511

Re: Общество вимановладельцев

https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F


https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b8_8a210572_orig.png
5v57_assembly_1_full.png


Это здесь http://nanoworld.org.ru/post/96436/#p96436


Напишите пожалуйста сюда Ваше резюме диаграммы.


3D ....   Молчу, молчу

512

Re: Общество вимановладельцев

Kushelev пишет:

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_03:

https://www.ebi.ac.uk/ena/data/view/AAB … play=fasta

>ENA|AAB41788|AAB41788.1 Homo sapiens (human) smoothened
ATGGCCGCTGCCCGCCCAGCGCGGGGGCCGGAGCTCCCGCTCCTGGGGCTGCTGCTGCTG
CTGCTGCTGGGGGACCCGGGCCGGGGGGCGGCCTCGAGCGGGAACGCGACCGGGCCTGGG
CCTCGGAGCGCGGGCGGGAGCGCGAGGAGGAGCGCGGCGGTGACTGGCCCTCCGCCGCCG
CTGAGCCACTGCGGCCGGGCTGCCCCCTGCGAGCCGCTGCGCTACAACGTGTGCCTGGGC
TCGGTGCTGCCCTACGGGGCCACCTCCACACTGCTGGCCGGAGACTCGGACTCCCAGGAG
GAAGCGCACGGCAAGCTCGTGCTCTGGTCGGGCCTCCGGAATGCCCCCCGCTGCTGGGCA
GTGATCCAGCCCCTGCTGTGTGCCGTATACATGCCCAAGTGTGAGAATGACCGGGTGGAG
CTGCCCAGCCGTACCCTCTGCCAGGCCACCCGAGGCCCCTGTGCCATCGTGGAGAGGGAG
CGGGGCTGGCCTGACTTCCTGCGCTGCACTCCTGACCGCTTCCCTGAAGGCTGCACGAAT
GAGGTGCAGAACATCAAGTTCAACAGTTCAGGCCAGTGCGAAGTGCCCTTGGTTCGGACA
GACAACCCCAAGAGCTGGTACGAGGACGTGGAGGGCTGCGGCATCCAGTGCCAGAACCCG
CTCTTCACAGAGGCTGAGCACCAGGACATGCACAGCTACATCGCGGCCTTCGGGGCCGTC
ACGGGCCTCTGCACGCTCTTCACCCTGGCCACATTCGTGGCTGACTGGCGGAACTCGAAT
CGCTACCCTGCTGTTATTCTCTTCTACGTCAATGCGTGCTTCTTTGTGGGCAGCATTGGC
TGGCTGGCCCAGTTCATGGATGGTGCCCGCCGAGAGATCGTCTGCCGTGCAGATGGCACC
ATGAGGCTTGGGGAGCCCACCTCCAATGAGACTCTGTCCTGCGTCATCATCTTTGTCATC
GTGTACTACGCCCTGATGGCTGGTGTGGTTTGGTTTGTGGTCCTCACCTATGCCTGGCAC
ACTTCCTTCAAAGCCCTGGGCACCACCTACCAGCCTCTCTCGGGCAAGACCTCCTACTTC
CACCTGCTCACCTGGTCACTCCCCTTTGTCCTCACTGTGGCAATCCTTGCTGTGGCGCAG
GTGGATGGGGACTCTGTGAGTGGCATTTGTTTTGTGGGCTACAAGAACTACCGATACCGT
GCGGGCTTCGTGCTGGCCCCAATCGGCCTGGTGCTCATCGTGGGAGGCTACTTCCTCATC
CGAGGAGTCATGACTCTGTTCTCCATCAAGAGCAACCACCCCGGGCTGCTGAGTGAGAAG
GCTGCCAGCAAGATCAACGAGACCATGCTGCGCCTGGGCATTTTTGGCTTCCTGGCCTTT
GGCTTTGTGCTCATTACCTTCAGCTGCCACTTCTACGACTTCTTCAACCAGGCTGAGTGG
GAGCGCAGCTTCCGGGACTATGTGCTATGTCAGGCCAATGTGACCATCGGGCTGCCCACC
AAGCAGCCCATCCCTGACTGTGAGATCAAGAATCGCCCGAGCCTTCTGGTGGAGAAGATC
AACCTGTTTGCCATGTTTGGAACTGGCATCGCCATGAGCACCTGGGTCTGGACCAAGGCC
ACGCTGCTCATCTGGAGGCGTACCTGGTGCAGGTTGACTGGGCAGAGTGACGATGAGCCA
AAGCGGATCAAGAAGAGCAAGATGATTGCCAAGGCCTTCTCTAAGCGGCACGAGCTCCTG
CAGAACCCAGGCCAGGAGCTGTCCTTCAGCATGCACACTGTGTCCCACGACGGGCCCGTG
GCGGGCTTGGCCTTTGACCTCAATGAGCCCTCAGCTGATGTCTCCTCTGCCTGGGCCCAG
CATGTCACCAAGATGGTGGCTCGGAGAGGAGCCATACTGCCCCAGGATATTTCTGTCACC
CCTGTGGCAACTCCAGTGCCCCCAGAGGAACAAGCCAACCTGTGGCTGGTTGAGGCAGAG
ATCTCCCCAGAGCTGCAGAAGCGCCTGGGCCGGAAGAAGAAGAGGAGGAAGAGGAAGAAG
GAGGTGTGCCCGCTGGCGCCGCCCCCTGAGCTTCACCCCCCTGCCCCTGCCCCCAGTACC
ATTCCTCGACTGCCTCAGCTGCCCCGGCAGAAATGCCTGGTGGCTGCAGGTGCCTGGGGA
GCTGGGGACTCTTGCCGACAGGGAGCGTGGACCCTGGTCTCCAACCCATTCTGCCCAGAG
CCCAGTCCCCCTCAGGATCCATTTCTGCCCAGTGCACCGGCCCCCGTGGCATGGGCTCAT
GGCCGCCGACAGGGCCTGGGGCCTATTCACTCCCGCACCAACCTGATGGACACAGAACTC
ATGGATGCAGACTCGGACTTCTGA

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4ac/0_18799c_89d3b638_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/872132/158289418.4ad/0_18799d_e81304e2_XL.png
Оригинал: https://img-fotki.yandex.ru/get/872132/ … 2_orig.png


Дайте пожалуйста ссылку на публикацию 'этой структуры в ncbi

513

Re: Общество вимановладельцев

Татьяна Рясина пишет:
Kushelev пишет:

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_03:

https://www.ebi.ac.uk/ena/data/view/AAB … play=fasta

>ENA|AAB41788|AAB41788.1 Homo sapiens (human) smoothened
ATGGCCGCTGCCCGCCCAGCGCGGGGGCCGGAGCTCCCGCTCCTGGGGCTGCTGCTGCTG
CTGCTGCTGGGGGACCCGGGCCGGGGGGCGGCCTCGAGCGGGAACGCGACCGGGCCTGGG
CCTCGGAGCGCGGGCGGGAGCGCGAGGAGGAGCGCGGCGGTGACTGGCCCTCCGCCGCCG
CTGAGCCACTGCGGCCGGGCTGCCCCCTGCGAGCCGCTGCGCTACAACGTGTGCCTGGGC
TCGGTGCTGCCCTACGGGGCCACCTCCACACTGCTGGCCGGAGACTCGGACTCCCAGGAG
GAAGCGCACGGCAAGCTCGTGCTCTGGTCGGGCCTCCGGAATGCCCCCCGCTGCTGGGCA
GTGATCCAGCCCCTGCTGTGTGCCGTATACATGCCCAAGTGTGAGAATGACCGGGTGGAG
CTGCCCAGCCGTACCCTCTGCCAGGCCACCCGAGGCCCCTGTGCCATCGTGGAGAGGGAG
CGGGGCTGGCCTGACTTCCTGCGCTGCACTCCTGACCGCTTCCCTGAAGGCTGCACGAAT
GAGGTGCAGAACATCAAGTTCAACAGTTCAGGCCAGTGCGAAGTGCCCTTGGTTCGGACA
GACAACCCCAAGAGCTGGTACGAGGACGTGGAGGGCTGCGGCATCCAGTGCCAGAACCCG
CTCTTCACAGAGGCTGAGCACCAGGACATGCACAGCTACATCGCGGCCTTCGGGGCCGTC
ACGGGCCTCTGCACGCTCTTCACCCTGGCCACATTCGTGGCTGACTGGCGGAACTCGAAT
CGCTACCCTGCTGTTATTCTCTTCTACGTCAATGCGTGCTTCTTTGTGGGCAGCATTGGC
TGGCTGGCCCAGTTCATGGATGGTGCCCGCCGAGAGATCGTCTGCCGTGCAGATGGCACC
ATGAGGCTTGGGGAGCCCACCTCCAATGAGACTCTGTCCTGCGTCATCATCTTTGTCATC
GTGTACTACGCCCTGATGGCTGGTGTGGTTTGGTTTGTGGTCCTCACCTATGCCTGGCAC
ACTTCCTTCAAAGCCCTGGGCACCACCTACCAGCCTCTCTCGGGCAAGACCTCCTACTTC
CACCTGCTCACCTGGTCACTCCCCTTTGTCCTCACTGTGGCAATCCTTGCTGTGGCGCAG
GTGGATGGGGACTCTGTGAGTGGCATTTGTTTTGTGGGCTACAAGAACTACCGATACCGT
GCGGGCTTCGTGCTGGCCCCAATCGGCCTGGTGCTCATCGTGGGAGGCTACTTCCTCATC
CGAGGAGTCATGACTCTGTTCTCCATCAAGAGCAACCACCCCGGGCTGCTGAGTGAGAAG
GCTGCCAGCAAGATCAACGAGACCATGCTGCGCCTGGGCATTTTTGGCTTCCTGGCCTTT
GGCTTTGTGCTCATTACCTTCAGCTGCCACTTCTACGACTTCTTCAACCAGGCTGAGTGG
GAGCGCAGCTTCCGGGACTATGTGCTATGTCAGGCCAATGTGACCATCGGGCTGCCCACC
AAGCAGCCCATCCCTGACTGTGAGATCAAGAATCGCCCGAGCCTTCTGGTGGAGAAGATC
AACCTGTTTGCCATGTTTGGAACTGGCATCGCCATGAGCACCTGGGTCTGGACCAAGGCC
ACGCTGCTCATCTGGAGGCGTACCTGGTGCAGGTTGACTGGGCAGAGTGACGATGAGCCA
AAGCGGATCAAGAAGAGCAAGATGATTGCCAAGGCCTTCTCTAAGCGGCACGAGCTCCTG
CAGAACCCAGGCCAGGAGCTGTCCTTCAGCATGCACACTGTGTCCCACGACGGGCCCGTG
GCGGGCTTGGCCTTTGACCTCAATGAGCCCTCAGCTGATGTCTCCTCTGCCTGGGCCCAG
CATGTCACCAAGATGGTGGCTCGGAGAGGAGCCATACTGCCCCAGGATATTTCTGTCACC
CCTGTGGCAACTCCAGTGCCCCCAGAGGAACAAGCCAACCTGTGGCTGGTTGAGGCAGAG
ATCTCCCCAGAGCTGCAGAAGCGCCTGGGCCGGAAGAAGAAGAGGAGGAAGAGGAAGAAG
GAGGTGTGCCCGCTGGCGCCGCCCCCTGAGCTTCACCCCCCTGCCCCTGCCCCCAGTACC
ATTCCTCGACTGCCTCAGCTGCCCCGGCAGAAATGCCTGGTGGCTGCAGGTGCCTGGGGA
GCTGGGGACTCTTGCCGACAGGGAGCGTGGACCCTGGTCTCCAACCCATTCTGCCCAGAG
CCCAGTCCCCCTCAGGATCCATTTCTGCCCAGTGCACCGGCCCCCGTGGCATGGGCTCAT
GGCCGCCGACAGGGCCTGGGGCCTATTCACTCCCGCACCAACCTGATGGACACAGAACTC
ATGGATGCAGACTCGGACTTCTGA

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4ac/0_18799c_89d3b638_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/872132/158289418.4ad/0_18799d_e81304e2_XL.png
Оригинал: https://img-fotki.yandex.ru/get/872132/ … 2_orig.png


Дайте пожалуйста ссылку на публикацию 'этой структуры в ncbi


И резюме 2D диаграммы Пикотех

514

Re: Общество вимановладельцев

Третье письмо, проект
адресата два, Андрей Ищенко и Вадим Черезов
http://cherezov.usc.edu/members.htm

Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V



https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png
5tud_assembly_1_full (1).png



Это здесь  http://nanoworld.org.ru/post/96441/#p96441


Напишите пожалуйста резюиме диаграммы.

515

Re: Общество вимановладельцев

Одно письмо отправлено, можно звонить.

И постепенно досылать письма в США и на русском в МФТИ и дозваниваться.

516

Re: Общество вимановладельцев

2D диаграмма Пикотехнология
http://nanoworld.org.ru/post/96474/#p96474


На сайте NCBI
https://www.ncbi.nlm.nih.gov/Structure/pdb/1FBB

Molecular mechanism of vectorial proton translocation by bacteriorhodopsin

Subramaniam S, Henderson R

Subramaniam S
https://ccr.cancer.gov/Laboratory-of-Ce … ubramaniam

Sriram Subramaniam, Ph.D.
Center for Cancer Research
National Cancer Institute
Building 50, Room 4306
Bethesda, MD 20892-8008
Ph: 240-760-6384
subramas@mail.nih.gov

Александр Юрьевич,
напишите пожалуйста резюме 3D диаграммы Пикотех, и вышлем по адресу


Subramaniam S  публикации
https://www.ncbi.nlm.nih.gov/pubmed?cmd … dispmax=50

517

Re: Общество вимановладельцев

Татьяна Рясина пишет:

Это здесь  http://nanoworld.org.ru/post/96441/#p96441


Напишите пожалуйста резюиме диаграммы.

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_04:

https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

Результат:

https://img-fotki.yandex.ru/get/483127/158289418.4ad/0_1879a5_bcb641c8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ad/0_1879a6_beabcae0_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 0_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

518

Re: Общество вимановладельцев

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:
Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 92 926

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Общество вимановладельцев

Комплексный заказ 2017-11-29_11:

Татьяна Рясина пишет:

Вадим Черезов https://www.ncbi.nlm.nih.gov/pubmed/17962520

human beta2-adrenergic G protein-coupled receptor

https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

https://img-fotki.yandex.ru/get/896349/158289418.4ac/0_187938_b0dc3657_XL.png

http://www.uniprot.org/uniprot/P00720

https://www.ebi.ac.uk/ena/data/view/CAA28212

>ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein
ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
TATAAAAATCTATAA

Результат:

https://img-fotki.yandex.ru/get/480022/158289418.4ac/0_187939_bf9f1843_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/879536/158289418.4ac/0_18793a_6ec915a1_XL.png
Оригинал: https://img-fotki.yandex.ru/get/879536/ … 1_orig.png

Заказ (часть 2)

http://www.uniprot.org/uniprot/P07550

https://www.ebi.ac.uk/ena/data/view/CAA28511

>ENA|CAA28511|CAA28511.1 Homo sapiens (human) hypothetical protein
ATGGGGCAACCCGGGAACGGCAGCGCCTTCTTGCTGGCACCCAATGGAAGCCATGCGCCG
GACCACGACGTCACGCAGGAAAGGGACGAGGTGTGGGTGGTGGGCATGGGCATCGTCATG
TCTCTCATCGTCCTGGCCATCGTGTTTGGCAATGTGCTGGTCATCACAGCCATTGCCAAG
TTCGAGCGTCTGCAGACGGTCACCAACTACTTCATCACTTCACTGGCCTGTGCTGATCTG
GTCATGGGCCTGGCAGTGGTGCCCTTTGGGGCCGCCCATATTCTTATGAAAATGTGGACT
TTTGGCAACTTCTGGTGCGAGTTTTGGACTTCCATTGATGTGCTGTGCGTCACGGCCAGC
ATTGAGACCCTGTGCGTGATCGCAGTGGATCGCTACTTTGCCATTACTTCACCTTTCAAG
TACCAGAGCCTGCTGACCAAGAATAAGGCCCGGGTGATCATTCTGATGGTGTGGATTGTG
TCAGGCCTTACCTCCTTCTTGCCCATTCAGATGCACTGGTACCGGGCCACCCACCAGGAA
GCCATCAACTGCTATGCCAATGAGACCTGCTGTGACTTCTTCACGAACCAAGCCTATGCC
ATTGCCTCTTCCATCGTGTCCTTCTACGTTCCCCTGGTGATCATGGTCTTCGTCTACTCC
AGGGTCTTTCAGGAGGCCAAAAGGCAGCTCCAGAAGATTGACAAATCTGAGGGCCGCTTC
CATGTCCAGAACCTTAGCCAGGTGGAGCAGGATGGGCGGACGGGGCATGGACTCCGCAGA
TCTTCCAAGTTCTGCTTGAAGGAGCACAAAGCCCTCAAGACGTTAGGCATCATCATGGGC
ACTTTCACCCTCTGCTGGCTGCCCTTCTTCATCGTTAACATTGTGCATGTGATCCAGGAT
AACCTCATCCGTAAGGAAGTTTACATCCTCCTAAATTGGATAGGCTATGTCAATTCTGGT
TTCAATCCCCTTATCTACTGCCGGAGCCCAGATTTCAGGATTGCCTTCCAGGAGCTTCTG
TGCCTGCGCAGGTCTTCTTTGAAGGCCTATGGGAATGGCTACTCCAGCAACGGCAACACA
GGGGAGCAGAGTGGATATCACGTGGAACAGGAGAAAGAAAATAAACTGCTGTGTGAAGAC
CTCCCAGGCACGGAAGACTTTGTGGGCCATCAAGGTACTGTGCCTAGCGATAACATTGAT
TCACAAGGGAGGAATTGTAGTACAAATGACTCACTGCTGTAA

Результат (часть 2):

https://img-fotki.yandex.ru/get/879536/158289418.4ac/0_18793b_a02233d9_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/769660/158289418.4ac/0_18793c_25152180_XL.png
Оригинал: https://img-fotki.yandex.ru/get/769660/ … 0_orig.png

Программа Пикотех показывает, что первый белок состоит преимущественно из пи-спиралей, а второй - преимущественно из альфа-310-спиралей.

Рентгеноструктурный анализ высокого разрешения не может отличить пи-спираль от альфа-310-спирали.



На сайте NCBI

https://www.ncbi.nlm.nih.gov/Structure/pdb/1FBB

Molecular mechanism of vectorial proton translocation by bacteriorhodopsin

Subramaniam S, Henderson R

Subramaniam S
https://ccr.cancer.gov/Laboratory-of-Ce … ubramaniam

Sriram Subramaniam, Ph.D.
Center for Cancer Research
National Cancer Institute
Building 50, Room 4306
Bethesda, MD 20892-8008
Ph: 240-760-6384
subramas@mail.nih.gov


Александр Юрьевич,

напишите пожалуйста резюме 3D диаграммы Пикотех, и вышлем по адресу

Резюме: Первый белок состоит преимущественно из пи-спиралей. Второй преимущественно из альфа-спиралей.

519

Re: Общество вимановладельцев

Kushelev пишет:
Татьяна Рясина пишет:

Это здесь  http://nanoworld.org.ru/post/96441/#p96441


Напишите пожалуйста резюиме диаграммы.

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-12-01_04:

https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

Результат:

https://img-fotki.yandex.ru/get/483127/158289418.4ad/0_1879a5_bcb641c8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/897139/158289418.4ad/0_1879a6_beabcae0_XL.png
Оригинал: https://img-fotki.yandex.ru/get/897139/ … 0_orig.png

Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.



Супер! Пакуем, оправляем по авторам кого найдём.

520

Re: Общество вимановладельцев

Формы, механизмы, энергия наномира. Сообщение 92 975

Online service PROTEIN PICOTECHNOLOGY

http://nanoworld.org.ru/post/96429/#p96429

Кушелев: Давайте посмотрим ещё несколько структур...

Заказ 2017-12-01_01:

https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

>ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein
ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
GAGACGAGCCAGGTGGCCCCGGCCTAA

Результат:

https://img-fotki.yandex.ru/get/876984/158289418.4ac/0_187981_ae7f53b8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/756497/158289418.4ac/0_187982_755b30a4_XL.png
Оригинал: https://img-fotki.yandex.ru/get/756497/ … 4_orig.png

8-14 - альфа-спираль.
21-26 - альфа-спираль.
28-31 - альфа-спираль.
35-44 - альфа-спираль.
46-70 - 310-альфа-спираль.
72-78 - альфа-спираль.
83-87 - альфа-спираль.
90-97 - альфа-спираль.
102-107 - альфа-спираль.
112-115 - альфа-спираль.
117-120 - альфа-спираль.
124-139 - альфа-спираль.
141-151 - альфа-спираль.
153-156 - альфа-спираль.
158-168 - альфа-спираль.
172-186 - альфа-спираль.
189-201 - альфа-спираль.
204-216 - альфа-спираль.
215-225 - программная 355-спираль.
224-233 - альфа-спираль.
235-239 - альфа-спираль.
238-248 - программная 255-спираль.
247-259 - альфа-спираль.
261-271 - альфа-спираль.
273-283 - альфа-спираль.
285-290 - альфа-спираль.
295-302 - альфа-спираль.
307-326 - альфа-спираль.
336-348 - альфа-спираль.