341

Re: Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

Вы в курсе об особенностях генетического кода растений, а тем более грибов, и чем он отличается от животных? Там даже аминокислоты по другому кодируются.

Кушелев: Мне удалось выяснить, что даже код митохондрий композиционный, не то что код растений. А то, что у некоторых организмов иначе кодируются некоторые аминокислоты, ничего страшного. Так что делать будем с лизиновым "хвостом" длиной 263 аминокислотных остатка? Ваша программа вроде то же самое показывает. Или я ошибаюсь?

Victoriy пишет:

я ещё не стала дальше разбираться с Вашими "чудо"-открытиями. Времени простите нет.

А программные спирали есть. Жаль, что Вам не хватило времени в этом убедиться. Здесь Вы можете увидеть десятки типов программных спиралей. Некоторые из них во всю длину белковой молекулы: http://nanoworld.org.ru/topic/1656/

Там есть гипотетические белки, но много не гипотетических, а как раз таких, о которых Вы пишите:

Victoriy пишет:

из протеин-банка с наиболее полно установленной структурой

Правда, речь идёт о первичной структуре и нуклеотидной последовательности. Далее хотелось бы услышать Ваши комментарии вторичных структур, которые определяет не только моя, но и Ваша программа. Своей-то программе Вы доверяете или как? wink

342

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 92 821

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

http://nanoworld.org.ru/topic/1656/page/13/

Kushelev пишет:

Заказ 2017-11-19_17:

https://www.ncbi.nlm.nih.gov/nuccore/1129206831

>OLQ08878
atgcgacaagcagccccagcgggtcctccgagaggtgagctgaacggcctgtccaggtcc
gatccacgagcgctaatggctgcagcagcagcgaaggtggcccagacgtctgtggttccg
gagagattagttgagagcagctcctcaagcagcaagccggcggctccctcagccggacag
tgtgcgtgcgcgtgcgtgtgcgtgtgcgtgtgcgtgtgcgtgtgcgtgcgcgtgtgcgcg
tgtgtgtgtgtgtgcgcgtgtngtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtctgt
gtgtgtgcatgttacatagcattcatgacaacaagaccggtcagtcttgtcatcaccatc
atcattgccaccatcttcaccatcgtcctcgtaggtcgtaggtga

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4a5/0_186966_1f6e83a7_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/877150/158289418.4a5/0_186967_f33d2f73_XL.png
Оригинал: https://img-fotki.yandex.ru/get/877150/ … 3_orig.png

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-26_01:

P43537

http://www.uniprot.org/uniprot/P43537

https://www.ebi.ac.uk/ena/data/view/BAA … play=fasta

>ENA|BAA09174|BAA09174.1 Saccharomyces cerevisiae (baker's yeast) hypothetical protein
ATGGAATCTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGCACTAGCGTT
GGTGCTGGCAGTGGTAGTAGCATTAGTCCTGACGTTGATGCTGGCAGTGGTAGTCGCACT
AGTCCTGACGTTGATGCTGGCAGTGGTAGTCGCATTAGTGCTGGAGTTGGTACTTTCAGT
GGTAGTAGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTT
GGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTAGTCGCATTGGTACTGGCATT
GGTAGTCGCATTGGTACTGGCATTGGTACTGGCATTGGTAGTCGCATTAGTACTAGCATT
GGTAGTCGCATTAGTCCTGACGTTGGTACTAGCAGTGGTAATCGCATTAGTACTGGCGTT
AGTACTGGCATTAGCACTACCATGAATGCACGTGTCGCTGTCCTCATCACTGCTGCAATA
CTTTCTGCACCTGTCACTGCTATTGCTCTCCTGGAAGCTAGACGGTAA

Результат:

https://img-fotki.yandex.ru/get/876523/158289418.4a9/0_186f8d_7bef5217_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/876523/158289418.4a9/0_186f8e_c7df3c71_XL.png
Оригинал: https://img-fotki.yandex.ru/get/876523/ … 1_orig.png

Кушелев: Белок с протяженной программной 35-спиралью в базе данных ассоциирован с другим белком из базы UNIPROT с протяженным участком программной 3335-спирали.

https://img-fotki.yandex.ru/get/478477/158289418.4a9/0_186f90_173214ef_orig.png
Так изображена структура этого белка в базе данных UNIPROT: https://www.proteinmodelportal.org/?pid … ;zid=async

Мы видим, что пикотехнологическая модель не противоречит официальной модели. Просто она более детальная smile

343

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 92 853

Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

А что Вы можете о них сказать? Выложите досье на один, самый интересный для Вас белок, и мы обсудим его структуру, декодированную Вами и в моей программе.

Давайте начнём с первого:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Если он чем-то плох, то есть аналогичный:

https://www.ncbi.nlm.nih.gov/nuccore/943392557
>ENA|KXJ25885.1
atgactgagactcggacgttggccaccagttttttactgcttagtattgtatacattgca
gggttttatattctggaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaag

Что касается "досье", то я не понимаю, что от меня требуется. Если Вы согласны, что белок реальный, то в чём проблема?

Что показывает для него моя программа, Вы знаете. Одну прямую пи-спираль.

344

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 92 867

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 92 853

Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

А что Вы можете о них сказать? Выложите досье на один, самый интересный для Вас белок, и мы обсудим его структуру, декодированную Вами и в моей программе.

Давайте начнём с первого:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Если он чем-то плох, то есть аналогичный:

https://www.ncbi.nlm.nih.gov/nuccore/943392557
>ENA|KXJ25885.1
atgactgagactcggacgttggccaccagttttttactgcttagtattgtatacattgca
gggttttatattctggaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaag

Что касается "досье", то я не понимаю, что от меня требуется. Если Вы согласны, что белок реальный, то в чём проблема?

Что показывает для него моя программа, Вы знаете. Одну прямую пи-спираль.

Кушелев: Вот, что для этого белка показывает алгоритм от Кушелева и от Виктории Соколик:

https://img-fotki.yandex.ru/get/893753/158289418.4aa/0_187195_bcb5486a_orig.gif

Мы знаем, что пи-спирали белков существуют. Интересно, как Вы получите ту же пи-спираль "другим способом"?

345

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира - 92

Victoriy пишет:

"программные" спирали являются комбинацией этих разновидностей.

Кушелев: Если Вы признаёте существование программных спиралей, то

1. Во-первых, почему они не изображаются у Вас на уровне 2D-структуры?
2. О каком фолдинге может идти речь, если 3D модель программных спиралей строится по таблице композиционного кода?

https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png

346

Re: Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

Специфика 3/10, пи- и альфа-спиралей формируется уже в ходе процесса фолдинга на основе простейшего структурного шаблона 3/10 спирали.

Кушелев: А тут подробнее, пожалуйста.

Вот вторичная структура двух полилизинов:

https://img-fotki.yandex.ru/get/892397/158289418.4a9/0_186f36_d8ccd8b5_orig.png
Обе иллюстрации, чтобы Вы смогли их увидеть на Украине, я продублирую для Вас по скайпу.

Вот, что показывает для пи-спирали алгоритм Кушелева и Соколик:

https://img-fotki.yandex.ru/get/893753/158289418.4aa/0_187195_bcb5486a_orig.gif

Ваш алгоритм 2D ничего не показывает. Откуда при 3D моделировании у Вас появляется пи-спираль? Каков конкретный алгоритм Вашей 3D программы, который строит пи-спираль по коду:

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Если не секрет, конечно smile

347

Re: Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

А.Ю., если Вам интересны 3D-модели Ваших белков в моей программе, то потрудитесь её (программу МС) найти в своём архиве (я Вам несколько раз уже присылала) и стройте.

Кушелев: Ваша программа, к сожалению, на моём компьютере не хочет работать. Там нужно какие-то хитрые настройки делать. Но я и так помню, что она прекрасно строит спирали из метионина. А Вы только что написали, что и программные спирали она тоже строит. Вот мне и интересно, по какому алгоритму, если не по таблице композиционного генетического кода Ваша программа строит программные или хотя бы пи-спираль?

Если алгоритм 2D пи-спираль не показывает, то с чего её фолдировать-то? Если Вы пишите, что основой является 310-спираль, то каков алгоритм фолдирования 310-спирали в пи-спираль? Почему один и тот же полилизин с кодом n(AAA) по Вашему 3D алгоритму фолдирует из 310-спирали в пи-спираль, а тот же полилизин с кодом n(AAG) из 310-спирали по Вашему 3D алгоритму фолдирует в прямую альфа-спираль. Что за чудо-алгоритм такой? Расскажите подробнее, как он работает для случая n(AAA) и n(AAG) ?

В моём алгоритме всё предельно просто. По коду AAA из таблицы композиционного кода извлекается композиционный код пи-спирали и синий "кирпичик". По коду AAG - композиционный код альфа-спирали и красный "кирпичик".

Вы писали, что "мы получим одинаковый результат, но разными способами". Вот мне и любопытно, как конкретно по коду n(AAA) вы сначала получаете 310-спираль, а потом "волшебным фолдингом" из 310-спирали пи-спираль.

Ну и при этом если код n(AAG), то "волшебный фолдинг" из той же 310-спирали-шаблона делает не пи-спираль, а альфа-спираль. Что это за волшебство, если не секрет, конечно...

348

Re: Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

декодированные спиральные структуры белка не обязательно сохраняются в полном объёме в его функциональной конформации после фолдинга: нередко они полностью трансформируются в бета-тяжи и петлевые структуры/повороты.  Пересмотрите примеры в монографии "Пикотехнология белков", там много таких белков.

Кушелев: Вот мне и интересно, как эти два белка (пи-спиральный и альфа-спиральный) моделируются в Вашей программе. Можно пошагово показать, как по коду n(AAA) Ваша программа получает пи-спираль, а по коду n(AAG) - альфа-спираль. И ещё очень интересно посмотреть Вашу 3D модель программной 35-спирали, когда коды AAA и AAG чередуются. По моей таблице композиционного кода получается такая модель:

https://img-fotki.yandex.ru/get/52656/158289418.3e5/0_176e45_d9eaf001_orig.png
Пример программной 35-спирали (компактное 2D-представление)

https://img-fotki.yandex.ru/get/169883/158289418.3df/0_1760dd_d85de618_orig.png
Пример программной 35-спирали (развернутое 2D-представление)

https://img-fotki.yandex.ru/get/198860/158289418.3e0/0_176329_6d9df850_L.gif
Подробнее: https://subscribe.ru/archive/science.ne … 3210.html/
3D-модель белковой молекулы с программной 35-спиралью.

349

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 92 907

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Создана геномная версия программы Пикотех 2D

Комплексный заказ 2017-11-29 на 923 структуры белка.

Кушелев: Создана геномная версия программы Пикотех 2D, которая может показать структуру всех белков данного организма. По этому адресу можно скачать 923 структуры белка (Astyanax mexicanus chromosome 1), полученные с помощью геномной версии программы Пикотех 2D за один запуск: https://cloud.mail.ru/public/CiLX/v2Kc3PmgC

https://img-fotki.yandex.ru/get/872977/158289418.4ac/0_18766e_6e6c01b1_orig.png

350

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 92 919

Общество вимановладельцев

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-29_10:

https://www.rcsb.org/pdb/explore.do?structureId=1FBB

1FBB
CRYSTAL STRUCTURE OF NATIVE CONFORMATION OF BACTERIORHODOPSIN

https://img-fotki.yandex.ru/get/480548/158289418.4ac/0_187901_2913ef6_XL.png

http://www.uniprot.org/uniprot/P02945

https://img-fotki.yandex.ru/get/896238/158289418.4ac/0_187927_894d1439_XL.png

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA23744|CAA23744.1 Halobacterium salinarum hypothetical protein
ATGTTGGAGTTATTGCCAACAGCAGTGGAGGGGGTATCGCAGGCCCAGATCACCGGACGT
CCGGAGTGGATCTGGCTAGCGCTCGGTACGGCGCTAATGGGACTCGGGACGCTCTATTTC
CTCGTGAAAGGGATGGGCGTCTCGGACCCAGATGCAAAGAAATTCTACGCCATCACGACG
CTCGTCCCAGCCATCGCGTTCACGATGTACCTCTCGATGCTGCTGGGGTATGGCCTCACA
ATGGTACCGTTCGGTGGGGAGCAGAACCCCATCTACTGGGCGCGGTACGCTGACTGGCTG
TTCACCACGCCGCTGTTGTTGTTAGACCTCGCGTTGCTCGTTGACGCGGATCAGGGAACG
ATCCTTGCGCTCGTCGGTGCCGACGGCATCATGATCGGGACCGGCCTGGTCGGCGCACTG
ACGAAGGTCTACTCGTACCGCTTCGTGTGGTGGGCGATCAGCACCGCAGCGATGCTGTAC
ATCCTGTACGTGCTGTTCTTCGGGTTCACCTCGAAGGCCGAAAGCATGCGCCCCGAGGTC
GCATCCACGTTCAAAGTACTGCGTAACGTTACCGTTGTGTTGTGGTCCGCGTATCCCGTC
GTGTGGCTGATCGGCAGCGAAGGTGCGGGAATCGTGCCGCTGAACATCGAGACGCTGCTG
TTCATGGTGCTTGACGTGAGCGCGAAGGTCGGCTTCGGGCTCATCCTCCTGCGCAGTCGT
GCGATCTTCGGCGAAGCCGAAGCGCCGGAGCCGTCCGCCGGCGACGGCGCGGCCGCGACC
AGCGACTGA

https://img-fotki.yandex.ru/get/872977/158289418.4ac/0_187928_b06eb9c0_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/876984/158289418.4ac/0_187929_996d197_XL.png
Оригинал: https://img-fotki.yandex.ru/get/876984/ … 7_orig.png

Кушелев: Мы видим, что в первом приближении структура бактериородопсина, показанная программой Пикотех 2D соответствует вторичной структуре этого белка из Protein Data Base. При этом программа Пикотех показывает тонкую структуру спиралей, т.е. дает существенно больше информации, чем удалось получить методом РСА и другими. Понятно и другое преимущество. Время. Его пришлось затратить в миллионы раз меньше smile