521

Re: Общество вимановладельцев

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_02:

http://www.rcsb.org/pdb/explore/explore … ureId=5V56

https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

>ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein
ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
GCGCATGACGTGAGGGGCGCCATCTAG

Результат:

https://img-fotki.yandex.ru/get/877150/158289418.4ac/0_187983_c6c8c3bf_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ac/0_187984_90c83513_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 3_orig.png

4-8 - альфа-спираль
49-53 - альфа-спираль
57-60 - альфа-спираль
62-65 - альфа-спираль
67-71 - альфа-спираль
75-78 - альфа-спираль
80-95 - альфа-спираль
97-103 - альфа-спираль
105-108 - альфа-спираль
110-115 - альфа-спираль
115-121 - программная 35-спираль
120-127 - программная 3355-спираль
128-141 - альфа-спираль
143-148 - альфа-спираль

522

Re: Общество вимановладельцев

Kushelev пишет:

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_02:

http://www.rcsb.org/pdb/explore/explore … ureId=5V56

https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

>ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein
ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
GCGCATGACGTGAGGGGCGCCATCTAG

Результат:

https://img-fotki.yandex.ru/get/877150/158289418.4ac/0_187983_c6c8c3bf_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ac/0_187984_90c83513_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 3_orig.png

4-8 - альфа-спираль
49-53 - альфа-спираль
57-60 - альфа-спираль
62-65 - альфа-спираль
67-71 - альфа-спираль
75-78 - альфа-спираль
80-95 - альфа-спираль
97-103 - альфа-спираль
105-108 - альфа-спираль
110-115 - альфа-спираль
115-121 - программная 35-спираль
120-127 - программная 3355-спираль
128-141 - альфа-спираль
143-148 - альфа-спираль


Отлично!

523

Re: Общество вимановладельцев

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_03:

https://www.ebi.ac.uk/ena/data/view/AAB … play=fasta

>ENA|AAB41788|AAB41788.1 Homo sapiens (human) smoothened
ATGGCCGCTGCCCGCCCAGCGCGGGGGCCGGAGCTCCCGCTCCTGGGGCTGCTGCTGCTG
CTGCTGCTGGGGGACCCGGGCCGGGGGGCGGCCTCGAGCGGGAACGCGACCGGGCCTGGG
CCTCGGAGCGCGGGCGGGAGCGCGAGGAGGAGCGCGGCGGTGACTGGCCCTCCGCCGCCG
CTGAGCCACTGCGGCCGGGCTGCCCCCTGCGAGCCGCTGCGCTACAACGTGTGCCTGGGC
TCGGTGCTGCCCTACGGGGCCACCTCCACACTGCTGGCCGGAGACTCGGACTCCCAGGAG
GAAGCGCACGGCAAGCTCGTGCTCTGGTCGGGCCTCCGGAATGCCCCCCGCTGCTGGGCA
GTGATCCAGCCCCTGCTGTGTGCCGTATACATGCCCAAGTGTGAGAATGACCGGGTGGAG
CTGCCCAGCCGTACCCTCTGCCAGGCCACCCGAGGCCCCTGTGCCATCGTGGAGAGGGAG
CGGGGCTGGCCTGACTTCCTGCGCTGCACTCCTGACCGCTTCCCTGAAGGCTGCACGAAT
GAGGTGCAGAACATCAAGTTCAACAGTTCAGGCCAGTGCGAAGTGCCCTTGGTTCGGACA
GACAACCCCAAGAGCTGGTACGAGGACGTGGAGGGCTGCGGCATCCAGTGCCAGAACCCG
CTCTTCACAGAGGCTGAGCACCAGGACATGCACAGCTACATCGCGGCCTTCGGGGCCGTC
ACGGGCCTCTGCACGCTCTTCACCCTGGCCACATTCGTGGCTGACTGGCGGAACTCGAAT
CGCTACCCTGCTGTTATTCTCTTCTACGTCAATGCGTGCTTCTTTGTGGGCAGCATTGGC
TGGCTGGCCCAGTTCATGGATGGTGCCCGCCGAGAGATCGTCTGCCGTGCAGATGGCACC
ATGAGGCTTGGGGAGCCCACCTCCAATGAGACTCTGTCCTGCGTCATCATCTTTGTCATC
GTGTACTACGCCCTGATGGCTGGTGTGGTTTGGTTTGTGGTCCTCACCTATGCCTGGCAC
ACTTCCTTCAAAGCCCTGGGCACCACCTACCAGCCTCTCTCGGGCAAGACCTCCTACTTC
CACCTGCTCACCTGGTCACTCCCCTTTGTCCTCACTGTGGCAATCCTTGCTGTGGCGCAG
GTGGATGGGGACTCTGTGAGTGGCATTTGTTTTGTGGGCTACAAGAACTACCGATACCGT
GCGGGCTTCGTGCTGGCCCCAATCGGCCTGGTGCTCATCGTGGGAGGCTACTTCCTCATC
CGAGGAGTCATGACTCTGTTCTCCATCAAGAGCAACCACCCCGGGCTGCTGAGTGAGAAG
GCTGCCAGCAAGATCAACGAGACCATGCTGCGCCTGGGCATTTTTGGCTTCCTGGCCTTT
GGCTTTGTGCTCATTACCTTCAGCTGCCACTTCTACGACTTCTTCAACCAGGCTGAGTGG
GAGCGCAGCTTCCGGGACTATGTGCTATGTCAGGCCAATGTGACCATCGGGCTGCCCACC
AAGCAGCCCATCCCTGACTGTGAGATCAAGAATCGCCCGAGCCTTCTGGTGGAGAAGATC
AACCTGTTTGCCATGTTTGGAACTGGCATCGCCATGAGCACCTGGGTCTGGACCAAGGCC
ACGCTGCTCATCTGGAGGCGTACCTGGTGCAGGTTGACTGGGCAGAGTGACGATGAGCCA
AAGCGGATCAAGAAGAGCAAGATGATTGCCAAGGCCTTCTCTAAGCGGCACGAGCTCCTG
CAGAACCCAGGCCAGGAGCTGTCCTTCAGCATGCACACTGTGTCCCACGACGGGCCCGTG
GCGGGCTTGGCCTTTGACCTCAATGAGCCCTCAGCTGATGTCTCCTCTGCCTGGGCCCAG
CATGTCACCAAGATGGTGGCTCGGAGAGGAGCCATACTGCCCCAGGATATTTCTGTCACC
CCTGTGGCAACTCCAGTGCCCCCAGAGGAACAAGCCAACCTGTGGCTGGTTGAGGCAGAG
ATCTCCCCAGAGCTGCAGAAGCGCCTGGGCCGGAAGAAGAAGAGGAGGAAGAGGAAGAAG
GAGGTGTGCCCGCTGGCGCCGCCCCCTGAGCTTCACCCCCCTGCCCCTGCCCCCAGTACC
ATTCCTCGACTGCCTCAGCTGCCCCGGCAGAAATGCCTGGTGGCTGCAGGTGCCTGGGGA
GCTGGGGACTCTTGCCGACAGGGAGCGTGGACCCTGGTCTCCAACCCATTCTGCCCAGAG
CCCAGTCCCCCTCAGGATCCATTTCTGCCCAGTGCACCGGCCCCCGTGGCATGGGCTCAT
GGCCGCCGACAGGGCCTGGGGCCTATTCACTCCCGCACCAACCTGATGGACACAGAACTC
ATGGATGCAGACTCGGACTTCTGA

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4ac/0_18799c_89d3b638_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/872132/158289418.4ad/0_18799d_e81304e2_XL.png
Оригинал: https://img-fotki.yandex.ru/get/872132/ … 2_orig.png

7-38 - 310-альфа-спираль.
42-54 - 310-альфа-спираль.
58-66 - 310-альфа-спираль.
68-89 - 310-альфа-спираль.
Далее мелкие участки альфа-спиралей.
201 - 222 - альфа-спираль.
226-250 - альфа-спираль.
Далее мелкие участки альфа-спиралей.
353-365 - альфа-спираль.
Далее мелкие участки альфа-спиралей.
426-437 - альфа-спираль.
442-453 - альфа-спираль.
466-477 - альфа-спираль.
Далее мелкие участки альфа-спиралей.
664-688 - альфа-спираль.
Далее мелкие участки альфа-спиралей.

524

Re: Общество вимановладельцев

Kushelev пишет:
Татьяна Рясина пишет:

Это здесь  http://nanoworld.org.ru/post/96441/#p96441


Напишите пожалуйста резюиме диаграммы.

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_04:

https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

Результат:

https://img-fotki.yandex.ru/get/483127/158289418.4ad/0_1879a5_bcb641c8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ad/0_1879a6_beabcae0_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 0_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.


Супер.

525

Re: Общество вимановладельцев

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 92 975

Online service PROTEIN PICOTECHNOLOGY

http://nanoworld.org.ru/post/96429/#p96429

Кушелев: Давайте посмотрим ещё несколько структур...

Заказ 2017-12-01_01:

https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

>ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein
ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
GAGACGAGCCAGGTGGCCCCGGCCTAA

Результат:

https://img-fotki.yandex.ru/get/876984/158289418.4ac/0_187981_ae7f53b8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/756497/158289418.4ac/0_187982_755b30a4_XL.png
Оригинал: https://img-fotki.yandex.ru/get/756497/ … 4_orig.png

8-14 - альфа-спираль.
21-26 - альфа-спираль.
28-31 - альфа-спираль.
35-44 - альфа-спираль.
46-70 - 310-альфа-спираль.
72-78 - альфа-спираль.
83-87 - альфа-спираль.
90-97 - альфа-спираль.
102-107 - альфа-спираль.
112-115 - альфа-спираль.
117-120 - альфа-спираль.
124-139 - альфа-спираль.
141-151 - альфа-спираль.
153-156 - альфа-спираль.
158-168 - альфа-спираль.
172-186 - альфа-спираль.
189-201 - альфа-спираль.
204-216 - альфа-спираль.
215-225 - программная 355-спираль.
224-233 - альфа-спираль.
235-239 - альфа-спираль.
238-248 - программная 255-спираль.
247-259 - альфа-спираль.
261-271 - альфа-спираль.
273-283 - альфа-спираль.
285-290 - альфа-спираль.
295-302 - альфа-спираль.
307-326 - альфа-спираль.
336-348 - альфа-спираль.

Ага.

526

Re: Общество вимановладельцев

Kushelev пишет:

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_04:

https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

Результат:

https://img-fotki.yandex.ru/get/483127/158289418.4ad/0_1879a5_bcb641c8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ad/0_1879a6_beabcae0_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 0_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.


Супер.

527

Re: Общество вимановладельцев

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_05:

http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ

http://www.uniprot.org/uniprot/P47871

https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

>ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor
ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

Результат:

https://img-fotki.yandex.ru/get/914565/158289418.4ad/0_1879cd_d8ed9727_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/477847/158289418.4ad/0_1879ce_cd306c63_XL.png
Оригинал: https://img-fotki.yandex.ru/get/477847/ … 3_orig.png

147-173 - наиболее протяженный участок альфа-310-спирали. Весь белок представлен преимущественно участками альфа-310-спиралей.

528

Re: Общество вимановладельцев

Отлично.


Забыла.  Сейчас мысль пришла. 

Сопоставление диаграммы РСА и Пикотеха  (если нужно).


Т.е. слева сделать - если не лень конечно - ленту РСА  перед 2D Диаграммы Пикотеха, как Вы показывали на отдельных примерах.  На мой взгляд это наглядно,   бросается в глаза -  это нужно при первом, беглом,  возможно вскользь,  "холодном" прочтении. Чтобы запомнилось.


А в резюме может сделать в виде таблицы и перечислить совпадения, несовпадения, участки где структура не определена.   Именно потому что таблица тоже бросается в глаза, при первом холодном ознакомлении.

Столбцы

Фрагмент РСА      -    Фрагмент  Пикотех, последовательность спиралей (как Вы сделали только что)   -     Совпадения     -     Несовпадения     -     Неясные участки в РСА

529

Re: Общество вимановладельцев

Татьяна Рясина пишет:

Отлично.


Забыла.  Сейчас мысль пришла. 

Сопоставление диаграммы РСА и Пикотеха  (если нужно).


Т.е. слева сделать - если не лень конечно - ленту РСА  перед 2D Диаграммы Пикотеха, как Вы показывали на отдельных примерах.  На мой взгляд это наглядно,   бросается в глаза -  это нужно при первом, беглом,  возможно вскользь,  "холодном" прочтении. Чтобы запомнилось.


А в резюме может сделать в виде таблицы и перечислить совпадения, несовпадения, участки где структура не определена.   Именно потому что таблица тоже бросается в глаза, при первом холодном ознакомлении.

Столбцы

Фрагмент РСА      -    Фрагмент  Пикотех, последовательность спиралей (как Вы сделали только что)   -     Совпадения     -     Несовпадения     -     Неясные участки в РСА

Это имеет смысл сделать для той пары белков, где пи-спирали и альфа-спирали соответственно. Я как раз и дал для сравнения вторичные структуры для тех двух белков. Для остальных будет менее наглядно.

530

Re: Общество вимановладельцев

Да, резонно.