,
1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,
3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,
3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,
3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,
1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,
2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,
3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,
3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,
3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,
1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,
3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,
3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,
3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,
2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,
3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,
3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,
1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,
4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,
3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,
1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,
1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,
3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,
2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,
1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,
3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,
2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,
1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,
1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,
1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,
3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,
1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,
3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,
1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,
3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,
1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,
2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,
3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,
3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,
1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,
1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,
1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,
1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,
2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,
1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,
1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,
3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,
3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,
3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,
1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,
3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,
3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,
1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,
1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,
3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,
3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,
3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,
2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,
3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,
3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,
2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,
1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,
3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,
3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,
1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,
3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,
4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,
4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,
1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,
3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,
1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,
1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,
1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,
1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,
3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,4,4,1,3,4,3,1,3,3,1,3,1,1,2,4,3,2,3,3,3,
3,4,2,1,1,3,3,2,3,1,2,1,1,1,1,3,3,4,3,1,2,3,1,3,1,1,1,1,1,1,3,1,4,1,3,1,3,3,3,1,4,4,2,3,1,1,4,4,1,1,
1,2,1,2,1,2,3,0)
peptide = box length:1 width:1 height:1  position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 4500 do(
element = box length:1 width:1 height:1 pos:[0,0,0]; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

https://img-fotki.yandex.ru/get/373339/158289418.4bb/0_18a3fa_79817ce3_XL.png
Оригинал: https://img-fotki.yandex.ru/get/373339/ … 3_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/370744/158289418.4bc/0_18a569_fd9446b9_XL.png
0.25 от оригинала: https://img-fotki.yandex.ru/get/370744/ … 9_orig.png
Оригинал: https://cloud.mail.ru/public/8gC2/mkhM3wWW4

https://img-fotki.yandex.ru/get/9494/158289418.4bc/0_18a589_4694862e_orig.gif

Настройки одного из 5 композиционных углов по одной из трёх составляющих заняла около двух часов:

https://img-fotki.yandex.ru/get/371487/158289418.4bc/0_18a588_ce47e849_orig.gif
Настройка 5 композиционных углов по 3 составляющим может занять около 30 часов. Однако это не имеет смысла, т.к. в реальном белке композиционные и транспозиционные (это ещё столько столько же степеней свободы) на разных участках белка разные. А третий угол Pro - ещё одна степень свободы, которая без учета физико-химических взаимодействий тоже представляет собой неопределенность.