741

Re: Формы, механизмы, энергия наномира - 91

Татьяна Рясина пишет:

Программные - это которые описываются цифрами.

Кушелев: Нет. Программные - это повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).

1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль

232323 - программная 23-спираль
141414 - программная 14-спираль

742

Re: Формы, механизмы, энергия наномира - 91

Татьяна Рясина пишет:

Пи-спирали есть в официальной науке?  Бета тяжи есть в Пикотехе? 

Пи-спирали есть и там, и тут. В официальной науки считается, что бета-тяжи плоские, т.е. "спираль с поворотом каждой следующей аминокислоты на 180 градусов. Пикотехнологические модели показывают, что это не тяжи, а именно правые спирали (2.5 остатка на виток). 310-спираль правая. Имеет примерно 3 остатка на виток. Альфа-спираль тоже правая. Имеет ~3.6 остатков на виток. Пи-спираль левая имеет примерно 4.1 остатка на виток: http://info-farm.ru/alphabet_index/p/pi-spiral.html

Почитайте про вторичную структуру в википедии: https://ru.wikipedia.org/wiki/%D0%92%D1 … 1%80%D0%B0

Модели всех типов простых спиралей показаны здесь: http://nanoworld88.narod.ru/data/302.htm

Почитайте этот доклад. Там есть ответы почти на все Ваши вопросы smile

743

Re: Формы, механизмы, энергия наномира - 91

Татьяна Рясина пишет:

Т.е. можно ли составить табличку с двумя столбцами - слева виды спиралей что есть в науке, справа что есть в Пикотехе . 

Достаточно одной поправке. В официальной науке ошибочно считается, что бета-спираль вовсе не спираль, а плоская структура или "спираль" с двумя остатками на виток.

744

Re: Формы, механизмы, энергия наномира - 91

Татьяна Рясина пишет:

А в пикотехе - больше типов спиралей, а загогулистые участки (не упорядоченной формы)  точно описываются  наборами символов, точно и однозначно передающих форму интересующего участка.

Да. Но ещё нужно учесть, что аминокислоты хорошо гнутся, т.е. являются по существу суставами, а пролин - два сустава под углом, т.е. аналог шарнира.

745

Re: Формы, механизмы, энергия наномира - 91

Татьяна Рясина пишет:

почему РСА не видит вторичную структуру на 100 % ?

"Человек видит то, что понимает". Специалисты по РСА просто не в курсе, что электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода... Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток. Кольцегранные модели помогут специалистам по РСА более точно определять структуры белков и не только. Кстати, пикотех не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не знает. Так что полностью пренебрегать РСА не стоит. Но в плане дополнения РСА "весит" в несколько раз меньше, чем "Пикотех".

746

Re: Формы, механизмы, энергия наномира - 91

Татьяна Рясина пишет:

есть уже сверх точные микроскопы, пикометровые или какие там ещё.  И ни одну белковую молекулу на них не разглядывают.  Чего-то публикаций нет. Атомы металлов разглядывают, а белки (которые намного крупнее) - нет. А потому что не положено.

Это не совсем так. Во-первых, в микроскопах, например, туннельных используется игла, состоящая из многогранных атомов. Таким инструментом трудно заметить, что электрон - кольцо. Но тем не менее это уже удалось!

http://nanoworld88.narod.ru/data/515_files/0_13756f.jpg

Подробнее: http://nanoworld88.narod.ru/data/515.htm

747

Re: Формы, механизмы, энергия наномира - 91

Заказ 2017-10-31_13:

https://www.ncbi.nlm.nih.gov/nuccore/12 … mask=65536

>OXA54029
atggcttatcaatatgtgtctcggatggacaagaattctcaagatgtacttaacaagggg
atttctataggacacgttgtatctcgactagacaatatcttgtccgccactggctatgat
tttgaacgaatatatacacctctcaaaacctcgcaagccctagcagagtcagtttttgaa
atgtgccaacgaaatgagacatccacttggaccgaattattcaaggacaaattgtcgaca
gaagaggatctgcgatttagcatgttctcagagtatttcaacaagaagctgtcgtctgat
ggaaaagtcgccaaagcttcgtttataaaaattttgaatttgcccgacgtcaagcaaatc
ttgagtggcttggtgtgcaagttgtatggtgcaaaaaaaggccgggtcgccagtgtcaac
caacttttggatatatttggacaagatatcgtggatggttacacgaggcaaaggagggcg
gatccatatgcctataatctaacgaccattaaggctgatcagatggaaactgatgacatg
ttcttggacgtgatgacgaatcaggagggcaaacattgctaccctgcacccattcaaaat
gtcacgatgaatgacataagcattaggatggcatggctgtcgtcggccgagcaacttgag
tttctttcgggctataaagaatgcctagagggggcagatgaccggctcatgaaaaccagg
caaacaattacatccattctagacacagttagaagcgcgctggacagaactgaatccagg
ctagtgtggaaggcaaccgttgcaccacttgcacacacgatttgtcaaacagacatggaa
acgtccaccttgagggccaaactttgcaagatctttgacgcagcaaagtctaaacctctc
aacaagttctttaacgacttgccaccaacggctgcaactctaccaacaacggctgcaacc
ctaccaacaacggctgcaaccctaccaacaacggctgcaactctaccaacaacggctgca
accctaccaacaacggctgcaaccctaccaacaacggctgcaactctaccaacaacggct
gcaaccctaccaacaacggctgcaaccctaccaacaacggctgcaactctaccaacaacg
gctgcaactctaccaacaacggctgcaaccctaccaacaacggctgcaactctaccaaca
acggctgcaactctaccaacaacggctgcaaccctaccaacaacggctgcaactctacca
acaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgcaacccta
ccaacaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgcaacc
ctaccaacaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgca
accctaccaacaacggctgcaactctaccaacaacggctgcaactctaccaacaacggct
gcaactccaccaacaacggctgcaactccaccaacagcgactgcaacgccaacaaatgga
ggggacaccgaccctaccctgctaaaagagggacaaactaaagacgagacttctcatttg
ccgctatcaatatgcacgtccgagccaaccgtagctcagctcgagcataggaagcaacag
ttggaaagggaactggtcagggtcatccaagacaagctggccgttctagaggagcaacaa
gggttggccatgcccaagacgatccaaactccttcaactgactatgccaatgacaacaac
atgacaacaactacgcaaatggcaacgacaaagttcagaatgtctgatgacactaatgac
aacggcaatgtgtcggatggtgataatgccaccactacaacaagtcgtgctgatggttcc
ataaacgacaatgttgttgatggagcagacgcatccatcaaaccagcggacatttcgtct
ggtgtgctagaaaaagcccgacaatcgactgtagctttggatctggagatatccgacagc
gaggaggaggacaatggtgatcatgaagctcaagagggaacgtccaacttttcatctgca
gcttttcttgcagaaatgacggctgaatttagtgatagtagtagtagtgctagaagtagt
agtgaaagtagtagcagtagcagtagtggtagtggtagcagtagcgaggagcaagaggaa
gaggaggggacattggtcgacacatga

Результат:

https://img-fotki.yandex.ru/get/880237/158289418.496/0_185943_74e07912_XL.png

21 триплет в строке:

>OXA54029
atggcttatcaatatgtgtctcggatggacaagaattctcaagatgtacttaacaaggggatt
tctataggacacgttgtatctcgactagacaatatcttgtccgccactggctatgattttgaa
cgaatatatacacctctcaaaacctcgcaagccctagcagagtcagtttttgaaatgtgccaa
cgaaatgagacatccacttggaccgaattattcaaggacaaattgtcgacagaagaggatctg
cgatttagcatgttctcagagtatttcaacaagaagctgtcgtctgatggaaaagtcgccaaa
gcttcgtttataaaaattttgaatttgcccgacgtcaagcaaatcttgagtggcttggtgtgc
aagttgtatggtgcaaaaaaaggccgggtcgccagtgtcaaccaacttttggatatatttgga
caagatatcgtggatggttacacgaggcaaaggagggcggatccatatgcctataatctaacg
accattaaggctgatcagatggaaactgatgacatgttcttggacgtgatgacgaatcaggag
ggcaaacattgctaccctgcacccattcaaaatgtcacgatgaatgacataagcattaggatg
gcatggctgtcgtcggccgagcaacttgagtttctttcgggctataaagaatgcctagagggg
gcagatgaccggctcatgaaaaccaggcaaacaattacatccattctagacacagttagaagc
gcgctggacagaactgaatccaggctagtgtggaaggcaaccgttgcaccacttgcacacacg
atttgtcaaacagacatggaaacgtccaccttgagggccaaactttgcaagatctttgacgca
gcaaagtctaaacctctcaacaagttctttaacgacttgccaccaacggctgcaactctacca
acaacggctgcaaccctaccaacaacggctgcaaccctaccaacaacggctgcaactctacca
acaacggctgcaaccctaccaacaacggctgcaaccctaccaacaacggctgcaactctacca
acaacggctgcaaccctaccaacaacggctgcaaccctaccaacaacggctgcaactctacca
acaacggctgcaactctaccaacaacggctgcaaccctaccaacaacggctgcaactctacca
acaacggctgcaactctaccaacaacggctgcaaccctaccaacaacggctgcaactctacca
acaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgcaaccctacca
acaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgcaaccctacca
acaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgcaaccctacca
acaacggctgcaactctaccaacaacggctgcaactctaccaacaacggctgcaactccacca
acaacggctgcaactccaccaacagcgactgcaacgccaacaaatggaggggacaccgaccct
accctgctaaaagagggacaaactaaagacgagacttctcatttgccgctatcaatatgcacg
tccgagccaaccgtagctcagctcgagcataggaagcaacagttggaaagggaactggtcagg
gtcatccaagacaagctggccgttctagaggagcaacaagggttggccatgcccaagacgatc
caaactccttcaactgactatgccaatgacaacaacatgacaacaactacgcaaatggcaacg
acaaagttcagaatgtctgatgacactaatgacaacggcaatgtgtcggatggtgataatgcc
accactacaacaagtcgtgctgatggttccataaacgacaatgttgttgatggagcagacgca
tccatcaaaccagcggacatttcgtctggtgtgctagaaaaagcccgacaatcgactgtagct
ttggatctggagatatccgacagcgaggaggaggacaatggtgatcatgaagctcaagaggga
acgtccaacttttcatctgcagcttttcttgcagaaatgacggctgaatttagtgatagtagt
agtagtgctagaagtagtagtgaaagtagtagcagtagcagtagtggtagtggtagcagtagc
gaggagcaagaggaagaggaggggacattggtcgacacatga

https://img-fotki.yandex.ru/get/894414/158289418.496/0_185945_901042a3_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/898391/158289418.496/0_185944_ab09cb1d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/898391/ … d_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/476913/158289418.496/0_185946_865c514d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/476913/ … d_orig.png

Эволюционирующая фрактальная программная спираль.

748

Re: Формы, механизмы, энергия наномира - 91

Заказ 2017-10-31_14:

https://www.ncbi.nlm.nih.gov/nuccore/167537988

>XP_001750661
atgaatcgctcccgtacgcgcaatgatgtcatacagctgatgaacgagctgcttgccgtttgc
cgtgagaggagtatcatgcgcaagagaaccgattctcgatacgcagcttaccgaccactcagt
cacccggcacagcggcgacagtggtacagagcgactcacagagcgactcacagagcgactcac
agagcgtctcacagagaggtacaaagaggtacacagacacagacacaagagggactcacggag
agagatgcagacacagacacagacacagacacagacacagacacagacacagacacagacaca
gacacagacacagacacagacacagacacagacacagacacagacacagacacagacacagac
acagacacagacacagacacagacacagacacagacacagacacagacacagacacagacaca
gacacagacacagacacagacacagacacagacacagacacagacacagacacagacacagac
acagacacagacacagacacagacacagacacagacacagacacagacacagacacagacaca
ggcacagacacaggcacagacacagacacagacacagacacagacacagacacagacacagac
acagacacagacacagacacagacacagacacagacacagacacgcggatggccttgtccatc
tcgcttcttccaaattag

Результат:

https://img-fotki.yandex.ru/get/892702/158289418.496/0_185947_66cb49e7_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/480548/158289418.496/0_185948_db64122_XL.png
Оригинал: https://img-fotki.yandex.ru/get/480548/ … 2_orig.png

749

Re: Формы, механизмы, энергия наномира - 91

Заказ 2017-10-31_15:

https://www.ebi.ac.uk/ena/data/view/EDQ … play=fasta

>ENA|EDQ89036|EDQ89036.1 Monosiga brevicollis MX1 predicted protein
ATGTCGCTCAAGAGTGCCGTCAAAACGGTTTTAACCAACTCCTTGCGCAGCGTTGCCGAT
GGCGGGGACTGGAAAGTGCTGGTCGTGGACAAGCCAGCCCTGCGCATGATTTCCGAGTGC
GCGCGAATGTCCGAGATTCTCGACCTTGGCGTCACTGTTGTGGAAGATGTCTCCAAGCAG
CGCAAGGTCCTGCCTCAGTTCCACGGCGTCTACTTTATTGAGCCCACGGAAGAGAACCTG
GACTATGTGATCCGTGACTTTGCTGATCGCACCCCAACCTACGAGGCTGCCCACCTGTTC
TTCCTGTCTCCCGTTCCTGACGCATTGATGGCCAAGCTGGCCAGCGCCAAGGCTGTCAAA
TATGTGAAGACTCTGAAGGAGATTAACACGCTCTTCATTCCCAAGGAACATCGCGTCTTC
ACGCTCAACGAGCCCCACGGCCTCGTTCAATATTATGGATCTCGCTCCTCCTCCTACAAC
ATCGATCATCTGGTTCGCCGTCTTTCGACCCTGTGCACCACGATGAATGTGGCTCCCATT
GTGCGCTACAGCAGCACCTCCACGCCAGGCACGGAGCGCATGGCTATGCAGCTGCAAAAG
GAGATTGATATGTCGGTCTCTCAAGGCTTGATCAATGCACGCGAGGGCAAGCTGAAGTCA
CAATTTCTGATTCTGGACCGCGCCGTCGACCTCAAGTCCCCTCTGGTGCACGAGCTGACG
TACCAGGCTGCCGCCTACGACCTGCTGAACATTGAGAATGACATTTACAGCTACTCGACG
GTCGACGCTGGAGGCCGTGAGCAACAACGTCAGGTTGTCCTGGGCGAGGATGACGACATT
TGGCTTCAGATGCGTCATCTGCACATCAGTGAAGTGTTTCGCAAGGTCAAGTCTAGCTTT
GACGAGTTTTGCGTATCGGCCCGCCGACTGCAAGGCCTGCGCGACAGCCAGCAGGGTGAA
GGTGGTGCTGGTGCGCTGAAGCAAATGCTCAAAGACCTTCCCCAGCATCGTGAGCAGATG
CAAAAGTATTCTTTGCATCTGGACATGTCCAACGCCATCAACATGGCCTTTTCCTCGACC
ATTGACAGCTGTACCAAGGCTGAGCAGAACATTGTGACGGAGGAGGAGCAAGACGGCAAC
AAGGTCCGCGACTTTATTGGCGAGGTAGCCAGTGTAGTCGTTGACCGCCGTGTTTCGACT
GAGGACAAGCTGCGCTGCCTGATGTTGTGCGTCTTGGCCAAGAACGGCACGTCCAGCCAC
GAACTGAATAATCTGCTCGACAATGCCAACATTGCCACCCCCAGCCGCTCGGCCATCTAC
AATCTGGAGATGCTCGGGGCGACCGTGGTTGCAGATCGCCGTGGCCGCAAGCCCAAGACC
ATGAAGCGCATTGAACGCGACATGCCCTATGTCCTCTCACGCTGGACACCCATTGTCAAG
GATCTGATGGAATACATTGCCACCGGACAATTGGACCTCGAATCCTACCCCGCTGTTCGG
GATGGACCCAGTGTAGTGCAACCCAAGCGCGCCAGCAAATCGGTTGAGGAAGACGATGAT
GGACCGGCGACCTCTGCGCGCAAGCGCGGCAACTGGGCCAAGAACAAGGGCAACAACCGC
TCGCTGCCCTCGACCCCGTCGGGTGTCGCTGTCTCTGGCAATGGCGCCGCTGGTGCTGCG
GAAAGCGCCAAGCCCAAGCTTTTTGTCTTTATCAATGGCACCGTGAGCTACAACGAGATT
CGCTGCGCATATGAGGTCAGCCAGTCCTCGGGATATGAGGTGTACATTGGGGCCCACAAC
ATTGCCACCCCAGCAGAGTTTGTTGAGCTCGTTAGTCTGCTGGACAAAGCCGACCAAGAT
GTTCAGGTGCTGACACAGGGTCAGGGCGACGGTGGCTTGGTCATCACGACGGGCAGTGCG
CAAGCAGGTCTCAACCTGGCCGAGGTGTAA

Результат:

https://img-fotki.yandex.ru/get/516062/158289418.496/0_185949_4f72852a_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/760582/158289418.496/0_18594a_72343fea_XL.png
Оригинал: https://img-fotki.yandex.ru/get/760582/ … a_orig.png

750

Re: Формы, механизмы, энергия наномира - 91

Заказ 2017-10-31_16:

https://www.ebi.ac.uk/ena/data/view/EDQ … play=fasta

>ENA|AAC13987|AAC13987.1 Escherichia coli bacterioferritin
ATGAAAGGTGATACTAAAGTTATAAATTATCTCAACAAACTGTTGGGAAATGAGCTTGTC
GCAATCAATCAGTACTTTCTCCATGCCCGAATGTTTAAAAACTGGGGTCTCAAACGTCTC
AATGATGTGGAGTATCATGAATCCATTGATGAGATGAAACACGCCGATCGTTATATTGAG
CGCATTCTTTTTCTGGAAGGTCTTCCAAACTTACAGGACCTGGGCAAACTGAACATTGGT
GAAGATGTTGAGGAAATGCTGCGTTCTGATCTGGCACTTGAGCTGGATGGCGCGAAGAAT
TTGCGTGAGGCAATTGGTTATGCCGATAGCGTTCATGATTACGTCAGCCGCGATATGATG
ATAGAAATTTTGCGTGATGAAGAAGGCCATATCGACTGGCTGGAAACGGAACTTGATCTG
ATTCAGAAGATGGGCCTGCAAAATTATCTGCAAGCACAGATCCGCGAAGAAGGTTGA

Результат:

https://img-fotki.yandex.ru/get/484029/158289418.496/0_18594b_87126095_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/476913/158289418.496/0_18594c_8c0b8230_XL.png
Оригинал: https://img-fotki.yandex.ru/get/476913/ … 0_orig.png

https://img-fotki.yandex.ru/get/516062/158289418.496/0_18594d_ad048429_XL.png
Специалисты по РСА программные спирали интерпретировали как альфа-спирали smile