141

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 685

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

Программная аллотропия белков опровергает гипотезу фолдинга

Victoriy пишет:

фолдинг этих самых структурных шаблонов в энергетически устойчивую функциональную конформацию

Кушелев: Уважаемая Виктория! Как Вы прокомментируете открытие программных спиралей белковых молекул?

https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png
Здесь Вы видите 19 вторичных структур поливалина. На схеме вторичной структуры представлены фундаментальные спирали:
альфа-, 310-, пи-, бета-
и программные:
14-, 35-, 352-, 144-, 25-, 22225-, 411412-, 255-, 2444-, 1144-, 11444444-, 23-, 335(коллагеновая)-

Помните, как мы с Вами дискутировали по поводу лизиновых "хвостов", т.е. участков пи-спиралей длиной более 10 аминокислотных остатков? Вы ещё писали, что это всё гипотетические структуры...

А как Вы прокомментируете тему: "Рекорды сверхдлинных спиралей белковых молекул"?

Там встречаются фундаментальные спирали (альфа-, 310-, пи-, бета-) длиной более 3000 аминокислотных остатков. И программные спирали, в т.ч. фрактальные более 100 периодов, например, по 35 аминокислотных остатков в периоде, т.е. более 3500 аминокислотных остатков в спирали.

Если бы была верна гипотеза фолдинга, то зачем было бы кодировать все эти спиральные структуры?

Антигомология = программная аллотропия опровергает гипотезу фолдинга. Согласны?

142

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 727

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-25_04:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Результат:

https://img-fotki.yandex.ru/get/872977/158289418.4a8/0_186f28_9609f17b_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/478910/158289418.4a8/0_186f29_f1769699_XL.png
Оригинал: https://img-fotki.yandex.ru/get/478910/ … 9_orig.png

Нашёлся лизиновый "хвост" длиной 263 аминокислотных остатка Lys. Рекорд однако...

143

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ 2017-11-25_05:

https://www.ncbi.nlm.nih.gov/nuccore/700454480

>KGO44433
atggacaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagtga

Результат:

https://img-fotki.yandex.ru/get/878955/158289418.4a8/0_186f2a_83132c7f_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/914553/158289418.4a9/0_186f2b_d3b23609_XL.png
Оригинал: https://img-fotki.yandex.ru/get/914553/ … 9_orig.png

Мы видим, что лизиновые "хвосты" бывают не только пи-спиральными, но и альфа-спиральными...
Аутоантигомология...

144

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ 2017-11-25_06:

https://www.ncbi.nlm.nih.gov/nuccore/632911273

>KDB11191
atgaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaag
aagaagaagaagaagaagaagaagaagaagaagaagaagaagacgaagaattggttggtt
acgggtcaaatcgcggaaatggaatttaaaaaagcaaaggaggaagtgagacttgctgcc
aaatcaaactgcatcaagtcatga

Результат:

https://img-fotki.yandex.ru/get/480022/158289418.4a9/0_186f2c_5a5e1c4c_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/892397/158289418.4a9/0_186f2d_7db06094_XL.png
Оригинал: https://img-fotki.yandex.ru/get/892397/ … 4_orig.png

Это уже не "хвост", а "нос", но тоже представленный прямой альфа-спиралью полилизина...

145

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 821

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

http://nanoworld.org.ru/topic/1656/page/13/

Kushelev пишет:

Заказ 2017-11-19_17:

https://www.ncbi.nlm.nih.gov/nuccore/1129206831

>OLQ08878
atgcgacaagcagccccagcgggtcctccgagaggtgagctgaacggcctgtccaggtcc
gatccacgagcgctaatggctgcagcagcagcgaaggtggcccagacgtctgtggttccg
gagagattagttgagagcagctcctcaagcagcaagccggcggctccctcagccggacag
tgtgcgtgcgcgtgcgtgtgcgtgtgcgtgtgcgtgtgcgtgtgcgtgcgcgtgtgcgcg
tgtgtgtgtgtgtgcgcgtgtngtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggt
gtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtgggtgtctgt
gtgtgtgcatgttacatagcattcatgacaacaagaccggtcagtcttgtcatcaccatc
atcattgccaccatcttcaccatcgtcctcgtaggtcgtaggtga

Результат:

https://img-fotki.yandex.ru/get/872132/158289418.4a5/0_186966_1f6e83a7_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/877150/158289418.4a5/0_186967_f33d2f73_XL.png
Оригинал: https://img-fotki.yandex.ru/get/877150/ … 3_orig.png

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-26_01:

P43537

http://www.uniprot.org/uniprot/P43537

https://www.ebi.ac.uk/ena/data/view/BAA … play=fasta

>ENA|BAA09174|BAA09174.1 Saccharomyces cerevisiae (baker's yeast) hypothetical protein
ATGGAATCTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGCACTAGCGTT
GGTGCTGGCAGTGGTAGTAGCATTAGTCCTGACGTTGATGCTGGCAGTGGTAGTCGCACT
AGTCCTGACGTTGATGCTGGCAGTGGTAGTCGCATTAGTGCTGGAGTTGGTACTTTCAGT
GGTAGTAGCACTAGTCCTGACGTTGATGCTGGCAGTGGTAGTAGCACTAGTCCTGACGTT
GGTGCTGGCAGTGGTAGTAGCATTAGTGCTGGAGTTGGTAGTCGCATTGGTACTGGCATT
GGTAGTCGCATTGGTACTGGCATTGGTACTGGCATTGGTAGTCGCATTAGTACTAGCATT
GGTAGTCGCATTAGTCCTGACGTTGGTACTAGCAGTGGTAATCGCATTAGTACTGGCGTT
AGTACTGGCATTAGCACTACCATGAATGCACGTGTCGCTGTCCTCATCACTGCTGCAATA
CTTTCTGCACCTGTCACTGCTATTGCTCTCCTGGAAGCTAGACGGTAA

Результат:

https://img-fotki.yandex.ru/get/876523/158289418.4a9/0_186f8d_7bef5217_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/876523/158289418.4a9/0_186f8e_c7df3c71_XL.png
Оригинал: https://img-fotki.yandex.ru/get/876523/ … 1_orig.png

Кушелев: Белок с протяженной программной 35-спиралью в базе данных ассоциирован с другим белком из базы UNIPROT с протяженным участком программной 3335-спирали.

https://img-fotki.yandex.ru/get/478477/158289418.4a9/0_186f90_173214ef_orig.png
Так изображена структура этого белка в базе данных UNIPROT: https://www.proteinmodelportal.org/?pid … ;zid=async

Мы видим, что пикотехнологическая модель не противоречит официальной модели. Просто она более детальная smile

146

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 838

Рекорды сверхдлинных спиралей белковых молекул

Программная аллотропия белков опровергает гипотезу фолдинга

Online service PROTEIN PICOTECHNOLOGY

https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png

147

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 867

Kushelev пишет:

Формы, механизмы, энергия наномира. Сообщение 92 853

Пикотехнология белков, ДНК, РНК - 3

Victoriy пишет:

А что Вы можете о них сказать? Выложите досье на один, самый интересный для Вас белок, и мы обсудим его структуру, декодированную Вами и в моей программе.

Давайте начнём с первого:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_022674627.1 PREDICTED: Astyanax mexicanus protein FAM133-like (LOC111193520), partial mRNA
GTCCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA

Если он чем-то плох, то есть аналогичный:

https://www.ncbi.nlm.nih.gov/nuccore/943392557
>ENA|KXJ25885.1
atgactgagactcggacgttggccaccagttttttactgcttagtattgtatacattgca
gggttttatattctggaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaagaa
gaagaagaag

Что касается "досье", то я не понимаю, что от меня требуется. Если Вы согласны, что белок реальный, то в чём проблема?

Что показывает для него моя программа, Вы знаете. Одну прямую пи-спираль.

Кушелев: Вот, что для этого белка показывает алгоритм от Кушелева и от Виктории Соколик:

https://img-fotki.yandex.ru/get/893753/158289418.4aa/0_187195_bcb5486a_orig.gif

Мы знаем, что пи-спирали белков существуют. Интересно, как Вы получите ту же пи-спираль "другим способом"?

148

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 868

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-27_04:

https://www.ncbi.nlm.nih.gov/nuccore/1129196593

>ENA|OLQ00702
gatgcgacgacgattgctactacatctactactccctagcttgcacggtgtgctctctgt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttggttggttggttggt
tggttggttggttggttggttggttggttggttggttggttggttg

Результат:

https://img-fotki.yandex.ru/get/914553/158289418.4aa/0_187199_e5315820_XL.png

Сдвигаем рамку считывания на 1 символ

https://img-fotki.yandex.ru/get/516062/158289418.4aa/0_18719a_b8591bc3_XL.png

Сдвигаем рамку считывания еще на 1 символ

https://img-fotki.yandex.ru/get/516062/158289418.4aa/0_18719b_d619b7b2_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/9760/158289418.4aa/0_18719c_97f238db_XL.png https://img-fotki.yandex.ru/get/477594/158289418.4aa/0_18719d_970c4d7a_XL.png https://img-fotki.yandex.ru/get/372697/158289418.4aa/0_18719e_d682edd2_XL.png

Оригиналы:
https://img-fotki.yandex.ru/get/9760/15 … b_orig.png
https://img-fotki.yandex.ru/get/477594/ … a_orig.png
https://img-fotki.yandex.ru/get/372697/ … 2_orig.png

Мы видим, что программная спираль инвариантна относительно сдвига рамки считывания.

https://img-fotki.yandex.ru/get/516062/158289418.4aa/0_18719f_82d882ea_orig.png
Мажорная позитивная музыка сборки этой программной спирали.

Эту программную спираль алгоритм Виктории Соколик не показывает:

https://img-fotki.yandex.ru/get/477594/158289418.4aa/0_1871a0_6b391b75_XL.gif
Оригинал: https://img-fotki.yandex.ru/get/477594/ … 5_orig.gif

Кстати, не имеет значения, гипотетический это белок или не гипотетический. Ведь нуклеотидная последовательность в любом случае реальная. А значит по ней можно синтезировать белок однозначно, если внутри последовательности не встречается стоп-кодонов.

149

Re: Рекорды сверхдлинных спиралей белковых молекул

Заказ 2017-11-27_05:

https://www.ncbi.nlm.nih.gov/nuccore/1129196593

>ENA|OLQ00701_fr01
tactncttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttctacttctacttctacttctacttctacttctacttctacttctac
ttctacttctacttcttctactactactactactgctactaa

Результат:

https://img-fotki.yandex.ru/get/477137/158289418.4aa/0_1871a1_25464fdb_XL.png

Сдвигаем рамку считывания на 1 символ

https://img-fotki.yandex.ru/get/477137/158289418.4aa/0_1871a2_66ec239b_XL.png

Сдвигаем рамку считывания еще на 1 символ

https://img-fotki.yandex.ru/get/373339/158289418.4aa/0_1871a3_a3ed007f_XL.png

Первый вариант программно-спирального фрагмента совпадает с контрольной аминокислотной последовательностью.

Развернуто:

https://img-fotki.yandex.ru/get/896349/158289418.4aa/0_1871a4_a955042e_XL.png
Оригинал: https://img-fotki.yandex.ru/get/896349/ … e_orig.png

150

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 92 874

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-27_07:

https://www.ncbi.nlm.nih.gov/nuccore/11 … mask=65536

>ENA|OLQ10134 fragment
atgtatntctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat
gtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctat

Результат:

https://img-fotki.yandex.ru/get/877700/158289418.4aa/0_187298_191fe18d_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/742275/158289418.4aa/0_187299_eb9c67a0_XL.png
Оригинал: https://img-fotki.yandex.ru/get/742275/ … 0_orig.png

Последовательность n(VY) образует программную 35-спираль длиной 1196 аминокислотных остатков