31

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 031

Готовится 642-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

642 Программирование многоуровневых фракталов в Геноме человека
Фрактальные структурные/архитектурные перевертыши
3D модель "монстра" первой хромосомы (фрагмент, первые 4500 аминокислотных остатков).

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a502_98c45a81_XL.png

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

32

Re: Формы, механизмы, энергия наномира - 94

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 АО)

Скрипт Кушелева, с помощью которого был построен фрагмент "монстра" первой хромосомы человека.

-- Monster of the first human chromosome (fragment. 4500 amino acids)
-- Nanoworld Lab. Alexander Kushelev
-- http://nanoworld.org.ru
p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,3,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,
1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,
4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,
1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,
3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,
1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,
3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,
3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,
1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,
3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,
4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,
3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,
1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,
1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,
3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,
3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,
3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,
1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,
2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,
3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,
3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,
3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,
1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,
3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,
3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,
3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,
2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,
3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,
3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,
1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,
4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,
3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,
1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,
1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,
3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,
2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,
1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,
3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,
2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,
1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,
1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,
1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,
3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,
1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,
3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,
1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,
3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,
1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,
2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,
3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,
3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,
1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,
1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,
1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,
1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,
2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,
1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,
1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,
3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,
3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,
3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,
1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,
3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,
3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,
1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,
1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,
3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,
3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,
3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,
2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,
3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,
3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,
2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,
1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,
3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,
3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,
1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,
3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,
4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,
4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,
1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,
3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,
1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,
1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,
1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,
1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,
3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,4,4,1,3,4,3,1,3,3,1,3,1,1,2,4,3,2,3,3,3,
3,4,2,1,1,3,3,2,3,1,2,1,1,1,1,3,3,4,3,1,2,3,1,3,1,1,1,1,1,1,3,1,4,1,3,1,3,3,3,1,4,4,2,3,1,1,4,4,1,1,
1,2,1,2,1,2,3,0)
peptide = box length:1 width:1 height:1  position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 4500 do(
element = box length:1 width:1 height:1 pos:[0,0,0]; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

33

Re: Формы, механизмы, энергия наномира - 94

Программирование многоуровневых фракталов в Геноме человека

Что такое программа "Пикотехнология белков", и как её грамотно использовать?

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 033

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 АО)

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

Кушелев: 3D модель "монстра" первой хромосомы хороша тем, что её можно проверить, рассматривая молекулу белка в подходящий микроскоп. Дело в том, что "Монстр" первой хромосомы такой крупный, что его просто видно в микроскоп в отличие от мелких белков. В частности, диаметр начальной фрактальной петли (правая часть) примерно 100 нанометров,  т.е. 0.1 микрона. Такие объекты можно увидеть даже в флуоресцентный микроскоп.

34

Re: Формы, механизмы, энергия наномира - 94

https://postnauka.ru/faq/33813

Цитата:  предел разрешения, достигнутый методом STED, составляет около 40 нм.
Конец цитаты.

Кушелев: А диаметр петри "монстра" первой хромосомы порядка 100 нм. Теперь можно убедиться в работоспособности пикотехнологии минуя РСА, т.е. с помощью флуоресцентного микроскопа, разглядывая "монстров" (крупнейшие белки, закодированные в геноме человека и других организмов) smile

35

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 035

Online service PROTEIN PICOTECHNOLOGY

http://photobiology.info/Zimmer.html

Посмотрим структуру этого белка: http://www.rcsb.org/pdb/explore/explore … ureId=1GFL

Заказ 2018-01-01_02:

http://www.uniprot.org/uniprot/P42212

https://www.ebi.ac.uk/ena/data/view/AAA27722

>ENA|AAA27722|AAA27722.1 Aequorea victoria green-fluorescent protein
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGT
GATGTTAATGGGCACAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGA
AAACTTACCCTTAAATTTATTTGCACTACTGGAAAGCTACCTGTTCCATGGCCAACACTT
GTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAG
CATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTAC
AAAGATGACGGGAACTACAAATCACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTCGTT
AATAGAATTGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAA
ATGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGA
ATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGAC
CATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC
CTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTT
CTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA

Результат:

https://img-fotki.yandex.ru/get/3505/158289418.4bc/0_18a506_82c928b_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/877700/158289418.4bc/0_18a507_b7b98b9d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/877700/ … d_orig.png

А что за структуру показал РСА за 10 000 евро?

https://img-fotki.yandex.ru/get/896349/158289418.4bc/0_18a508_f1a8196d_XL.png

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a509_3c3933aa_orig.png

Кушелев: Вполне коррелирует. Не только угадали  тип белка, но и процент альфа-310-спиральных участков! Однако Пикотех позволила получить эту структуру в миллиард раз быстрее smile

Специалисты приняли пи-спиральные участки и участки программной 35-спирали за "бета-тяжи", но это уже мелочи wink

36

Re: Формы, механизмы, энергия наномира - 94

Kushelev пишет:

https://postnauka.ru/faq/33813

Цитата:  предел разрешения, достигнутый методом STED, составляет около 40 нм.
Конец цитаты.

Кушелев: А диаметр петри "монстра" первой хромосомы порядка 100 нм. Теперь можно убедиться в работоспособности пикотехнологии минуя РСА, т.е. с помощью флуоресцентного микроскопа, разглядывая "монстров" (крупнейшие белки, закодированные в геноме человека и других организмов) smile


Четвёртый способ проверки Пикотехнологии.

Александр Юрьевич, а АСМ?

37

Re: Формы, механизмы, энергия наномира - 94

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 94 035

Online service PROTEIN PICOTECHNOLOGY

http://photobiology.info/Zimmer.html

Посмотрим структуру этого белка: http://www.rcsb.org/pdb/explore/explore … ureId=1GFL

Заказ 2018-01-01_02:

http://www.uniprot.org/uniprot/P42212



https://www.ebi.ac.uk/ena/data/view/AAA27722

>ENA|AAA27722|AAA27722.1 Aequorea victoria green-fluorescent protein
ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGT
GATGTTAATGGGCACAAATTCTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGA
AAACTTACCCTTAAATTTATTTGCACTACTGGAAAGCTACCTGTTCCATGGCCAACACTT
GTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCAAGATACCCAGATCATATGAAACAG
CATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTAC
AAAGATGACGGGAACTACAAATCACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTCGTT
AATAGAATTGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAA
ATGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGA
ATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGAC
CATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC
CTGTCCACACAATCTGCCCTTTCCAAAGATCCCAACGAAAAGAGAGATCACATGATCCTT
CTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA

Результат:

https://img-fotki.yandex.ru/get/3505/158289418.4bc/0_18a506_82c928b_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/877700/158289418.4bc/0_18a507_b7b98b9d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/877700/ … d_orig.png

А что за структуру показал РСА за 10 000 евро?

https://img-fotki.yandex.ru/get/896349/158289418.4bc/0_18a508_f1a8196d_XL.png

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a509_3c3933aa_orig.png

Кушелев: Вполне коррелирует. Не только угадали  тип белка, но и процент альфа-310-спиральных участков! Однако Пикотех позволила получить эту структуру в миллиард раз быстрее smile

Специалисты приняли пи-спиральные участки и участки программной 35-спирали за "бета-тяжи", но это уже мелочи wink


То что нужно. Побольше таких примеров пожалуйста!

38

Re: Формы, механизмы, энергия наномира - 94

Kushelev пишет:
Татьяна Рясина пишет:

Это очень интересно.

Кушелев: Вы забыли задать главный вопрос: "Зачем нужны структурные/архитектурные перевертыши"?

Зачем возвращаться по той же траектории назад? Шли бы себе и шли вперед...


Да, зачем нужно возвращаться?

39

Re: Формы, механизмы, энергия наномира - 94

https://img-fotki.yandex.ru/get/878590/158289418.4bc/0_18a560_2af46fb6_XL.png
Подбираю аккомпанемент к музыке белка...

40

Re: Формы, механизмы, энергия наномира - 94

Татьяна Рясина пишет:
Kushelev пишет:
Татьяна Рясина пишет:

Это очень интересно.

Кушелев: Вы забыли задать главный вопрос: "Зачем нужны структурные/архитектурные перевертыши"?

Зачем возвращаться по той же траектории назад? Шли бы себе и шли вперед...


Да, зачем нужно возвращаться?

Интересно, сможет ли кто-нибудь догадаться? Если не получится, то можно прочесть ответ в рассылке. Её легко найти через Гугл по словам "Кушелев" и "перевертыш"