821

Re: Формы, механизмы, энергия наномира - 91

Формы, механизмы, энергия наномира. Сообщение 91 821

Готовится 628-ой выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

628 Эфиродром "летающих тарелок"
Обнаружен сардинский аналог магического камня Хоту Матуа
Метаморфозы программных спиралей
Фрактальные программные спирали белковых молекул
Открыты крупно-блочные третичные структуры белков
Открыты полуспирали и эволюционирующие спирали белков

https://img-fotki.yandex.ru/get/15528/158289418.1a6/0_1065cb_ee9e33e3_orig.jpg
Бусы, состоящие из "летающих тарелок". Кто-то носит на шее просто украшения, а кто-то носит на шее номинальный ряд "летающих тарелок"-роботов smile

https://img-fotki.yandex.ru/get/516062/158289418.492/0_185017_d3de4e81_XL.png

http://nanoworld88.narod.ru/data/283_files/0_b4949_fed0017c_orig.gif

https://img-fotki.yandex.ru/get/878590/158289418.494/0_1852f4_9605119b_orig.png

https://img-fotki.yandex.ru/get/872132/158289418.494/0_1852f5_b26f7b2d_orig.png

https://img-fotki.yandex.ru/get/874316/158289418.494/0_185367_49b72bcd_XL.png https://img-fotki.yandex.ru/get/477847/158289418.494/0_185300_c83dbcbe_XL.png https://img-fotki.yandex.ru/get/962386/158289418.493/0_1852d7_fd20696e_XL.gif https://img-fotki.yandex.ru/get/896349/158289418.494/0_1852f7_64c26e4_XL.png
https://img-fotki.yandex.ru/get/892702/158289418.495/0_18539d_8b97098_orig.png
https://img-fotki.yandex.ru/get/876984/158289418.495/0_18586e_fec998ae_orig.png
https://img-fotki.yandex.ru/get/361493/158289418.495/0_1856ff_36950aa5_XL.png
https://img-fotki.yandex.ru/get/876984/158289418.495/0_18587e_cd944928_orig.gif
https://img-fotki.yandex.ru/get/898391/158289418.496/0_185913_cc48c44_XL.png
https://img-fotki.yandex.ru/get/878590/158289418.496/0_185909_a64001c4_XL.png
https://img-fotki.yandex.ru/get/766539/158289418.496/0_185914_6a6e9e69_XL.png

822

Re: Формы, механизмы, энергия наномира - 91

Пикотехнолоигя для менеджеров и заказчиков (Татьяна Рясина)

Пикотехнология белков

Видим белковую молекулу в объёме и в деталях

100%  2D и 3D структура белковой молекулы с точностью до пикометра и все без исключения участки

В отличие от РСА, который "видит" только 3% белков и не замечает десятки крайних аминокислотных остатков- "хвостов" новая технология показывает 100% структуры 100% белков. Только 3% белков подлежат кристаллизации, т.е. исследованию методом рентгено-структурного анализа

Организатор заказа получает 80% выплаты от заказчиком

http://nanoworld.org.ru/forum/1/





КАК ЧИТАТЬ ДИАГРАММЫ ПИКОТЕХНОЛОГИИ

СОКРАЩЁННАЯ ДИАГРАММА

Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.

https://img-fotki.yandex.ru/get/898391/158289418.498/0_1859fc_e2e79c6_orig.png

ПОЛНАЯ ДИАГРАММА

1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)


Программные спирали - это повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль
http://nanoworld.org.ru/post/94081/#p94081

https://img-fotki.yandex.ru/get/509063/158289418.498/0_1859fd_27b43600_orig.png



Пи-спирали есть и в официальной науке, а в Пикотехнологии. http://nanoworld.org.ru/post/94083/#p94083 В официальной науке считается, что бета-тяжи плоские, т.е. "спираль с поворотом каждой следующей аминокислоты на 180 градусов. Пикотехнологические модели показывают, что это не тяжи, а именно правые спирали (2.5 остатка на виток). 310-спираль правая. Имеет примерно 3 остатка на виток. Альфа-спираль тоже правая. Имеет ~3.6 остатков на виток. Пи-спираль левая имеет примерно 4.1 остатка на виток: http://info-farm.ru/alphabet_index/p/pi-spiral.html .

Модели всех типов простых спиралей показаны здесь: http://nanoworld88.narod.ru/data/302.htm

Моделирование аминокислотных остатков http://nanoworld88.narod.ru/data/279.htm



ЧТО ОЗНАЧАЕТ НОТНАЯ ЗАПИСЬ В ПРАВОЙ ЧАСТИ ДИАГРАММЫ ПИКОТЕХНОЛОГИИ?

У каждой аминокислоты есть радикал, который "отзванивает" ноту на частоте, которую я рассчитал по формуле пружинного и математического маятников
Формула эта имеет вид: f = sqrt(1/(Sum(ml))), где
f - частота
m - масса атома в радикале
l - Расстояние атома до точки закрепления радикала
Суммируются произведения масс на расстояние до точки закрпления для одного радикала. Из обратной величины извлекается квадратный корень.
Понятно, что это - грубая оценка резонансных частот, поэтому они многократно уточнялись, в частности, по гармоничности мелодий, звучащих в зонах активных центров белковых молекул. Эта работа ещё далека до завершения. Очевидно, что в частотах есть ошибки. Поэтому встречаются "фальшивые нотки"  http://nanoworld.org.ru/post/93998/#p93998



ИНФОРМАТИВНОСТЬ ПИКОТЕХНОЛОГИИ

https://img-fotki.yandex.ru/get/893194/158289418.498/0_1859fe_42c2eed0_orig.png

https://img-fotki.yandex.ru/get/477847/158289418.498/0_1859ff_f066b0ba_orig.png

СУТЬ  МЕТОДА

http://nanoworld88.narod.ru/data/302.htm

Триплеты ДНК кодируют аминокислоты. По таблице обычного генетического кода:

https://img-fotki.yandex.ru/get/509739/158289418.498/0_185a00_494c8c31_orig.jpg

Кушелев: В упрощённом представлении третья (как бы лишняя) буква управляет углом поворота. Это я понял, когда сделал 3D модель аминокислотного остатка. Один аминокислотный остаток можно повернуть относительно другого на углы 0, 120 и 240 градусов. Когда я в этом убедился, построив пластмассовые модели нескольких белковых молекул, начались уточнения. Ведь водородные связи между соседними витками спирали могут слегка менять углы поворота. Анализ белковых структур помог составить таблицу композиционного генетического кода http://nanoworld.org.ru/post/94014/#p94014 .



Кушелев: Официальная наука "знает" альфа-спираль, 310-спираль, пи-спираль и бета-тяж (не знает, что спираль). В устаревшей официальной науке спирали не кодируются. Для того, чтобы узнать их код, нужно открыть композиционный генетический код, что, собственно, я и сделал в 1992-ом году. Я составил её по этим данным: http://www.nanoworld.org.ru/data/01/dat … 920204.htm


В упрощённой модели пикотехнологии учитывается поворот вокруг одной оси на 3 разных угла. Вариант "альфа" в дальнешем расщепляется на "Альфа-спираль", "310-спираль", "одиночный альфа-код". http://nanoworld.org.ru/post/94009/#p94009

https://img-fotki.yandex.ru/get/509063/158289418.498/0_185a01_e2c81f39_orig.png

ПОЧЕМУ ПИКОТЕХНОЛОГИЯ ТОЧНА НА 100%



Специалисты по РСА просто не в курсе, что электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода... Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток. Кольцегранные модели помогут специалистам по РСА более точно определять структуры белков и не только. Кстати, пикотех не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не знает. Так что полностью пренебрегать РСА не стоит. Но в плане дополнения РСА "весит" в несколько раз меньше, чем "Пикотех". http://nanoworld.org.ru/post/94089/#p94089



В современных базах данных структура белка изображается в виде опознанных участков альфа и 310-спиралей.

https://img-fotki.yandex.ru/get/876984/158289418.498/0_185a02_c1602d27_orig.jpg

https://img-fotki.yandex.ru/get/894110/158289418.498/0_185a03_84676294_orig.jpg



Здесь спиральные участки (альфа- и 310-) показаны красным цветом. Остальное - неопознанная часть. В настоящее время считается, что белок в неопознанной части не имеет определенной структуры, но пикотехнология показала, что это не так. В программе "Пикотех" вся структура определена. http://nanoworld.org.ru/post/93980/#p93980

https://img-fotki.yandex.ru/get/876984/158289418.498/0_185a04_236de89a_orig.jpg



Данный белок состоит из программных спиралей, но в стандартном представлении его покажут либо вообще без структуры, либо изобразят кусками альфа- и 310-спиралей. Оба варианта в корне ошибочны.
Ещё один типовой пример ошибки - изображение структуры коллагена тройной альфа-спиралью. В действительности структура данного коллагена представляет собой одинарную, но программную 335-спираль:

https://img-fotki.yandex.ru/get/878955/158289418.498/0_185a05_9329ef4c_orig.png


Хотя специалисты по РСА (рентгеноструктурному анализу) заявляют, что точность метода достигает долей ангстрема (меньше размера одного атома), но в действительности не могут на протяжении десятилетий отличить тройную альфа-спираль от программной 335-спирали коллагена. Это значит, что они не могут достичь атомной точности даже сегодня. Реальная погрешность РСА находится в диапазоне от нескольких атомных радиусов до сотен атомных радиусов. Например, "хвосты" белковых молекул (до 50 аминокислотных остатков) РСА может вообще не заметить. А это - сотни атомных радиусов в длину.



РСА часто ошибается при распознании спиральных участков. Иногда вообще не замечает или показывает там, где спирали нет. А перепутать альфа-спираль с 310- Пи- или программной спиралью – элементарно. http://nanoworld.org.ru/post/94010/#p94010



Вместо тройной спирали коллагена" программа Пикотех показывает одиночную, но "трёхзаходную" программную 335-спираль. Другими словами форма похожа, но микроструктура другая. И получена в автоматическом режиме, т.е. по табличной функции. http://nanoworld.org.ru/post/94011/#p94011



РАБОТОСПОСОБНОСТЬ ПИКОТЕХНОЛОГИИ

Кушелев: Работоспособность пикотехнологии имеет смысл демонстрировать во-первых на уровне вторичной структуры длинных спиралей. В т.ч. программных: http://nanoworld.org.ru/topic/1656/
Для них легко получать точные 3D-модели.
Акцент имеет смысл сделать на замыкании циклов лизоцима. Случайно получить замыкание циклов невозможно. Вероятность типа 1/30 000 000 000. А для программных спиралей случайность имеет вероятность типа 4^-3982=4e-2398 Подробнее: http://nanoworld.org.ru/topic/1656/page/5/
Далее имеет смысл демонстрировать возможности Пикотех на примере белков заказчиков. Заказчики сами увидят свои белки более точно, чем о них рассказывают специалисты по РСА. Именно это и привлечёт заказчиков к более тщательному ознакомлению и использованию новой технологии. Они должны убедиться в её работоспособности и эффективности не по наслышке.
У меня уже был негативный опыт работы с заказчиками через посредников. Искаженная и неполная информация о новой технологии только отпугивает заказчиков. Они думают, что результаты работы Пикотех должны полностью совпасть с результатами РСА. Это не так. На уровне вторичной структуры Пикотех имеет 100%-ную достоверность, а РСА на уровне 70%. 97% белков для РСА вообще недоступны, т.к. они не кристаллизуются.
Преодолеть барьер слепой веры в РСА - дело тонкое. С помощью "испорченного телефона" задача не решается. Так что ждём потенциальных заказчиков, например, на форуме лаборатории Наномир или в скайпе. В этом случае есть шанс донести до них информацию о новой технологии без искажений.
http://nanoworld.org.ru/post/94006/#p94006



ПУБЛИКАЦИИ

Монография «Геометрия живого наномира. Пикотехнология белков»  2016 https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2

Конкурсный проект на Конкурс Министерства Образования и Науки 1993  http://nanoworld.org.ru/post/93984/#p93984   Текст  http://www.nanoworld.org.ru/data/01/dat … 930114.htm

Таблицы по химии, Российская академия образования, 2006   http://nanoworld88.narod.ru/data/250.htm

Медаль ВДНХ за пикотехнологические модели молекул 1989  http://www.sciteclibrary.ru/cgi-bin/yab … 691890/113



ПРИМЕРЫ  2D И 3D СТРУКТУР БЕЛКА

http://nanoworld.org.ru/post/94033/#p94033

http://nanoworld.org.ru/post/94044/#p94044

http://nanoworld.org.ru/post/94186/#p94186

823

Re: Формы, механизмы, энергия наномира - 91

http://nanoworld.org.ru/post/94242/#p94242

Тарасенко пишет:

http://lenr.su/forum/index.php?threads% … 1%8B.33%2F   Здесь доклад Година, он получил конкреции... Он на правильном пути, но кто ему его подсказал....

Цитата: В программе встречи была демонстрация получения полиметаллических порошков из воды в прототипе "Энергонивы" по Вачаеву
Конец цитаты.

Кушелев: Круто! Кстати, у меня из крана постоянно интерметаллический порошок сыпется. Может позвать министров, чтобы посмотрели? wink

Кстати, Годину передавайте от меня привет. Он больше чудо-дисками не занимается? Переключился на порошки?

824

Re: Формы, механизмы, энергия наномира - 91

Формы, механизмы, энергия наномира. Сообщение 91 824

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-02_10

http://www.rcsb.org/pdb/explore/explore … ureId=4LJ0

https://www.ebi.ac.uk/ena/data/view/EGS … play=fasta

>ENA|EGS19143|EGS19143.1 Chaetomium thermophilum var. thermophilum DSM 1495 hypothetical protein
ATGTCAGTCGAGATCGCTCTCGGCACCCCGCTTGCGGATGCCCTTAACACGGCCATCCAG
GGCAAGATCGCAGAGCTGGGCTGGGCCGGCCCTGGCTCTGAGGTTTCTGCCATGTCCGAA
TACTTTGTCCTCATGCTCGCCAATGGCAAGACGGAGGCCGAAATCGTTCAAGAGATCCAG
GGCGACCTCCTTGGCCTAGGTCCAGAAGATGAGACTGCTCCCAAGTTTGCGCGATGGCTG
TCTGAGCAGGTTGCTGCCCTCAGCTCCCAGTCCGGCAACGGCGCTTCGGCAGCACCGTCT
GGCGACGCCATGGATGGGATCCGCGATGAGTCAATGACTGGACCAAGCGACGTCAACATG
GACACTTCGACCGATATGCCTGCTACGGGCTTGAATGCGCCTACTGGTCCTAAGGCTATG
CGCAATGGCAATAACATGATGCGCGGCAGCCGCGAAAAGCGCTTGATGGGTCAGATCAGC
CGTGCCATGGACCGATCCCAAGATTCCGTCCTTCACCGCGTGCGCACGCAGTCTGGCAAT
GAGCGAATCAGCAGAGGCCCGCCGGCTGGTCCCAGGCTCGGTGTGGGCAGGCAGCCTCGG
ACGACCAATACCCGTATGGCCAGCATTGCTGCCGGCATGGCTAACATGAGCGGGATGCCG
CATCCCGGCGGTCCAATGCCTATGAATCCAATGAATGGCATGCCCCCTATGCCTCCTAAC
GGCACCCCTTATGTGCCCCCAGAGCTGTATGCTATGATGGAACAGCAGAACCTCATGCTT
CAGCAGATGCAGCAGCAGCTTCAGATGCAACAGGCCAGCATGCGTGGCGGCTTCGGCGGC
CGGGGTGGCAGGGGCGGCGGCTTCCGTCGTGGTGGCGGTCATTTTCAGCAACAGCACAAC
GGCAGCCATGCGCACCCGCAACAGCAACAGTCACAGCAGGCAGGCTCCGAAGGGACACAA
TCTGAGGGAGCTTCGCAGGGCGACGCCGAGATGGCCGGCGCGAAGCCGAACCCAGAAGAG
ACGGTGTGCCGCTTCAACTTGAGGTGCCAGAACAAGGACTGCAAGTTTGCGCATCAATCT
CCCGCGGCGCCTCCCGGCATCACGATCGATGTCAAGGACGTTTGCAGCTACGGTGTGGCC
TGCAAGAACCGTAAATGTGTGGGCCGGCACCCATCACCAGCGGCCAAGGCGGCCCATCAG
AGCGAGCAAGACTGCAAGTACTGGCCCAATTGCGCCAACCCTCTCTGCGCCTTCCGGCAT
CCGACAATGCCCCCGTGTCGCAACGGTGGTGAGTGCAAGGTACCCGGCTGCAAGTTCACT
CATCTCAAGACGCCGTGCAAGTTCCGGCCCTGCACCAACCGCAGCTGCCCTTTCCTGCAC
GAGGAGGGCCAGCGCGGCACATTCCAGGACAAAGTGTGGACGGCGGATGGTGCCAAGGAG
CATGTCAGCGAGCGCAAGTTTGCCAATGATACGGGCAACGAGGAGCTGGTGCTGCCTGGC
TCAGGACAGCAGGAGGAGAACCAGACGGAGACGGAGGTTATCATGTAA

Результат:

https://img-fotki.yandex.ru/get/921322/158289418.498/0_1859fa_444e59b2_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/876984/158289418.498/0_1859fb_3a774c71_XL.png
Оригинал: https://img-fotki.yandex.ru/get/876984/ … 1_orig.png

А вот что известно об этом белке из PDB:

https://img-fotki.yandex.ru/get/897139/158289418.498/0_185a06_6edd9a22_XL.png
Неплохое дополнение к результатам Пикотех smile

825

Re: Формы, механизмы, энергия наномира - 91

Заказ 2017-11-02_11

http://www.rcsb.org/pdb/results/results … gotopage=2

http://www.rcsb.org/pdb/explore/explore … ureId=2KB8

https://img-fotki.yandex.ru/get/893194/158289418.499/0_185a09_9c09beb4_XL.png

http://www.uniprot.org/uniprot/G0SCL7

https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

>ENA|AAA35524|AAA35524.1 Homo sapiens (human) partial amylin
TCATCAGGTGGAAAAGCGGAAATGCAACACTGCCACATGTGCAACGCAGCGCCTGGCAAA
TTTTTTAGTTCATTCCAGCAACAACTTTGGTGCCATTCTCTCATCTACCAACGTGGGATC
CAATACATATGGCAAGAGGAATGCAGTAGAGGTTTTAAAGAGAGAGCCACTGAATTACTT
GCCCCTTTAG

Результат:

https://img-fotki.yandex.ru/get/874801/158289418.499/0_185a07_425000e8_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/914565/158289418.499/0_185a08_70e32487_XL.png
Оригинал: https://img-fotki.yandex.ru/get/914565/ … 7_orig.png

Кушелев: Что-то аминокислотные последовательности не совпадают. Какая-то ошибка в базе данных...

826

Re: Формы, механизмы, энергия наномира - 91

http://nanoworld.org.ru/topic/23/

Тарасенко пишет:

http://lenr.su/forum/index.php?threads% … 1%8B.33%2F   Здесь доклад Година, он получил конкреции... Он на правильном пути, но кто ему его подсказал....

Цитата: В программе встречи была демонстрация получения полиметаллических порошков из воды в прототипе "Энергонивы" по Вачаеву
Конец цитаты.

Кушелев: Круто! Кстати, у меня из крана постоянно интерметаллический порошок сыпется. Может позвать министров, чтобы посмотрели? wink

Кстати, Годину передавайте от меня привет. Он больше чудо-дисками не занимается? Переключился на порошки?

Тарасенко пишет:

на конкреции... но пока не понимает, без геологии не разберется!  http://lenr.su/forum/index.php?threads% … 1%8B.33%2F

Вы-то в геологии точно разбираетесь. Знаете, почему у меня из водопроводного крана прлиметаллические порошки выходят. Иногда мало, вода прозрачная. Иногда так прут, что вода аж коричневая...

Там, наверное, где-то ХЯС в водопроводной трубе живёт smile

827

Re: Формы, механизмы, энергия наномира - 91

Формы, механизмы, энергия наномира. Сообщение 91 827

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-02_12

http://www.rcsb.org/pdb/results/results … d=32C5D651

http://www.rcsb.org/pdb/explore/explore … ureId=5KNZ

Human Islet Amyloid Polypeptide Segment 19-SGNNFGAILSS-29 with Early Onset S20G Mutation Determined by MicroED

Krotee, P.A.L., Rodriguez, J.A., Sawaya, M.R., Cascio, D., Reyes, F.E., Shi, D., Hattne, J., Nannenga, B.L., Oskarsson, M., Griner, S., Jiang, L., Westermark, G., Gonen, T., Eisenberg, D.S.

https://img-fotki.yandex.ru/get/509063/158289418.499/0_185a0b_2cf3eba5_XL.png

http://www.uniprot.org/uniprot/P10997

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA33032|CAA33032.1 Homo sapiens (human) hypothetical protein
ATGGGCATCCTGAAGCTGCAAGTATTTCTCATTGTGCTCTCTGTTGCATTGAACCATCTG
AAAGCTACACCCATTGAAAGTCATCAGGTGGAAAAGCGGAAATGCAACACTGCCACATGT
GCAACGCAGCGCCTGGCAAATTTTTTAGTTCATTCCAGCAACAACTTTGGTGCCATTCTC
TCATCTACCAACGTGGGATCCAATACATATGGCAAGAGGAATGCAGTAGAGGTTTTAAAG
AGAGAGCCACTGAATTACTTGCCCCTTTAG

Результат:

https://img-fotki.yandex.ru/get/509739/158289418.499/0_185a0c_c2e55abc_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/509063/158289418.499/0_185a0d_fc0eb8a5_XL.png
Оригинал: https://img-fotki.yandex.ru/get/509063/ … 5_orig.png

Специалисты по РСА ошиблись не больше, чем на 8 аминокислотных остатков. Они идентифицировали участок как 310-спираль, а второй - как бета-тяж. Программа Пикотех показывает, что первый участок это гибридная альфа-310-спираль, а второй прямая альфа-спираль. Между ними находится более протяженный участок прямой пи-спирали. Но мы знаем, что РСА его не "видит".

828

Re: Формы, механизмы, энергия наномира - 91

https://www.youtube.com/watch?v=JgWO7bQ … 5005866257

obojdi: не камень, а бетонная глыба

Александр Кушелев: Расскажите, как изготовить бетонную глыбу массой 70 000 тонн. Как мы знаем, дорог там нет smile

obojdi: большой космический корабль нужен с большой бетономешалкой

Александр Кушелев: Инопланетяне не тратят десятки часов на застывание бетона. Они режут породу на блоки с высокой точностью и быстро укладывают без зазоров. На объекты типа египетской пирамиды у них обычно уходит одна ночь...

829

Re: Формы, механизмы, энергия наномира - 91

Формы, механизмы, энергия наномира. Сообщение 91 829

Online service PROTEIN PICOTECHNOLOGY

Заказ 2017-11-02_13

http://www.rcsb.org/pdb/explore/explore … ureId=1SPF

https://img-fotki.yandex.ru/get/894110/158289418.499/0_185a0e_cf8da7c9_orig.png

http://www.uniprot.org/uniprot/P15785

http://www.uniprot.org/uniprot/Q3MSM1

https://www.ebi.ac.uk/ena/data/view/CAI72667

https://www.ebi.ac.uk/ena/data/view/CAI … play=fasta

>ENA|CAI72667|CAI72667.1 Sus scrofa (pig) surfactant protein C propeptide
ATGGATGTAGGCAGCAAAGAAGTCCTGATGGAGAGCCCGCCGGACTACTCAGCAGTCCCA
GGGGGCCGGCTCCGCATCCCCTGCTGTCCTGTGAACCTCAAACGCCTTCTTGTCGTGGTC
GTGGTGGTGGTTCTTGTCGTCGTGGTGATTGTAGGGGCCCTGCTCATGGGTCTTCACATG
AGCCAGAAACATACTGAGATGGTCCTAGAGATGAGCCTCGCAGGGCCAGAAGCCCAGCAA
CGCCTGGCCCTGAGTGAGCATGTGGGAACCACTGCCACCTTCTCCATTGGCTCTAGTGGC
AATGTGGTCTATGACTACCAGCGGCTCCTGATTGCCTACAAGCCAGCCCCGGGAACCTGC
TGCTATGTCATGAAGATGTCTCCGCAGAGTATGCCGAGTCTTGAGGCTCTCACCAAAAAA
TTCCAGAACTTCCAGGGCCTCAGGAAGCCCCAAGAGGACAGCAAAGATCCAGGAGCAAAG
AGTCTTGTGCAGACTCACAGGAAGCCGCTTCTGGGACACCACGGGGACTGGCCCTGGAGA
AATGGGAGCTGTGGGGAGAGGTGGGCAGAGGAGAAGCAGCTGTTAGGGGCCCGGGGGCTT
CTACCACCAAAGAATAAAGCAGCCTGA

Результат:

https://img-fotki.yandex.ru/get/767871/158289418.499/0_185a0f_1d9ccbe2_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/878590/158289418.499/0_185a10_75adc965_XL.png
Оригинал: https://img-fotki.yandex.ru/get/878590/ … 5_orig.png

Сравним данные из PDB и Пикотех:

https://img-fotki.yandex.ru/get/878590/158289418.499/0_185a11_2f35541d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/878590/ … d_orig.png

https://img-fotki.yandex.ru/get/931298/158289418.499/0_185a12_31de0c7e_orig.png
Кушелев: Такова примерно средняя достоверность РСА smile

830

Re: Формы, механизмы, энергия наномира - 91

Формы, механизмы, энергия наномира. Сообщение 91 830

Что такое программа "Пикотехнология белков", и как её грамотно использовать

Реальные возможности рентгеноструктурного анализа.

https://img-fotki.yandex.ru/get/931298/158289418.499/0_185a12_31de0c7e_XL.png

Данные РСА находятся справа. Данные программы Пикотех находятся слева. Специалисты по РСА отметили сплошную альфа-спираль красной полосой (слева). Программа Пикотех показывает, что в этом месте находятся четыре коротких 310-спирали, разделенные кодами пи-спирали (синий цвет) и бета-спирали (зеленый цвет). РСА "не видит" отдельных аминокислотных остатков, поэтому специалистам приходится "гадать на кофейной гуще". Программа Пикотех показывает вторичную структуру белка по таблице композиционного генетического кода со 100%-ной достоверностью. Правильность таблицы подтверждена двумя независимыми способами. Первый способ - сильная корреляция с данными РСА, а второй - самоповерка на белках со сверхдлинными спиралями: http://nanoworld.org.ru/topic/1656/