741

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 650

Online service PROTEIN PICOTECHNOLOGY

Комплексный заказ (2611 структур) 2017-12-15_01:

https://cloud.mail.ru/public/B91Q/kuvHX6Upf

Результат:

https://cloud.mail.ru/public/6ajp/u2HrSUyAo

Посмотрим наиболее интересные структуры...

https://img-fotki.yandex.ru/get/893904/158289418.4b2/0_18949a_23fa116_orig.png

https://img-fotki.yandex.ru/get/3914/158289418.4b2/0_18949b_bdc616d9_orig.png

https://img-fotki.yandex.ru/get/5202/158289418.4b2/0_18949f_86e0f151_orig.png

https://img-fotki.yandex.ru/get/894110/158289418.4b2/0_1894a0_9e32aa02_orig.png

https://img-fotki.yandex.ru/get/28032/158289418.4b2/0_1894bc_94be5bc5_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/872132/158289418.4b2/0_1894bd_50bea670_XL.png
Оригинал: https://img-fotki.yandex.ru/get/872132/ … 0_orig.png

https://img-fotki.yandex.ru/get/9088/158289418.4b2/0_1894d8_9360d66e_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/893904/158289418.4b2/0_1894d9_2e902e5c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/893904/ … c_orig.png

https://img-fotki.yandex.ru/get/4912/158289418.4b3/0_1894ed_2fdc7478_orig.png
Так идет поиск интересных структур из набора в 2611. Смотрим то, что подчеркнуто красной чертой:

https://img-fotki.yandex.ru/get/872132/158289418.4b3/0_1894f5_845107d0_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/872132/158289418.4b3/0_1894f6_85179d93_XL.png
Оригинал: https://img-fotki.yandex.ru/get/872132/ … 3_orig.png

Интересное сочетание программной 5323-спирали с длинной пи-спиралью.

742

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 666

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-16_01:

Фиброин шелка

http://www.uniprot.org/uniprot/P05790

https://www.ebi.ac.uk/ena/data/view/AAB … play=fasta

>ENA|AAB31861|AAB31861.1 Bombyx mori (domestic silkworm) silk fibroin heavy chain
GCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCGGCTAC
GAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGCTCA
GGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATAC
GGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGAAGCGGAGTT
GCCTCTGGTGCCGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCCGGTGCT
GGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCA
GGTGCTGGTGCTGGATACGGAGCAGGAGCTGGATACGGAGCTGGTGCTGGATACGGAGCA
GGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGATAC
GGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCC
GGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCT
GGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCA
GGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATAC
GGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCT
GGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCA
GGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCT
GGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGATACGGAGCAGGTGCAGGAGCA
GGCGTTGGATACGGAGCAGGAGCTGGAGCTGGATACGGAGCAGGTTATGGATACGGAGCA
GGAGCTGGCGTTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCT
GGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCA
GGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCT
GGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTT
GGATACGGAGCAGGATATGGAGTAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGC
GGAGCTGCCTCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCT
GGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGAGCT
GGTGCTGGATACGGAGCAGGAGCAGGAAGTGGAGCTGCCTCTGGTGCTGGTGCTGGAGCT
GGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCAGA
CGTGAAGGCTACGAATACGCTTGGTCGTCAAAATCTGACTTTGAAACTGGAAGCGGTGCT
GCCTCTGGTGCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCT
GGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTGGTAGCGTCAGTTACGGAGCT
GGCAGGGGATACGGACAAGGTGCAGGAAGTGCAGCTTCCTCTGTGTCATCTGCTTCATCT
CGCAGTTACGACTATTCTCGTCGTAACGTCCGCAAAAACTGTGGAATTCCTAGAAGACAA
CTAGTTGTTAAATTCAGAGCACTGCCTTGTGTGAATTGCTAA

Результат:

https://img-fotki.yandex.ru/get/880375/158289418.4b3/0_18955a_6302b653_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/880375/158289418.4b3/0_18955b_2038cbe9_XL.png
Оригинал https://img-fotki.yandex.ru/get/880375/ … 9_orig.png

Фрагмент 1:

https://img-fotki.yandex.ru/get/892702/158289418.4b3/0_18955c_adf916d6_XL.png

Основной мотив белка - программная 233333-спираль.

Фрагмент 2:

https://img-fotki.yandex.ru/get/962386/158289418.4b3/0_18955d_495cbf92_XL.png

Встречается и другая программная 52223532-спираль, которая строится под музыку с 8-ю повторяющимися нотами в двухдольном ритме:

https://img-fotki.yandex.ru/get/897810/158289418.4b3/0_18955e_786c5a8d_orig.png

743

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 695

Online service PROTEIN PICOTECHNOLOGY

Ищем wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww

https://blast.ncbi.nlm.nih.gov/

No significant similarity found. For reasons why,click here

Ищем vvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvv

No significant similarity found. For reasons why,click here

Ищем ffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff

No significant similarity found. For reasons why,click here

Ищем dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

Заказ 2017-12-17_01:

https://www.ncbi.nlm.nih.gov/protein/OB … B4B6EBB015

OBQ31849

https://www.ncbi.nlm.nih.gov/nuccore/1039188425

https://www.ncbi.nlm.nih.gov/nuccore/LJ … port=fasta

>LJOW01001018.1 Aphanizomenon flos-aquae WA102 180432, whole genome shotgun sequence
CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC
ATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCA
TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
CATCATCATCATCATCATCATCATCATCATCATCATCGTCATCATCATCATCATCATCATCATCATCATC
ATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCA
TCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC
ATCATCATCATCATCATCATCATCATCATCATCATCATC

Исправляем:

>LJOW01001018.1 Aphanizomenon flos-aquae WA102 180432, whole genome shotgun sequence
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgacgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgat
gatgatgatgatgatgatgatgatgatgatgatgatgatgatgatgatg

Результат:

https://img-fotki.yandex.ru/get/896238/158289418.4b3/0_189610_e6c73bf1_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/893904/158289418.4b3/0_189611_53642628_XL.png
Оригинал: https://img-fotki.yandex.ru/get/893904/ … 8_orig.png

744

Re: Online service PROTEIN PICOTECHNOLOGY

Ищем: kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk

Заказ: 2017-12-17_02:

https://www.ncbi.nlm.nih.gov/protein/XP … B5KVEZY015

XP_022530348

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Результат:

https://img-fotki.yandex.ru/get/872977/158289418.4b3/0_189613_c493ea14_XL.png

Кушелев: Мы его уже видели ...

745

Re: Online service PROTEIN PICOTECHNOLOGY

Комплексный заказ (40 структур): 2017-12-17_03: https://www.ncbi.nlm.nih.gov/nuccore/632911273

Результат: https://cloud.mail.ru/public/CyMr/Xznn7anBM

Одна из интересных структур:

https://img-fotki.yandex.ru/get/876523/158289418.4b3/0_189615_fc72dbc2_XL.png

746

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 698

Двухслойная пи-Met-спираль?!

Online service PROTEIN PICOTECHNOLOGY

Ищем: mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Комплексный заказ (85 структур): 2017-12-17_04: https://www.ncbi.nlm.nih.gov/protein/PI … B75001U015

Результат:

Одна из интересных структур:

https://img-fotki.yandex.ru/get/963786/158289418.4b3/0_189616_f8fa470_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/878590/158289418.4b3/0_189617_adc072c9_XL.png
Оригинал: https://img-fotki.yandex.ru/get/878590/ … 9_orig.png

И тут неожиданно возникает вопрос: А может ли пи-спираль намотаться поверх метиониновой спирали? Длины у них похожи, последовательность правильная, т.е. сначала строится тонкая метиониновая спираль, а на неё в обратном порядке наматывается пи-спираль. Логично?

Фрагмент:

https://img-fotki.yandex.ru/get/509885/158289418.4b3/0_189618_9027851c_orig.png

747

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Ищем: yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Заказ: 2017-12-17_05: https://www.ncbi.nlm.nih.gov/protein/EY … B88S2G6014

Результат: https://cloud.mail.ru/public/EArx/PW4DDQWFM

Одна из интересных структур:

https://img-fotki.yandex.ru/get/202385/158289418.477/0_181b8a_4fc28e9_XL.png

Подробнее: http://nanoworld.org.ru/post/91725/#p91725

Ещё:

https://img-fotki.yandex.ru/get/897810/158289418.4b3/0_18961b_f38412cd_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/897810/158289418.4b3/0_18961a_c556d458_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897810/ … 8_orig.png

748

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ: 2017-12-17_06:





Результат:

[img]XL.png[/img]

Развернуто:

[img]XL.png[/img]
Оригинал: orig.png

749

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 702

Многослойные спирали и мезо-механизмы

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Skype:

[16.12.2017 3:47:47] Va12220(Valqwa): усечение буду делать завтра к вечеру
[16.12.2017 10:50:33] Кушелев Александр Юрьевич: Замечательно!
[0:50:35] Кушелев Александр Юрьевич: Привет! Что-то  названия файлов не те и на компактной картинке не то в верхней строке.
Имя файла без номера: LJOW01001018P_01.png. А номер нужен.


https://img-fotki.yandex.ru/get/896238/158289418.4b3/0_189610_e6c73bf1_orig.png

[0:51:18] Кушелев Александр Юрьевич: А в первой строке вместо номера название папки. Это не нужно. Нужен номер и идентификатор. Папку тут указывать не нужно.
[1:32:24] Кушелев Александр Юрьевич: А другой gbk-файл обработался вроде лучше. Номера в названиях файлов есть. Но на картинке лишняя информация. Имя папки. Его желательно убрать.
[2:18:49] Кушелев Александр Юрьевич: Этот файл считается с ошибкой. Будем надеяться, что ошибка в NCBI:

https://img-fotki.yandex.ru/get/914565/158289418.4b3/0_189619_c63c4c30_XL.png
Оригинал: https://img-fotki.yandex.ru/get/914565/ … 0_orig.png

[2:19:30] Кушелев Александр Юрьевич: gbk взят отсюда: https://www.ncbi.nlm.nih.gov/protein/PI … B75001U015
[2:20:01] Кушелев Александр Юрьевич: Кстати, похоже сегодня удалось сделать крутое научное открытие: http://nanoworld.org.ru/topic/1881/
[2:20:09] Кушелев Александр Юрьевич: Поздравляю! Это наша удача.
[5:27:30] Va12220(Valqwa): сделал усечение. подчистил названия файлов.
проверь на нескольких файлах
[5:28:15] Va12220(Valqwa):
Кушелев: Кстати, похоже сегодня удалось сделать крутое научное открытие: http://nanoworld.org.ru/topic/1881/
Поздравляю! Это наша удача.
Va12220(Valqwa): забыл на форуме упомянуть меня
[9:29:57] Кушелев Александр Юрьевич: "Сам себя не похвалишь, никто не похвалит". А ты же зарегистрирован на форуме. Давай обсудим нашу удачу. В чём проблема?

https://img-fotki.yandex.ru/get/963786/158289418.4b3/0_189616_f8fa470_XL.png

Развёрнуто:

https://img-fotki.yandex.ru/get/509885/158289418.4b3/0_189618_9027851c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/509885/ … c_orig.png

Кстати, мне уже попадались аналогичные и даже "более такие же", "более чем" структуры:

https://img-fotki.yandex.ru/get/896238/158289418.4a6/0_186ba1_52a77613_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/872132/158289418.4a6/0_186ba2_ccc2630e_XL.png
Оригинал: https://img-fotki.yandex.ru/get/872132/ … e_orig.png

Эта структура вообще может быть Т-конструкцией из двухслойной спирали.

Сначала строится верхняя черта Т из 310-спирали длиной 38 аминокислотных остатков. Затем поверх нее укладывается второй слой (пи-спираль длиной 17 АО), покрывая процентов 20...25 310-спирали. Потом идёт шпилька из 310-спирали длиной 8 АО (примерно 0.21 от "верхней черты"). Далее обратным ходом на шпильку укладывается 19 АО пи-спирали. После этого строится 28 АО альфа-спирали, которая может идти под любым углом, т.е. от нуля до 180 к первоначальной "черте" или к шпильке. Кстати, шпилька тоже может быть расположена под любым углом к "черте". Далее идёт 310-спираль длиной 45 АО и альфа-спираль длиной 53 АО. Последние три участка - это сверхдлинная прямая спираль (28+45+53 АО), которая тоньше в средней части. Наконец, идёт пи-спираль, например, поверх альфа-спрали и какой-то хитрый узел. Всё это может иметь форму рогатки из двухслойной пи-альфа-спирали на всех трех концах. Может быть и сравнительно  низкочастотной резонансной системой, похожий на U-образный музыкальный камертон. С этим интересно было бы разобраться...

***

https://img-fotki.yandex.ru/get/5007/158289418.4a7/0_186bb7_ec7a55f4_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/5007/158289418.4a7/0_186bb8_14486e2d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/5007/15 … d_orig.png
Подробнее: http://nanoworld.org.ru/topic/1656/page/14/

Этот белок тоже может состоять из двухслойных спиралей, но верхний слой может быть образован не фундаментальной, а программной спиралью. У меня и раньше закрадывалось предположение, что программная 35-спираль может идти верхним слоем по отношению даже к пи-спирали, не говоря о более тонких спиралях.

https://img-fotki.yandex.ru/get/370294/158289418.4a7/0_186be0_27d7b96f_XL.png
Подробнее: http://nanoworld.org.ru/topic/1656/page/14/

А этот белок содержит длинные участки 310-альфа-спиралей, пи-спиралей и программных 35-спиралей. Я не удивлюсь, если в его структуре попадётся не только участок двухслойной, но и участок трехслойной альфа-пи-35-спирали.

https://img-fotki.yandex.ru/get/897139/158289418.4a5/0_1863b2_62631aa0_XL.png
Подробнее: http://nanoworld.org.ru/topic/1656/page/12/

Здесь мы тоже видим участок 310-спирали, за ним сразу пи-спираль, а за ним 35-спираль. Это может быть трехслойный участок 310-пи-35-спирали. А может и нет. Надо проверять...

https://img-fotki.yandex.ru/get/368754/158289418.4a8/0_186cc6_95a06491_orig.png
Подробнее: http://nanoworld.org.ru/topic/1656/page/14/

Если это - система противонаправленных альфа- и бета-спиральных участков, образующих гигантскую трубу, то это:

https://img-fotki.yandex.ru/get/896349/158289418.4a5/0_1863ba_ccc834d4_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/373339/158289418.4a5/0_1863bb_2169fd79_XL.png
Подробнее: http://nanoworld.org.ru/topic/1656/page/12/

Может быть либо антинаправленными участками альфа-спиралей и двухслойных 310-пи-спиралей, образующих гигантскую трубу, либо рёберным многогранником, в частности 6-угольной пирамидой, основание которой образовано альфа-спиральными участками, а наклонные ребра - двухслойными 310-пи-спиралями. При этом пирамида может быть лишь одним из крайних состояний некого манипулятора, который может развернуться в 6-конечную "звезду". Это нужно моделировать в 3D. Тогда может появиться определенность и ясность.

https://img-fotki.yandex.ru/get/875526/158289418.4a5/0_18649d_3b97c25e_orig.png
Подробнее: http://nanoworld.org.ru/topic/1656/page/12/

Это уже скорее всего гигантская труба из противонаправленных альфа-спиральных и двухслойных 310-пи-спиральных участков. Но тоже надо проверять.

https://img-fotki.yandex.ru/get/892702/158289418.4af/0_188379_96ba8f74_orig.png
Подробнее: http://nanoworld.org.ru/topic/1699/page/74/

Эти экзотические структуры могут оказаться очень интересными мезо-механизмами (что-то среднее между большой третичной и малой четвертичной структурой), включающими в себя многослойные спирали.

750

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 93 718

Online service PROTEIN PICOTECHNOLOGY

Ищем rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr

No significant similarity found. For reasons why,click here

Ищем ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

No significant similarity found. For reasons why,click here

Ищем bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb

No significant similarity found. For reasons why,click here

Ищем iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii

No significant similarity found. For reasons why,click here

Ищем hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

No significant similarity found. For reasons why,click here

Ищем jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

No significant similarity found. For reasons why,click here

Ищем llllllllllllllllllllllllllllllllllllllllllllllllllllllllllll

No significant similarity found. For reasons why,click here

Ищем nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Ищем oooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo

There was a problem with the search. Please, contact Help Desk and include RID 3E4E81E9015
Informational Message: Warning: Could not calculate ungapped Karlin-Altschul parameters due to an invalid query sequence or its translation. Please verify the query sequence(s) and/or filtering options Warning: One or more O characters replaced by X for alignment score calculations at positions 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,... (only first 20 shown)

Ищем pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp

1: http://nanoworld.org.ru/post/86638/#p86638

2: http://nanoworld.org.ru/post/86659/#p86659

3: http://nanoworld.org.ru/post/86657/#p86657

4: http://nanoworld.org.ru/post/86637/#p86637

Ищем qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq

No significant similarity found. For reasons why,click here

Ищем ssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

No significant similarity found. For reasons why,click here

uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu

Message ID#24 Error: Failed to read the Blast query: Nucleotide FASTA provided for protein sequence

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

There was a problem with the search. Please, contact Help Desk and include RID 3E59SD6N015
Informational Message: Warning: Could not calculate ungapped Karlin-Altschul parameters due to an invalid query sequence or its translation. Please verify the query sequence(s) and/or filtering options

Ищем zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz

No significant similarity found. For reasons why,click here

Ищем zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz

No significant similarity found. For reasons why,click here

Ищем zzzzzzzzzzzzzzzzzzzzzzzzzzzzzz

ELI35171

https://www.ncbi.nlm.nih.gov/nuccore/431561811

***

Заказ 2017-12-18_01:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_013080073.1 PREDICTED: Aplysia californica protein FANTASTIC FOUR 1-like (LOC106011227), partial mRNA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAA

Результат:

https://img-fotki.yandex.ru/get/362196/158289418.4b3/0_1896a5_eceb1ab4_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/28072/158289418.4b3/0_1896aa_e1095797_orig.png

***

EUM76151

https://www.ncbi.nlm.nih.gov/nuccore/578316723