851

Re: Формы, механизмы, энергия наномира - 92

Victoriy пишет:

для каждого из Ваших примеров 3D структур Вы САМОСТОЯТЕЛЬНО формируете досье (код белка, степень его изученности, организм, экспериментальные сведения о структуре, нуклеотидная последовательность и его аминокислотная последовательность, функция) и выкладываете последовательного в постах Вашего сайта. Обещаю просмотреть и отписаться. А пока обсуждать нечего.

Кушелев: Я уже специльно для Вас нашёл не гипотетические белки, причём ещё вчера:

https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png

852

Re: Формы, механизмы, энергия наномира - 92

Kushelev пишет:
Victoriy пишет:

для каждого из Ваших примеров 3D структур Вы САМОСТОЯТЕЛЬНО формируете досье (код белка, степень его изученности, организм, экспериментальные сведения о структуре, нуклеотидная последовательность и его аминокислотная последовательность, функция) и выкладываете последовательного в постах Вашего сайта. Обещаю просмотреть и отписаться. А пока обсуждать нечего.

Кушелев: Я уже специльно для Вас нашёл не гипотетические белки, причём ещё вчера:

https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png

А что Вы можете о них сказать? Выложите досье на один, самый интересный для Вас белок, и мы обсудим его структуру, декодированную Вами и в моей программе.

853

Re: Формы, механизмы, энергия наномира - 92

Формы, механизмы, энергия наномира. Сообщение 92 853

Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

А что Вы можете о них сказать? Выложите досье на один, самый интересный для Вас белок, и мы обсудим его структуру, декодированную Вами и в моей программе.

Давайте начнём с первого:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Если он чем-то плох, то есть аналогичный:

https://www.ncbi.nlm.nih.gov/nuccore/943392557
>ENA|KXJ25885.1
atgactgagactcggacgttggccaccagttttttactgcttagtattgtatacattgca
gggttttatattctggaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaag

Что касается "досье", то я не понимаю, что от меня требуется. Если Вы согласны, что белок реальный, то в чём проблема?

Что показывает для него моя программа, Вы знаете. Одну прямую пи-спираль.

854

Re: Формы, механизмы, энергия наномира - 92

Письмо, которое нужно разослать по лабораториям РСА

Упрощённый вариант письма:

Тема: Заказ структуры белка

Уважаемый ***** !
Прошу Вас рассмотреть нашу заявку на определение структуры белка:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

и выслать мне предложение и прайс-лист для заключения договора с Вашей лабораторией.

Связь со мной по e-mail

С уважением,

855

Re: Формы, механизмы, энергия наномира - 92

Кушелев:
Это, конечно, здОрово, но когда человек даёт советы, большинство из которых
мягко говоря абракадабра, то к нему и относятся, как к генератору бреда,
который случайно может и умную мысль выдать.
бОльшая часть сообщений - бред.

могу привести только один маленький пример из ~ двух десятков.
я Вам ещё в 2010 году давал ссылки на наши работы по феРРоптозу
и аноикису, но для Вас это как обычно была галиматья, абракадабра и бред.
вот теперь можете посмотреть на идущий поезд в который Вы не запрыгнули:
https://indicator.ru/article/2017/11/22 … votovskij/
а вместо этого хотите запрыгнуть в несуществующий поезд на станции
до которой ещё не провели железную дорогу.

856

Re: Формы, механизмы, энергия наномира - 92

diprospan пишет:

Кушелев:
Это, конечно, здОрово, но когда человек даёт советы, большинство из которых
мягко говоря абракадабра, то к нему и относятся, как к генератору бреда,
который случайно может и умную мысль выдать.
бОльшая часть сообщений - бред.

могу привести только один маленький пример из ~ двух десятков.
я Вам ещё в 2010 году давал ссылки на наши работы по феРРоптозу
и аноикису, но для Вас это как обычно была галиматья, абракадабра и бред.
вот теперь можете посмотреть на идущий поезд в который Вы не запрыгнули:
https://indicator.ru/article/2017/11/22 … votovskij/
а вместо этого хотите запрыгнуть в несуществующий поезд на станции
до которой ещё не провели железную дорогу.

Кушелев: Эта тема безусловно актуальна, но ... меня интересует отключение феноптоза, а не десятки способов апоптоза smile

857

Re: Формы, механизмы, энергия наномира - 92

https://www.youtube.com/watch?v=1L3_Hor … 0223302799

transformer7171: Верно.
Я не должен знать как надо работать, ибо этому я не учу.
Также я не должен знать как надо учить, ибо этому я также не учу.
Но я обязан знать как надо учить тех кто учит, ибо этому я учу.
(Знание о знаниях, или метазнание.)
Каждый должен знать то чему он учит.
И только работяга должен уметь работать, знать он ничего не должен :-)

Александр Кушелев: Вы забыли о критерии истины. А это - практика. Кто не знает, как работать, тот не сможет работать. А тем более учить, а тем более учить, как надо учить. Конечно, теоретик не должен быть экспериментатором и наоборот, но знать основные методы эксперимента должен. А Вы, как я понял, оторвались от реальности smile

858

Re: Формы, механизмы, энергия наномира - 92

Заказ 2017-11-26_06:

https://www.ncbi.nlm.nih.gov/nuccore/NC … mask=65536

>11889961_gen
agcgcagaaaacggagcaaaagagtctaaaagcggagagggtgcacatttctagcgcaga
aaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggg
gcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggcaaaag
agtctaaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtctaaa
agcggagagagagcgcatttctagcgcagaaaaacggggcaaaagagtctaaaagcggag
agagagcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagagagagc
gcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagagagagcgcatttc
tagcgcagaaaaatggggcaaaagagtctaaaagcggagagagagcgcatttctagcgca
gaaaaatggggcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaacg
gagcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggcaaa
agagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggcaaaagagtct
aaaagcggagagagagcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcg
gagagagagcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagagag
agcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatt
tctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgc
agaaaaatggggcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaac
ggagcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggcaa
aagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggcaaaagagtc
taaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcg
gagagagagcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagagag
agcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatt
tctagcgcagaaaaatggggcaaaagagtctaaaagcggagagagagcgcatttctagcg
cagaaaaatggggcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaa
atggggcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggc
aaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagt
ctaaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtctaaaagc
ggagagagagcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagaga
gagcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcat
ttctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcg
cagaaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaa
tggggcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaacggagcaa
aagagtctaaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtct
aaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcgg
agagagagcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagagaga
gcgcatttctagcgcagaaaaatggggcaaaagagtctaaaagcggagagagagcgcatt
tctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgc
agaaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaat
ggggcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatggggcaa
aagagtctaaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtct
aaaagcggagagagagcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcgg
agagagagcgcatttctagcgcagaaaacggagcaaaagagtctaaaagcggagagagag
cgcatttctagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatttc
tagcgcagaaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgcag
aaaacggagcaaaagagtctaaaagcggagagagagcgcatttctagcgcagaaaaatgg

Результат:

https://img-fotki.yandex.ru/get/369087/158289418.4a9/0_186fc1_633c0f14_XL.png

Сдвинем рамку считывания на 1 символ.

https://img-fotki.yandex.ru/get/509292/158289418.4aa/0_1870c2_baa66a95_XL.png

Сдвинем рамку считывания еще на 1 символ.

https://img-fotki.yandex.ru/get/486600/158289418.4aa/0_1870c3_a9b0083f_XL.png

Сделаем комплементарное преобразование кода

https://img-fotki.yandex.ru/get/769660/158289418.4aa/0_1870c4_c0411d24_XL.png

Сдвинем рамку считывания на 1 символ

https://img-fotki.yandex.ru/get/480548/158289418.4aa/0_1870c5_4dd7e28b_XL.png

Сдвинем рамку считывания еще на 1 символ

https://img-fotki.yandex.ru/get/480548/158289418.4aa/0_1870c6_cb375fcd_XL.png

Все 6 вариантов прочтения кода не соответствуют структуре белка. Либо этот код рассчитан на сборку из кусков CDS, либо этот код не является кодом белка.

859

Re: Формы, механизмы, энергия наномира - 92

http://nanoworld.org.ru/post/96117/#p96117

Тарасенко пишет:

вам жалко миллионы которые дают Росси на исследования или вы патриоты от науки...

Инвесторы, которые не хотят выбрасывать свои деньги на ветер, могут заказать независимую экспертизу в лаборатории Наномир: http://nanoworld.org.ru/topic/1828/

860

Re: Формы, механизмы, энергия наномира - 92

Skype:

[26.11.2017 17:23:06] Кушелев Александр Юрьевич: Привет! Можешь обработать такой геномный файл? https://www.ncbi.nlm.nih.gov/nuccore/NC … mask=65536
[26.11.2017 17:44:49] Кушелев Александр Юрьевич: Какая-то странная ошибка. Первый файл обрабатывает, а остальные не хочет. А в них просто убавляется по одному символу кода.
[26.11.2017 17:49:24] Va12220(Valqwa): да уж. нарушение принципа тройки видимо
попробуй убирать 3 символа за раз
один в начале и соответственно 2 сзади цепочки
[26.11.2017 17:50:22] Va12220(Valqwa): затем 2 спереди и один сзади
затем 3 спереди и ничего сзади
[26.11.2017 18:34:04] Кушелев Александр Юрьевич: Дело не в этом. Другая пачка с не кратным числом символов прекрасно обработалась: http://nanoworld.org.ru/post/96094/#p96094
[26.11.2017 18:34:50] Кушелев Александр Юрьевич: А если кратность - проблема, то её нужно решить в программе. Я подожду smile
[26.11.2017 21:31:59] Кушелев Александр Юрьевич: Привет! Прога CDS может обработать этот файл?
[26.11.2017 21:52:02] Кушелев Александр Юрьевич: Что-то прога Пикотех CDS не хочет обрабатывать файл .gb Может я не то расширение файла написал?
[26.11.2017 21:52:57] Кушелев Александр Юрьевич: Попробуй запустить на своём компьютере. А вдруг, о чудо, нарубит фасты?
[26.11.2017 21:53:32] Кушелев Александр Юрьевич: Вручную собирать CDS из этого файла нереально: https://www.ncbi.nlm.nih.gov/nuccore/NC … mask=65536
[26.11.2017 21:54:15] Кушелев Александр Юрьевич: А мне нужно все CDS из этого файла обработать...
[26.11.2017 22:25:05] Va12220(Valqwa): аппетиты у тебя - 923 структуры! CDS
[26.11.2017 22:31:53] Va12220(Valqwa): ЗАБИРАЙ!
[26.11.2017 22:35:17] Va12220(Valqwa):
Не кочегары мы, не плотники,
Но сожалений горьких нет,
мы программисты - беспредельщики,
И с беспределов шлем привет.
[26.11.2017 22:36:53] Va12220(Valqwa): замени файлик  - изменено кое-что
[26.11.2017 22:37:41] Va12220(Valqwa): расширение долно быть GBK у обарабатываемых файлов
[26.11.2017 22:56:17] Va12220(Valqwa): картинки тоже сделаю. жди чуток.
[26.11.2017 23:01:21] Кушелев Александр Юрьевич: Благодарю!
[26.11.2017 23:11:28] Кушелев Александр Юрьевич: Что-то фасты неправильные получились. Сплошные TKD...
[26.11.2017 23:12:19] Va12220(Valqwa): а файл ты мне верный дал ?
[26.11.2017 23:13:13] Кушелев Александр Юрьевич: Я же тебе и ссылку на него в инете дал: https://www.ncbi.nlm.nih.gov/nuccore/NC … mask=65536
[26.11.2017 23:15:08] Кушелев Александр Юрьевич: И ещё я заметил, что фасты как-то криво пронумерованы, т.е. в папке они вроде по порядку расположены, но обрабатываются не по порядку. Нужно их нумеровать типа 001, 002 и т.д., а не 1, 2, ...
[26.11.2017 23:15:53] Кушелев Александр Юрьевич: После первого обработан 10-ый
[26.11.2017 23:15:54] Va12220(Valqwa): в общем надо глубже копать
[26.11.2017 23:16:02] Кушелев Александр Юрьевич: Слегка smile
[26.11.2017 23:16:45] Va12220(Valqwa): так и верно - сначала все что на 1 начинаются, потом на 2 и т.д )
[26.11.2017 23:17:00] Va12220(Valqwa): второе - это то что у меня по ссылке твоей получилось
[26.11.2017 23:17:01] Кушелев Александр Юрьевич: А нужно, чтобы номера были 001...999
[26.11.2017 23:23:24] Va12220(Valqwa): глубже - это немного иное.
там есть CDS с
форматом JOIN
форматом COMPLEMENT
просто последовательностью - "от и до"
и даже 'complement(join'

все что содержит комплемент - у меня по моему ещё не обрабатывается
[26.11.2017 23:23:56] Va12220(Valqwa): и вот прямо сейчас не сделаю. занят
[26.11.2017 23:29:32] Кушелев Александр Юрьевич: Join - это как раз "сшить" из кусков. А Complement ты знаешь. Заменить A -> T, T -> A, G -> C, C -> G и написать "задом наперед"
[26.11.2017 23:29:47] Кушелев Александр Юрьевич: Ты вроде уже делал
[26.11.2017 23:30:31] Кушелев Александр Юрьевич: Ради этого и сыр-бор. Сшивать 30 кусков - жуткое дело, а если так 900 раз, то ещё и гиблое...
[2:46:44] Кушелев Александр Юрьевич: Из 900 файлов fasta программа почему-то обработала только 6 и выдала ошибку. Все CDS собраны неправильно. Что-то я припоминаю, что мы уже вроде решали эту проблему полгода назад. Может это старая версия алгоритма?
[10:06:01] Кушелев Александр Юрьевич: Привет! В первом CDS нет команды complement, но фаста неправильная. Вот первый CDS:
[10:06:02] Кушелев Александр Юрьевич: CDS             join(5012..5016,8168..8232,10373..10735,10821..11038,
                     12795..12845)
[10:07:42] Кушелев Александр Юрьевич: join означает, что нужно срастить код с символа под номерами от 5012 до 5016 со следующими участками кода, т.е. от 8168 до 8232 и далее по списку.
[10:08:08] Кушелев Александр Юрьевич: Раньше твоя прога вроде это делала. Может в этом файле другая кодировка пробелов и переносов строки?
[10:09:07] Кушелев Александр Юрьевич: Или может твоя прога не всегда может игнорить цифры в строках кода?
[10:10:14] Кушелев Александр Юрьевич: Посмотри, как работают эти преобразования: http://www.molbiol.ru/scripts/01_12.html
[10:10:30] Кушелев Александр Юрьевич: Там игнорится всё, кроме символов кода.
[10:11:07] Кушелев Александр Юрьевич: Я туда бросаю куски по CDS, и они сшиваются и комплементятся, если надо.
[10:12:11] Кушелев Александр Юрьевич: Нам для программы Пикотех нужно сделать подпрограмму, которая сможет так же обрабатывать CDS, только ещё и автоматически выкусывать куски кода для сшивания.
[10:13:52] Кушелев Александр Юрьевич: Я помню, что одна из последних геномных версий корректно обрабатывала некоторые CDS с командой join. И ты даже вроде complement реализовал. А сейчас прога явно неправильную фасту генерит.
[10:14:14] Кушелев Александр Юрьевич: Даже без команды complement