21

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 011

Готовится 642-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

642 Фрактальные структурные/архитектурные перевертыши

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a502_98c45a81_XL.png

22

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 022

Фрактальные структурные/архитектурные перевертыши

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-01_01:

Монстр третьей хромосомы

Monster of the third chromosome

>NP_060876.5 fragment
atg
acccctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccat
cccttccgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggt
caggccacctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtca
ctagcacttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccac
aggtcacgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcct
gtcactagcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtat
ccacaggtcacaccacccctcttcatgtcactgatgcttcctcagcatccacaggtcaggccacccctct
tcctgtcaccagcctttcctcagtatccacaggtgacaccacgcctcttcctgtcactagcccttcctca
gcatccacaggtcacgccacccctcttcttgtcaccgacacttcctcagcatccacaggacacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccatcccttc
cgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtcaggcc
acctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtcactagca
cttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccacaggtca
cgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcctgtcact
agcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtatccacag
gtcacaccacccctcttcctgtcaccagcccttcctcagcatctacaggtcacaccacccctcttcctgt
caccgacacttcctcagcatccaaaggtgacaccacccctcttcctgtcaccagcccttcctcagcatct
acaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtgacaccacccctcttc
ctgtcaccaatgcttcctcattatccacaggtcacgccacccctcttcatgtcaccagcccttcctcagc
atccacaggtcacgccacccctcttcctgtcaccagcacttcctcagcatccaccggtcacgccacccct
cttcctgtcaccggcctttcctcagctaccacagatgacaccacccgtcttcctgtcaccgacgtttcct
cggcatccacaggtcaggccacccctcttcctgtcaccagcctttcctcagtatccacaggtgacaccac
gcctcttcctgtcactagcccttcctcagcatccacaggtcacgccagccctcttcttgtcactgacgct
tcctcagcatccacaggtcaggccacccctcttcctgtcaccgacacttcctcagtatccacagctcacg
ccaccccacttcctgtcaccggcctttcttcagcttccacagatgacaccacccgtcttcctgtcaccga
cgtttcctcggcatccacaggtcaggccatccctcttcctgtcaccagcccttcctcagcatccacaggt
gacaccacccctcttcctgtcaccgacgcttcctcagcatccacaggtgacaccacctctcttcctgtca
ccatcccttcctcagcatcttcaggtcacaccacctctcttcctgtcaccgacgcttcctcagtgtccac
aggtcacgccacctctcttcttgtcaccgacgcttcctcagtatccacaggtgacaccacccctcttcct
gtcaccgacactaactcagcatccacaggtgacaccacccctcttcatgtcaccgacgcttcctcagtat
ccacaggtcacgccacctctcttcctgtcaccagcctttcctcagcatccacaggtgacaccacgcctct
tcctgtcactagcccttcctcagcatcctcaggtcacaccacccctcttcctgtcaccgacgcttcctca
gtacccacaggtcacgccacctctcttcctgtcaccgacgcttcctcagtgtccacaggtcacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacaggtcatgccacccctcttccggtcaccgacacttc
ctcagtatctacaggacaggccacccctcttcctgtcaccagcctttcctcagcatccactggtgacacc
acgccgcttcctgtcaccgatacttcctcagcatccacaggtcaggacacccctcttcctgtcaccagcc
tttcctcagtatccacaggtgacaccacgcctcttcctgtcactaacccttcctcagcatccacaggtca
cgccacccctcttcttgtcaccgacgcttcctcaatatccacaggtcacgccacctctcttcttgtcacc
gacgcttcctcagtatccacaggtcacgccaccgctcttcatgacaccgatgcttcctcattatccacag
tga

Результат:

https://img-fotki.yandex.ru/get/508799/158289418.4bc/0_18a503_a013567f_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a504_b4065481_XL.png
Оригинал: https://img-fotki.yandex.ru/get/900241/ … 1_orig.png

3D модель:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a502_98c45a81_XL.png

Кушелев: Мы видим фрагмент "монстра" третьей хромосомы, который по существу является ... фрактальным структурным (архитектурным) перевертышем! Его структура возвращается не только на фрактальном уровне вторичной структуры, но и на фрактальном уровне программной спирали! Тут уже о случайных совпадениях не может быть и речи, т.к. вероятность случайного образования фрактального перевертыша такого размера порядка 4^-900 = 10^-540, т.е. ноль целых и 540 нулей после запятой smile

23

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 023

Фрактальные структурные/архитектурные перевертыши

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:

Александр Юрьевич,
что означает фрактальный перевёртыш
структурный перевёртыш
Что относительно чего перевёрнуто?
Что значит, что структура возвращается
на уровне вторичной структуры
на фрактальном уровне программной спирали

Что там имеет свойство фрактальности?
Фрактальность - самоподобие?

Что самоподобно чему?

Как Вы сделали эту 3D  структуру?
Она сделана из программных спиралей?

Суставы есть в этом фрагменте белка?

Для МФТИ сделаете 3D&

Кушелев: Знакомиться с фрактальными структурными/архитектурными перевертышами нужно постепенно.

Сначала узнать, что такое перевертыш вообще. Это когда что-то переворачивается с сохранением некого свойства. В случае структурного перевертыша вторая половина структуры возвращается к началу первой. Представьте, что Вы прошли половину некоторого маршрута, развернулись и вернулись обратно практически по той же траектории. Это я называю структурным перевертышем белковой структуры. В отличие от маршрута на плоской поверхности, траектория вторичной структуры белка пролегает в пространстве, образуя 3D структуру. Поэтому возвращение вдоль 3D траектории - более сложная задача. чем возвращение вдоль плоской траектории. Тем не менее во многих белках это происходит. Причём реализуется просто. Реверсом композиционных кодов. Этот метод одинаково хорошо работает и на плоскости, и в пространстве. На плоскости его легко представить последовательностью команд: Прямо, налево, направо, кругом. Если первая половина задана последовательностью: прямо, прямо, прямо, налево, прямо, направо, прямо, прямо, то вторая половина перевертыша должна быть задана командами: кругом, прямо, прямо, налево, прямо, направо, прямо, прямо, прямо. В случае 3D-траектории достаточно реверсировать последовательность композиционных кодов. Например,

http://nanoworld88.narod.ru/data/210_files/0_480df_c1431c83_orig.gif
Подробнее: http://nanoworld88.narod.ru/data/210.htm

Нюансом структурных перевертышей белков является набор композиционных кодов для команды "кругом". Одним из таких наборов является последовательность кодов 131. Подробнее: http://www.nanoworld.org.ru/data/01/dat … 000509.htm

http://www.nanoworld.org.ru/data/01/data/images/slides/f&m/188.jpg http://www.nanoworld.org.ru/data/01/data/images/slides/f&m/187.jpg

Далее от простых перевертышей можно переходить к фрактальным. Для этого нужно ознакомиться с программными спиралями, которые по существу являются фрактализацией фундаментальных спиралей белков.

Что касается самоподобия фракталов, то нетрудно увидеть, что программные спирали подобны фундаментальным. Это спирали, состоящие из спиральных элементов. Программные спирали могут иметь неограниченное число фрактальных уровней. Реальные белки естественно имеют ограничение, которое можно назвать рекордным значением числа фрактальных уровней в геноме данного организма.

24

Re: Формы, механизмы, энергия наномира - 94

Skype:

[28.12.2017 9:50:08] Кушелев Александр Юрьевич: Добрый день! Мне удалось определить структуры всех белков человека: http://nanoworld.org.ru/topic/1887/
Новогодний подарок человечеству. С помощью рентгеноструктурного анализа это невозможно даже за триллион долларов и миллион лет. smile
[13:25:47] Andrei: не факт что структура таковая и есть и это не сказка про серого бычка smile
[13:26:03] Andrei: никто же не может доказать и подтвердить из научного мира...
[13:49:29] Кушелев Александр Юрьевич: Вы забываете, что пикотехнология проверена тремя независимыми способами, в т.ч. обнаружена сильная корреляция с данными РСА. Второй способ - самоповерка на структурах с дисульфидными  мостиками, которые обнаруживаются и без РСА. Третий способ - обнаружение сверхдлинных фундаментальных и программных спиралей и перевертышей. В том числе фрактальных: http://nanoworld.org.ru/topic/1890/
[13:50:06] Кушелев Александр Юрьевич: На уровне фрактальных перевертышей вероятность случайности порядка 10^-540, т.е. ноль и 540 нулей после запятой.
[13:50:09] Andrei: сильная корреляция это сколько процентов?
[13:51:00] Кушелев Александр Юрьевич: Для белков с хорошо изученной структурой (разными экспериментальными методами) корреляция с данными программы Пикотех доходит до 100%
[13:51:31] Andrei: так ведь нет ни одного ученого ктобы подтвердил...
[13:51:48] Кушелев Александр Юрьевич: А для белков с плохо изученной структурой при достаточной выборке корреляция всё равно имеет достоверность.
[13:52:16] Кушелев Александр Юрьевич: Что значит "нет  ни одного ученого"? Вы рецензии профессоров к книге "Пикотехнология белков" читали?
[13:52:53] Кушелев Александр Юрьевич: http://nanoworld.org.ru/topic/1150/

25

Re: Формы, механизмы, энергия наномира - 94

[13:53:33] Andrei: нужно не книга и экспертное заключение
[13:54:29] Andrei: например научная статья опубликованная в известном журнале
[13:54:49] Andrei: но почему научные журналы такую статью не хотят печатать...
[13:59:18] Кушелев Александр Юрьевич: Вы пишите незнамо что. В книге "Пикотехнология белков" приведены результаты статистического анализа. Стандартная методика показала достоверную корреляцию данных Пикотех и РСА. Рецензии профессоров как раз и являются экспертными заключениями, подтверждающими, что анализ проведен грамотно. Что касается названия журнала, что при наличии рецензий название журнала уже не имеет значения. Тем более, что это книга, поэтому в журнале такой объем не публикуется к Вашему сведению. Вы перепутали книгу со статьёй smile

26

Re: Формы, механизмы, энергия наномира - 94

[14:00:12] Andrei: ну будем надеятся что так smile
[14:00:25] Andrei: что-то пока что никто не верит этой книге
[14:02:25] Кушелев Александр Юрьевич: В науке верить не принято. На данном этапе менеджеры работают над тем, чтобы ознакомить со структурами всех белков человека максимальное количество специалистов, интересующихся структурами белков. Как только специалисты "распробуют" результаты новой технологии, начнётся бум пикотехнологии. А те, кто стоят в сторонке и наблюдают, окажутся не у дел smile

27

Re: Формы, механизмы, энергия наномира - 94

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 94 023

Фрактальные структурные/архитектурные перевертыши

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:

Александр Юрьевич,
что означает фрактальный перевёртыш
структурный перевёртыш
Что относительно чего перевёрнуто?
Что значит, что структура возвращается
на уровне вторичной структуры
на фрактальном уровне программной спирали

Что там имеет свойство фрактальности?
Фрактальность - самоподобие?

Что самоподобно чему?

Как Вы сделали эту 3D  структуру?
Она сделана из программных спиралей?

Суставы есть в этом фрагменте белка?

Для МФТИ сделаете 3D&

Кушелев: Знакомиться с фрактальными структурными/архитектурными перевертышами нужно постепенно.

Сначала узнать, что такое перевертыш вообще. Это когда что-то переворачивается с сохранением некого свойства. В случае структурного перевертыша вторая половина структуры возвращается к началу первой. Представьте, что Вы прошли половину некоторого маршрута, развернулись и вернулись обратно практически по той же траектории. Это я называю структурным перевертышем белковой структуры. В отличие от маршрута на плоской поверхности, траектория вторичной структуры белка пролегает в пространстве, образуя 3D структуру. Поэтому возвращение вдоль 3D траектории - более сложная задача. чем возвращение вдоль плоской траектории. Тем не менее во многих белках это происходит. Причём реализуется просто. Реверсом композиционных кодов. Этот метод одинаково хорошо работает и на плоскости, и в пространстве. На плоскости его легко представить последовательностью команд: Прямо, налево, направо, кругом. Если первая половина задана последовательностью: прямо, прямо, прямо, налево, прямо, направо, прямо, прямо, то вторая половина перевертыша должна быть задана командами: кругом, прямо, прямо, налево, прямо, направо, прямо, прямо, прямо. В случае 3D-траектории достаточно реверсировать последовательность композиционных кодов. Например,

http://nanoworld88.narod.ru/data/210_files/0_480df_c1431c83_orig.gif
Подробнее: http://nanoworld88.narod.ru/data/210.htm

Нюансом структурных перевертышей белков является набор композиционных кодов для команды "кругом". Одним из таких наборов является последовательность кодов 131. Подробнее: http://www.nanoworld.org.ru/data/01/dat … 000509.htm

http://www.nanoworld.org.ru/data/01/data/images/slides/f&m/188.jpg http://www.nanoworld.org.ru/data/01/data/images/slides/f&m/187.jpg

Далее от простых перевертышей можно переходить к фрактальным. Для этого нужно ознакомиться с программными спиралями, которые по существу являются фрактализацией фундаментальных спиралей белков.

Что касается самоподобия фракталов, то нетрудно увидеть, что программные спирали подобны фундаментальным. Это спирали, состоящие из спиральных элементов. Программные спирали могут иметь неограниченное число фрактальных уровней. Реальные белки естественно имеют ограничение, которое можно назвать рекордным значением числа фрактальных уровней в геноме данного организма.

Это очень интересно.

28

Re: Формы, механизмы, энергия наномира - 94

Татьяна Рясина пишет:

Это очень интересно.

Кушелев: Вы забыли задать главный вопрос: "Зачем нужны структурные/архитектурные перевертыши"?

Зачем возвращаться по той же траектории назад? Шли бы себе и шли вперед...

29

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 029

Программирование многоуровневых фракталов в Геноме человека

https://img-fotki.yandex.ru/get/768433/158289418.4bb/0_18a407_6515a742_L.png
Когда выгоднее тактика "шаг вперед, два шага назад"?

Формы, механизмы, энергия наномира. Сообщение 94 022

Фрактальные структурные/архитектурные перевертыши

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-01_01:

Монстр третьей хромосомы

Monster of the third chromosome

>NP_060876.5 fragment
atg
acccctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccat
cccttccgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggt
caggccacctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtca
ctagcacttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccac
aggtcacgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcct
gtcactagcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtat
ccacaggtcacaccacccctcttcatgtcactgatgcttcctcagcatccacaggtcaggccacccctct
tcctgtcaccagcctttcctcagtatccacaggtgacaccacgcctcttcctgtcactagcccttcctca
gcatccacaggtcacgccacccctcttcttgtcaccgacacttcctcagcatccacaggacacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccatcccttc
cgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtcaggcc
acctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtcactagca
cttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccacaggtca
cgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcctgtcact
agcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtatccacag
gtcacaccacccctcttcctgtcaccagcccttcctcagcatctacaggtcacaccacccctcttcctgt
caccgacacttcctcagcatccaaaggtgacaccacccctcttcctgtcaccagcccttcctcagcatct
acaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtgacaccacccctcttc
ctgtcaccaatgcttcctcattatccacaggtcacgccacccctcttcatgtcaccagcccttcctcagc
atccacaggtcacgccacccctcttcctgtcaccagcacttcctcagcatccaccggtcacgccacccct
cttcctgtcaccggcctttcctcagctaccacagatgacaccacccgtcttcctgtcaccgacgtttcct
cggcatccacaggtcaggccacccctcttcctgtcaccagcctttcctcagtatccacaggtgacaccac
gcctcttcctgtcactagcccttcctcagcatccacaggtcacgccagccctcttcttgtcactgacgct
tcctcagcatccacaggtcaggccacccctcttcctgtcaccgacacttcctcagtatccacagctcacg
ccaccccacttcctgtcaccggcctttcttcagcttccacagatgacaccacccgtcttcctgtcaccga
cgtttcctcggcatccacaggtcaggccatccctcttcctgtcaccagcccttcctcagcatccacaggt
gacaccacccctcttcctgtcaccgacgcttcctcagcatccacaggtgacaccacctctcttcctgtca
ccatcccttcctcagcatcttcaggtcacaccacctctcttcctgtcaccgacgcttcctcagtgtccac
aggtcacgccacctctcttcttgtcaccgacgcttcctcagtatccacaggtgacaccacccctcttcct
gtcaccgacactaactcagcatccacaggtgacaccacccctcttcatgtcaccgacgcttcctcagtat
ccacaggtcacgccacctctcttcctgtcaccagcctttcctcagcatccacaggtgacaccacgcctct
tcctgtcactagcccttcctcagcatcctcaggtcacaccacccctcttcctgtcaccgacgcttcctca
gtacccacaggtcacgccacctctcttcctgtcaccgacgcttcctcagtgtccacaggtcacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacaggtcatgccacccctcttccggtcaccgacacttc
ctcagtatctacaggacaggccacccctcttcctgtcaccagcctttcctcagcatccactggtgacacc
acgccgcttcctgtcaccgatacttcctcagcatccacaggtcaggacacccctcttcctgtcaccagcc
tttcctcagtatccacaggtgacaccacgcctcttcctgtcactaacccttcctcagcatccacaggtca
cgccacccctcttcttgtcaccgacgcttcctcaatatccacaggtcacgccacctctcttcttgtcacc
gacgcttcctcagtatccacaggtcacgccaccgctcttcatgacaccgatgcttcctcattatccacag
tga

Результат:

https://img-fotki.yandex.ru/get/508799/158289418.4bc/0_18a503_a013567f_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a504_b4065481_XL.png
Оригинал: https://img-fotki.yandex.ru/get/900241/ … 1_orig.png

3D модель:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a502_98c45a81_XL.png

Кушелев: Мы видим фрагмент "монстра" третьей хромосомы, который по существу является ... фрактальным структурным (архитектурным) перевертышем! Его структура возвращается не только на фрактальном уровне вторичной структуры, но и на фрактальном уровне программной спирали! Тут уже о случайных совпадениях не может быть и речи, т.к. вероятность случайного образования фрактального перевертыша такого размера порядка 4^-900 = 10^-540, т.е. ноль целых и 540 нулей после запятой smile

30

Re: Формы, механизмы, энергия наномира - 94

Формы, механизмы, энергия наномира. Сообщение 94 030

Программирование многоуровневых фракталов в Геноме человека

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 аминокислотных остатков).

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif