201

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 068

Online service of protein structures

Заказ 20170906_004:

https://www.ncbi.nlm.nih.gov/protein/57 … XBU142C016

https://www.ncbi.nlm.nih.gov/nuccore/576993497

EUC66439.1

>EUC66439.1
atgcgcacagccaacgctcttttttctggcgctctgttctcccttgctattcaggtcgtg
gctggtttctcattcgaggatgtaccccgtacgaatctctttgcgcgcgcagacccatgc
cctcctggtcagtacttcgacaacggatgcaggcgctgtccggcgggctcttactgtggc
ggcaaggacgcgaagcagtgtgaccaaggacaatactctgatccaggggcgtctgtctgt
tctccgtgtccagctggatcgtataccaaccaaaagggcaccaccaaatgtaccactgtc
cagtgcgggtggtacggctccgggtccaacgcagacaacaacaggggggcaaccgaacag
aaacaatgtggcagcggatccttcagctcggaaggtagcacggtttgcacaaaatgtccc
gcgggttcctattgtaattctgcgaccacatgcgcaccttctctatgtcaacctggaaga
ttctcggataaggaaggtgcgagtgattgtacagaatgtcaagcgggcgaatatatcaac
aggtatggatcgacgtcctgctgtaaatgttgtgccggtagcttccaaagctccaccggc
caaacacactgccaggcttgtccagagcaaactcgaccgaatggtcaaggtaaagttttg
gttacatccgacctcggctccaagagcagtcagcaatgccatgcgtacaactttggcgac
ccagcacctttgcctgccgcttgcgttgatagcaatgtgacgcaattccaggccacttgt
cctcactcgctgaaggcttacatctttgaaaagatggacggaggcgctcctattgtaccg
gttcttttgccctctggtgcaatccactttgctagagtcggcccatcggacaccagccag
gagattatccagatactactcgccaccgaaggtgtcaaggcagatatcctaggtgatctg
gagaatgtcgttggcgagggggtagattgggaatggtctcttcagcatgtgcggaaagaa
ccgaggggtagggtatggcaggatgaagaattggagcaactagatgatgaaatcctaagc
aatgatttcccggcggaacagctcatcccaaatcgacccgaggcaaaacatgatttacaa
cggcatttttcggcatttccgctcacatcacatctacattcccctacagttcgtttaata
tcccaacacccttacctcagttttcatgtcactttcgaacgggttccagaaataaccgat
gggtttgttatgcaatggtttattgcacactcctcgactgtagaggacataatcaacgat
attggggataaccttggccttgcggtataccttgccggaccaggtggagggaaggtggat
tacgctattgaggtatttgcgccagatagtgggaaggacgtcgaacggctggacccttct
gcgagtgttacggccgtactacgaaaactagcgcctggaagaaggatacgtttagtggtg
cccgaagaatggtatcgccgccccaaggcaaagtccttctcttctcacctttcgctcacc
gaagacgacacgctcaagcttgctgccccaatcgatgaaccgaaccttccaaatagtgaa
ggagagtccggtgaaaacggcgacgggaccgccaagcagaactcccaacaacccccatcc
gttccatccagtcccgttctccctcgacctcgaccattctcggctgcctctaattcgtcc
gatgctgactccccttctcgacaatccactttttcgactcatcggttatcctccatgttt
gacagttggctgagtatatctcctactggcgcgattacactaccatcacagcctaatgcg
gcaccagagaggattagtgttagttcgcccttgcctattgacccaggagatatgcggagc
ggaagccaagatccgggaaatatgttggagactgaagaacagaagactgagtttgaggag
ttcatggacgagtttggtatcaaaactgaacagagaccaaagatgcgggacatgacctgg
gaccggaagaagtacttgattgaccagagcaagaaccgcgcctcggcggctcccgcatta
tacaataataacaatgcgtcttctgctaccgttggtccggcgagtgcaagttcgttggtt
cccaagttgctccctcaattatccggaactgcgcttgggaaattctccgtagcacgattt
ggaagttggaccgccgcctcagcacctaatggtgcaactaccgcattcatgcccggcgaa
ctgtctccaaggtctccaaagggctctatcaaacgacagatgtcatttggttcaaggcgt
actagcttggagccaacagcagaggagatatccgggctcggatcaccaccaaggtcacct
cccctctctcctaaaccaagcctctgggcctcgtggtggggtgctcccggtcatccagta
acggcggaaggggaaaggtcgagcgataaagggaagagtgctgtcgcggagctagctcgt
cttggtcaaggcgcgccgccccctcgagcaaaccaatctactgtcgcgccatatgttact
ggaataactgggagtaaatttcatagcacgacgttggtaaaacacttggtcagcctgagg
atacatgctgcaacagccaaactggattggatcaaggaattcattggaccaggtcaagga
atggaagcgctctccactttgatcgttgcgctagtcaagaataaggagaagaggaggaac
ttgactcaatcagaatccatgtcacttctcgaatgcaccaagtgccttcgtgtgatcgtc
aatacggatcctggcttgtcaaagatactcacgatgccaaacctaatgttccaaatagcg
acttgcctcgacaccggaaacgtaaaaatacgttcgaatgtagcagatttactggcaggg
atatctgtggtttcggaggaccaagggcataagatggtgcttgacgcgctttccgacttt
gcaactgtgaatcgcgaattccgattcgagcagcttattgatacgcttcgagttcctgag
ttgacgctggatgatgtggacgaagcattttggtccgaaagaatgcctgctcttgttctt
cttatcgccataactgcatcctgcccggatcttgaacagagaatagcgctgagagatgag
cttagtaggcgaggtttcaacgaaatcatggttagtttaaggtacctcagcccaccctca
atcgttacagaacggctcgatggctactctgaagacaaactcgacgatgaagaagacctt
cgagcgcgcattcgaaagcagtttgagcaatcagaaaaagaacgggaagattgggctggc
tccgagactgggctggtattcgagagaattttaaccctttctgaggaatatgacggagtc
cccgatatcatccttgagatatttcgctcccatgtccggatcctggaacaacctaccaca
ttgggggttaaatcgcgagttttcatcattctgcatagatttatttcccaactggccacc
ttggaagatgtagagcacgaatgggtccctttactcagacgactactcgattcagttaaa
gacataaccggggtttgtccagagtttgccgatgataactctaggcagaccagtactaca
gtcgatgaacttcgcgggcagttggaagacatggtgaaggagaaacaagactctttggag
aaaatacggagtctcgaaatagagctcgatacgctgaaatcgatgcaggagagttctata
gtcaaagggtctgggcaggagaacatgcatggtattgtgcagaggcttgtacagaaggaa
aaggcgaatgttcgtcttcaggctgacatggataggctgcgtaacgagaacgagaagctt
attgaagcgtcggaagaacaagagcgcatcaaacgtgaacgagatcgagcgaaatggagt
gctatgactgaagaaatgtcaaatagtagggctaaggtcgcagaactcgaaagttcgctc
cgcgagaaagaaaaaatggttctctacttgaagcgcgcgatggaggctctttcttcgagg
tttgaatctgccaatagcacacgtgaagcagtttccgaacggcctgacgataacttcgat
gcggagagtataactaaacaggcagtagatgagctttctgccaaggaccagcaaatagcc
gaaatgcgtcgggaactagaggagctcaacaagaaactcgaggaagttcaatcaagcttg
aagcagcagtcggcggagcgtgaattcaagactcgcgtcccgccgccgccaccccctcca
cggcgtcagtctcagcctttcggcgactctgatataggaagtgcacctgctctccctcca
tcgccgcctccccctccccctcctctcgtactgagccgttcacatagccttagcgccatc
gccgcacctccgccgccgccacctcctcctccgccaccacccccgccaccgtcccttccc
gtcaatttggttatcgccccctcaagcagcgctcctccaccgcctccaccgcctccacca
cctccaccatcggcatcattcattccttatacatcctcgggggtttcatcgcctcccgct
cctcccgctcctcccgctcctcccgctcctcccgctcctcccgctcctcccgctcctccc
gctcctcccgctcctcccgctccaccgccgcctcccatgataccacctccatccaacgtg
ggagcaccctcagcatggaaagcatccaaacggaccagtgtctccgcccctcctccaagc
aagaaactcaagcctttcttctgggacaaggtctcaactgcagggggtgttcaaacagtt
tggggacagcttggcatgatgggagggcaggttgatctcaccgacttggaagatgtcttc
actctggaccaggcaccacctaaacctgtcagtacttcgaatacgacaaagaacaagccg
cagcaagttacaactatgttggacatcacacgcgccaataacgttgccataatgctcaag
acactgaagctgtctcctgtcgctattcgcgaagctatcctagccgtagatgacacacgg
ttgtccgcagaggatctggtcgcaatatcaaagcaactccccaccgttgaggaggcaaat
cggatacaagatttcggagacgtcggtaaacttgcagaggcggaccgatactttagcgag
atcctgaaaattcccagactccaagaacgtttatcatgcatgatttaccgccggcgtctc
gaactggatattattgaagcccagccagacttgtcaatacttcatgatgcagctgtggaa
ctttgcacctcagataaactgcgcaggctacttcaggttgtgttagctgtcggtaacgca
ttgaataaatccacattccgtggcggcgcatctggtttcaagctaaaatcgctaatgaag
ttgaaagaaacgaaaaccgcgaaaggagaatcagagtgtccgactctactccactacctt
gcccgagttttgttacgctctgagcctccagccattctttttatcgaacaagtcccccat
ctggaatctgctgccagggtctcggtccaaactgtgatgtcaggcgtaaatagcatcgaa
gcggggcttaagaagactacctccgaaatcatatcctgtaggaagtcttcaaattttcct
tctgataaattcgggtctgttatgcagcctttcattaggagctcagctgaaagtgtctat
tcgctgaagtctcttgccgagtcaactcaagccaagctcgctgagatggtatcatatttc
ggagaaacttctgaaggacccgagcccacgaagccggaggatgtgttcgaagtgattcta
gctttctcttcatctttgcagaaagctgcgctggatgtcaacgcaactatggcgcgaacg
cttccctcagtactaattgcagcaagcgaagaattgacatccactacgcccaagcaagaa
aaggaagaacttttatcttcatcagattccgttccccgaagcatcaacaatgtgtatctt
tctgctggccgcggtgatcttgaccaagcaattcggagcctgcgcaccggccgacgagcg
cgccaagataggccattgagcaagatcttccttgatggaggaagcaatcgccgtagccga
ttgtttgattca

Результат:

https://img-fotki.yandex.ru/get/232875/158289418.470/0_18165d_7eb35b40_XL.png

Фрагмент:

https://img-fotki.yandex.ru/get/467152/158289418.470/0_18165e_887262f5_XL.png

Развёрнуто (фрагмент):

https://img-fotki.yandex.ru/get/467152/158289418.470/0_18165f_350e860c_XL.png
Последовательность (APP)*n образует программную 335-спираль, характерную для структуры классического коллагена. В данном случае Ala замещает Gly.

202

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 069

Online service of protein structures

Заказ 20170906_005:

https://www.ncbi.nlm.nih.gov/protein/11 … XBU142C016

>SIQ78668
atgtccccgggctggaccgatccgccgtcggcgaccggcgtcatcgtggagaccgccggt
gacgtgctggtgctgcgtaccgaggcggacgcccgggaaccgttcgtcgcgctggctttg
gcgctgcccgtcgaggccgggcagaccgcggtggtgagcgcgccgacggtgacgggccgt
accgacttcttcgagctccttccggacctgctgatcgagcacctcggcggcagcgccggg
gcggtccgggtcgtcgcgacgggcgcgtacgccccctcggtccaggcggttcccgcggcg
cggaagctggccgagtgggtcggccaggacgtgctcgtgccggtcgtcgggctggtggtg
gcgcccgatggagggcatctcctgccggccgacgcgctcggctcgatctgggttacgtgc
tcgcccgacgggccgccccgcccggcggccgcctggccaccgccggccccggcacaggcc
gagcccgtaccgcctccggcgccatccgcaccttcgtcaccagctcccgcgcctcccgcg
cctcccgcgcctcccgcgcctcccgcgcctcccgcgcctcccgcgcctcccgcgcctccc
gcgcctcccgcgcctcccgcgccgcccccactgcccgcgtccgcggctgtgccgtcggcg
ccgtccacgacttcgtcacccgcgtccgggtgcgtggagttgtcgcccgcaccggcgtcg
cccgaggcgccaccccgaccggtacgccgcgagtggcccgacgggggaccctggtggctg
gtgtcccggggtgacggtgtggtcgcggtgccgcgcgagcgtccgcccctcgtctggctg
ccgccccgccccgcgcccaccgcacccgcacggagcagagccgccaccccgccgcccgac
ctgcccggcgtacgtacccgggctggctggtccttcgtggacgaaccaatcggcgacccg
ccgactccggcgctcgccggcttcgtcgtggaggtcaccgtcggcgcgaccgggttccgg
gtcggcggccgtccgaccccaccgcgagcgttcgcgaagctggtcgcggcttgccgcccg
gacgcgcgccaacctgtcgtgctcgtgccccggggcgcgaccgcctccgggtcggcggcc
gacctgctctacggcggcctggccgacgcgctggccgtccatgtctacgccgccgacggg
gaggtgcagcagaccagcagcggactgctgcggaccactggcgtcttccgccgctggagc
ccccggcgcggccgaccgggcgaggggcgaccggcgcgccagatcagggtggtcggccag
gtgctaccgccgctgccgggcacggccggccgtcgcgtcgtgcccgccgaccgtctgccg
ggcgccgagacgacgcggaccgttccgccgtccgccctggacccggcggccggcgagtcg
cgcatcgagctgaagcccgcggtcgagccggttccggcggccggcgcttcgcacaccgat
ccgagcccggcggtcgagccggtgccggcacccggcgggccgggacggcagccggacgcc
caggccggtgtcgacgccgccggcgacccgggcatcgaacccgatcccgagccggagccg
gtggacgcatcgttcgccgcactgctcgatccggggcgctggcacacccggtcggcggtt
cccccgatcacggtggttcccgtgccgccggaaccggcggaacccgcgccggcctccgcc
gatccggctgcggcgtcgtccgccgcgccgcccgcgatgtcgcccggcgccgcaccggcg
gttcccgccgaactgccgacgtcgcgggcggcgacggcacccggcgacggagccggacct
gtcacgctggcgcctccgggtgtcacggccgggccggtccccggcgctccggcggccgcc
gcggtggaccgccccgagccggtcgctccggtgcggatcagccttcccggcgcagctgcg
agcgtccccggcctgcccgagggcgtggtggcgtcgagggccgacgcgacctccgtcggg
gtgtccgggtcctccaccgccgcggcgcgcctccgcggcagcgacgcggccgacggcggc
gcggacgctccggccaacgcgtccggagggctcgccggtcccgccacgaccgtgccgcga
gcacgctggcttccgagcgccgatccggagctgacggtcgcgaaccgtgcggcgctgcgc
caggcggtcggcggccgctacgacgcccacgcccgggtggtcacccggaccctggccgag
tcgccggggctgcgggccgcggcgggcgcggtcgccgacctcgcggccgggctcgtcgcg
gtgcgcgcttactgcgacggtggacgtgagtacgtcaacgagatgctgcgcggtggcggc
gacgatgaggcggccgagcgggtcgaactgctggcccgctgggccacgtacgggctgcgc
cggctcccgtcggtgttcggcccggtcttccggcccggtcccgccgacttcgcgcacgtg
cgcgcgtaccgccccggtgacgtgctcgccgagccggctttcgtcgacgtggacctggct
gccggcccggtcccgccgtctggggtggagttcgcgatctggtcggtcagcgcccatcgg
ctcggcgggctggccgccgacaccggcccgggcggcgccgtcttccagccgggcagccgg
ttcctggtgctcgcggtcgaggagcagcccggcgagggcgcgccggtgcgggtgatgctg
caggatctcggcgccgcgtacggcaccgagccgcgccgcggggggcgcaacgactcggag
cggatcctggcccagctgcgggcggcgccgcgtaccggtgcgagccggacgatgggcttc
gccccagggctggacgacgagggccgccccttccagcggccggcggaactcgccggcgct
gccgtggtgaacaagggtgggagcgcgtga

Результат:

https://img-fotki.yandex.ru/get/371503/158289418.470/0_181660_b7604fc0_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/371503/158289418.470/0_181661_caf3bc0a_XL.png
Оригинал: https://img-fotki.yandex.ru/get/371503/ … a_orig.png

https://img-fotki.yandex.ru/get/467152/158289418.470/0_181662_ded21d8b_XL.png

Последовательность (APP)*n образует другую т.е. не 335, а 535-спираль

203

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 071

Online service of protein structures

Заказ 20170906_006:

https://www.ncbi.nlm.nih.gov/protein/10 … XBU142C016

https://www.ncbi.nlm.nih.gov/nuccore/1091738099#

>SCU90687
atggccggaccaccacctcctccacctccaatgatgcctggcgcagctttaggcggtaaa
aagccccccgccgcgcctgcagcgccggctggaagagacgccttattgagcgctattcga
aatggttcccgactaaagaaagccgagacgaatgacagaagcgctccaaaagttggtggc
gggcttgtcggagatgcaggttcgtcgatggacgctgctggagcgagacccccagcacct
gggtcagccgccacatttggagccccgccagttccaacgggtctagctcctcaattgggt
gacattctggctggggggtttccaaaattacgttctacaagtggcgcgacaagtgcacct
ccagccccggcggccagcgtgcccaaggtacctcaacatccgatttctgcaaatcatgcc
cctcctccgattcctggctcagcgcctccaatcccgggttcaaggccgccaatagttccc
ccggcacctccagcggctgctgctcctaatgttccaaacacgcggccccatataccggta
tcaagacccactaggaggaacgtgaatgtctcttccgtttcgacaacctctgcacctccg
ctgcccacggtcagtgctccaggcacaccagcagcagcagcagcagcagcaccttcgata
cctaataacagagctccaccagttccatcagctccaccagttcgatctgctccacccgtt
ccatctgctccatcagcttcatcagcttcatcagctccaccagctccactagcaccacca
gctccacctgctccacctgctccacctgctccacctgctccaccagctccaccagctcca
ctagcatcactaacaccactagcatcaccagcaccaccagcacctccagcaccaccagca
cctccagcaccaccagcaccaccagcaccaccagcaccaccagctccagcagtgacatca
aagaaaataccatctgcacctcctgtatctcaaggtcttccatttctttccgaaattcag
agaaagagggatgatcgttttgttattggcgaaactcccaactacacaactcaagtcgaa
caagctgcaggttctgaacccataaaagcaacaaaagcgcccgaagctccgaagacttcc
atctcagggccaggtttgtcttttcttgatgaaatgagctcgaagctcaaccgtaacgcg
cccaagcctccacaaatatcagcaccaccgctaccagtgggcggggctcctcctgtgccc
atgtccgctgctccaagcataccgaaacattctgctccttcatcagcggtaccacctttg
ccacaagctgctgcccctggggcacctccacttccaccgctttcggcgcctaagcctacc
tcagcaccaccgttccctcaaagttcggcaccaccagcaccgccagcaccaccagcacca
ccagcaccgccagcaccaccagcaccaccagcaccaccagcaccatcagcacaaaatgct
tctgcgcgaacccccgcatcctcgtcttctcttggaggtgggttaccattccttgccgaa
attgaacgtaaacgagacgattcgcatgtagtgagcagctcaagtggcccaaatgctgga
gtttctagcccccctgctacgatggctccatctgttccatcgctgcctaggatgagcgca
cctcctgtcccaccaactatgagtgcgcccccacccccaccatcagcacctcctgcattt
gtaccaccaacatttggtgcaccaccaccgccacccacagcgcctcctcttttagctgtc
tctcaaccttctcataccggggaatctacctctaagctgccacctcccccaccacctccg
gatacttcggggacaattacgaacaaccacaagcaaaggcttttctccagcaatgattcg
gggcgttctagccatgctataaatccacatacgaatcaaccagagttcgagtctaccaat
ttcaccatcagtggaagctcaacaaccactggggtcaaactagatcattccaagatttta
attgatgatagccgttttagatggaccaacaattctcagttgccaaaaccgcgagcattt
tcaagtaaaacgaaattgtatcccagcggcaggggcagtagcgtaccattgaatcttgca
agctactcttga

Результат:

https://img-fotki.yandex.ru/get/402270/158289418.470/0_1816af_a097798_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/467152/158289418.470/0_1816b0_b1fba117_XL.png
Оригинал: https://img-fotki.yandex.ru/get/467152/ … 7_orig.png

https://img-fotki.yandex.ru/get/402270/158289418.470/0_1816c2_1f68e7f0_XL.png
Последовательность (APP)*n образует бета-спираль, переходящую в программную 233-спираль и снова в бета-спираль

https://img-fotki.yandex.ru/get/249479/158289418.470/0_1816c3_697763a3_XL.png
Последовательность (APP)*n образует бета-спираль, которая имеет несколько изломов (композиционный код 5)

204

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 072

Online service of protein structures

Заказ 20170906_007:

https://www.ncbi.nlm.nih.gov/protein/94 … XBU142C016

CUS22713

https://www.ncbi.nlm.nih.gov/nuccore/940813542

>CUS22713
atggctggtccccctccacccccacctccaatgatgcctggggcggctcccggtagctca
aagccgcctgcggcgccacagatgccaatgggtagagacgctctgcttggtgatataagg
aaaggagcccggctaaaaaaggctgtcacgaatgatagaagtgcgccgcaagtcggtggc
ggtgttgtgtccggtaacgcgccaagctctggcgtgccagcttcggcgcccccagtgtcg
caggcacaagcaaagccgccaatgccgctgccgtcaggaccccaactcggggacatcctg
gctggcgggatcccgaagctgagatcgacatctggcgcgccaagaggagcgccagcgcct
ccggttcctggtatgcctgcggcgcccgctccggcggcgcccactcgtacggcccatcca
gctcccatgagttctgctcctccggtccctgggtctgcccctccaattcctgggtctgcc
cctccaatccctgggtctgctcctccaataccgggctcagctcccccagcacctgctgct
ccacaaattccctccagtaggccccacatgccttcctctaggcccaccaagaggaggtcg
aataccgaaggaaaagcgccgcctgtgccttcggctcctccagcttcagccccaccgcta
ccttcatcgaaggctccaggtgctcctgcccccccactgcctcaaaataatgcgccgcca
gcgccaccagtcccatttgccgcagctcccccggcaccagcatcttcggcaccatctgtc
cctaaaacaaattcgtcatcagcgccgccagcgcctccggctccaccggccccccttgta
ccaggtctgcccaaaattagtgcaccatcggctccgccagcgccgccagcgccgccagca
cctccagcacccgctctgcccaagagcagtgcaccaccggcgccaccggcacctcctgca
cctccagcgcccgctttccctaaaagcagcgcaccaccagcaccaccagcaccaccagca
ccaccagcaccaccagcaccaccagcgcctcctgctgctccgaaacgcggggccgcgccc
gcgacgtctaccccgtcagcacctatgtctgcggctgggggcttgccgttcttggccgag
attcagaaaaagcgagacgacaggtttgttattggcgagagctccaactacacaacgaaa
actgaaccggtgaatgacccagagccaatcaaggcctcgtcttcggataaagtatcgcag
aaggcccaatcaggccaaggaatgtctttcttagacgagatgaactcaaaattgagtgca
cagcactccaaagcgcctgcggcaccatccatgccaccacaacctccagtaagtggtgca
cccccagtcccgcctgctcctcctgctgcacctgcacccaccacaaaagcaccaccactg
ccttctttttcagcgccgagcacgaatccagctcctccagctcctccagctcctccgcct
tcagtctcgtcattgcctccccctcctccaatccctacgttttcgtctcctcaagcgcca
gcgcttcccaaaacaacggcgccaggcagccctccgccacctccacctccacctccgccg
gcgctagcatccgggcctcctacaaaccatcaaagtgcaccgaagccctcttttggcggc
ggtctgccattcctttcagaaatcgagaaaaagagagacgattctcatgtaattgagggg
gtatcgagtaactcgggacctggaataagcgagagtagagccccaagtgcccctagcgca
ccttccgccccagctccatcaatcccttctttgccaacttttggcgctcctcctgtacct
acatctgctaaggccacgccaagggttccctcgtcttccgtagcggcgccagcggcgcct
cctcttccatcagctgcctcgccagtattgccggccccaccggccccaccggccccaccg
gccccaccggccccaccggccccaccggccccatctgctccacctgctccaccaatggcg
tccccaggtcctcattcagccccaccaccccctccaatggtaccatcgtcccctgcttca
actactgctactaagggtgggtcttccaagcttcctccccctcctccaccgccatctaac
actacatcatcctcacacaaacaaagactcttttcgaacggtgatgacgtgcagtcaagc
catactctaaatccgcataccaatcaaccagaaatcaagacaagcaacttgactatcagt
ggcagcgcaacgacgaccggcgtcaaactaggcggtgctaagattaccgttgacgacagc
cgcttcagttggggtaacgctggtcaactgccgaagccaagagcatttagtaataagaca
aagctgtaccctagtggaaggggaagcagtgttccactggatctggcattgtactcgcag
tag

Результат:

https://img-fotki.yandex.ru/get/229553/158289418.470/0_1816e4_19664220_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/369167/158289418.470/0_1816e5_32460ac6_XL.png
Оригинал: https://img-fotki.yandex.ru/get/369167/ … 6_orig.png

https://img-fotki.yandex.ru/get/479589/158289418.470/0_181711_60f1d1eb_XL.png

Последовательность (APP)*n образует бета-спираль, которая неожиданно переходит в пи-спираль через композиционный код 5 (одиночный код альфа-спирали)

https://img-fotki.yandex.ru/get/233740/158289418.470/0_181712_46ec4aae_XL.png

В том же белке последовательность (APP)*n образует программную 233-спираль

https://img-fotki.yandex.ru/get/249078/158289418.470/0_181713_c64fc96e_XL.png

Последовательность (P)*n, т.е. полипролин образует 23-спираль

https://img-fotki.yandex.ru/get/467152/158289418.470/0_181714_59e8ebb3_XL.png

Последовательность (APS)*n не образует программных спиралей в данном белке

https://img-fotki.yandex.ru/get/483127/158289418.471/0_181715_487ce595_XL.png

В том же белке последовательность (APP)*n образует программную 525-спираль

205

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 076

Online service of protein structures

Заказ 20170906_008:

https://www.ncbi.nlm.nih.gov/nuccore/1017225020#

KZE91412.1

>KZE91412
atgcccgcagtggagttgaacgccgcccgcctcgtcgcggacggcaatacgttgcactcg
atcgcgcagaccgcgtggcaggccgcgcaggcctgtcagtcggccctcggcggcacgggg
ggaatggccggtgacgaggagtccgcggaggtcttcgcgcacggtcaagacggtgagccc
ggctatgacggttacgcccgcgatgtgctgaagggcgtcatcaacgcggccaacaccctg
aagactctggacgcggcactcgcgaacacggggcgcgcctacgacggtgcgcagctggtg
ggagcgttccgctccgccgacgagtcgagcattgcggaggagaccgcggtgccgttcggg
gtctcggtgtcggttccctccgccttgggtcccggtcccacgacgcctctgggtgagttc
ggcgagttcctgcaggacgcactcgcccagatcggtgtgcggctccctgacgccgacacc
gggaagctcggtgccgccgagtcggcgtggaatgagctctccggcgcgatgtcgcgcgtg
cagggccgcatcgactccgcgttcaccaacaccgcggcagccacgctcccgcagcaggcc
agcattcttgcctgccagtcgaagatgtcggagtcgttccgcagtctctccgagtcggcg
tcctccatgggtggcttcgcgcgatcgatgatcgacgagacgaacaaggcgtgggaggag
atcggctggttcatcgcgcagatggccgtcgagatcgccatcgagatcggtgtcggcgcg
ctgctcggtgcggtgaccttcggtgccggtgctgcggcgatggccgcgaagatcgcgttc
accgtgatgcgctgggcgatcaagatcgcgaacctctgccggaagctccgcacgctcatc
atggccgcgctccgcgccgcgcgcatggcgatccgtgccggcgtgcacgtggccaaggag
gcgctgtcggccggtctcgcctcggcgatcacgacgaccggtttcaacgtggtgcggggg
tcgctcgatccgtcgtaccagccccagaacatcctgaccgctgcgctggcggccaccgcc
gggggtggcgcgggcgggttcgcctcgcgcgtgggcggcgcggcgacctcgcgagtgacc
accaccggcctccagcgtgtcacgcacgtgagcgtggagatggggagcggcgcggtcgat
ggcctcgtcagtgccggagccgaatccggtctcaacggcacccccttcaacccgctgtcc
gctgtcgtcctcggatcgctcctgggcggcgcgatggcgggaaagcccggcggtgcccgt
ccgacgcccacgggcggcggttcgggtgcgcccagcgcgcccagcctcgggaacattccc
ggcgcgggcggcgcgggcggatccggcacggctgcggcagcgggaggcggcggcgtgacg
gtcaccgccgacggcccgacgccgggagcagcctcgggcggctcgtcgaacgcggtcggt
gacggctctggcgtgaccgtgaacaacgatggccctactccgggtgcgggcaccgccgac
gggggttcctcggccggcgacggcggctcggtcgacgtgtcgtcccagacgcccgacctg
cccgccagcctgggtggcgatggtccgtcttcgccctctggcccggatgcgccgtctgct
ccggatgcgccgagtaccccggatgcgccgtcgtcgccggatgcgccttcggctccggat
gcgccgtcgagccccgacgccccgtctgctccggatgcgccgtcgagccccgacgccccg
tctgctccggatgcgccgtcgagcccggatggaccgtctgctccggaggctccgagcact
ccggaggctccgagtgcccccgacgccccgtccgctccggacgcgccttcggctccggag
gccccgtccgctccggacgcgcccacggctccggacgcgcccacggcccccgatgctccg
tcggctccggatgcgccgtccgctccggacgcgccgtccgcgccgtccgcgccggacgca
ccgtccgctgccgatgcgccttctgctccggatgcgccgtcgtcgacggccgatgctccg
gcatccacggttgacgccccgagcgccgatgcgccgacgtcgccgtcctctgacgctccc
gtcgcgggcggtgcggtcccgaccgcgccctcgtcgccgtcgtcgcccgacgccgacgcc
cccacggctcctgacagcgacgcaccaacgggccccgacgccgaggctcctgcggtcccg
gatgcactcccggtcgacgcgccgtcctcgccggaggccacgacgcccgacggctccacg
cccgacggctccacgcccgacggctcggctcccgacggtgacgtgcctcctgtcgaggct
caggcggccgccaccgccggtgccgcagcagccgcgggtggtctctttgcgaagcccttc
gtgcgcacccccagcggcagctcgctcttcggcacggcgccctcgtctccggacgcgtcg
gcttcgtcgccggaggctcccagcgccacgggcccggatgccgggtcgccggccgcgccg
gatgcgaccgcccccgaggcgtcgccctccgccgactccgacgcgccgagccaggacgcg
ccttcgcaggacggcgagggatcgcccgatgcggaccatcccgccggtatcgacaagacc
gagctgagcaccgacgagatcgacgccgcgctcgacgcgatcaatccgaacttcgacccg
acgagcccctccaacggattcgcgacgaactgtggccacacctcgtcgatcctcaacgac
gtgctcaacggcggaacggtccgtgaggcacctggaggctccaccctgtcgatggcggag
atggctactgccaccggtcgtccgcagacacccgccacgccggcgcagatcgaagcgacg
ctgcgagccgggggagccggatcgcactgcgtcgtgggtatcgatcgttcgagcggcgac
ggtcactggttcaacgcatacttcgatggaacgaacgtctgggctctcgacgcccagacc
ggtacccgctccggatggccgccccacgagccgaacgcgacgaactgggacgtctccatc
gacaagggcgttctcgtcaacgccgacggcacggccgtgcacccggtggccgatgcagct
gcggacgcgtcggctggtggcgcgaccgcttccgatggcgcgaccgccaccgacggtgcg
acgactccccaccctgcgacggcatccgacggcggcgactcgcagcccgtggcttcgggg
gacgatcgaggatcggccggcgtggattcggacagccggatcgacgactacctgacgtcg
cacgggcgctcgccggcagacgtccacgacctgcggctcacgccttcatcgagcctgtca
gcggcggaccgaagtcttctgcagaccatccgtgagctgatcgagccgccgacctcgcgc
actcccttgatcaaggtgatgccgatcgacagcgtctcgcgctatctccgagggcccgat
cgcttcacccaggtggccggatatgtgatccgtgccacggatgcgaatccctgggcgggt
ctgtcacagatcatcgccgatctccgtctggactacacgatgagcgatggctctccgagt
ccgttccaggcgcccggcgtgaccgagtacggcttcatcgagttcacgacgagcaacccg
gaggcgcttcagatcccgttctcgcccgacttcggggggacgacgaccgatggcgcaccc
gcgaccggaaacggcttcctcgcaaacgccgacgatgtgtggcgtcccgagtacaaggcc
gacggccgtctcgacctgaacgacggcgcgcggttgtggatcgtcgggcctgatggtgcg
cgcgtggtgggcatctaccacgcgggcgctggtttcgtgatgaccggtgctgcgcgttga

Результат:

https://img-fotki.yandex.ru/get/372565/158289418.471/0_18185b_53ad12b3_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/484029/158289418.471/0_18185c_4289ffc4_XL.png
Оригинал: https://img-fotki.yandex.ru/get/484029/ … 4_orig.png

https://img-fotki.yandex.ru/get/467315/158289418.471/0_18185d_7b8595a6_XL.png
Этот фрагмент белка строится в трехдольном размере, но, в отличие от коллагена вместо Gly каждый третий аминокислотный остаток - Pro. Открыта новая структура белка, в которой каждый третий остаток - пролин.

206

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 081

Online service of protein structures

Ищем аминокислотную последовательность (PPGPG)*n

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Заказ 20170906_009:

https://www.ncbi.nlm.nih.gov/protein/67 … 0R4AU2B016

>XM_008762414.2 PREDICTED: Rattus norvegicus copine-1-like (LOC100910990), transcript variant X9, mRNA
CATCTCTCCAGCCCCTTGTTTTACCTTTTAGTGATAAAAATTATTACTGTGGCTTACTTGATCTCAAAGA
ATAGTAACAAAGTGAGAATCATTCAGATAAGTAGTTCTGTTACTAATCTAAGTACCAGAGAGTGGCAGGT
TTTTTTCTCATTTTCTGAATTTAGAAATGACTGTCTGAGGCAGTGGTTTAATGGGACATGAGGATCCCCA
GACTCTATGTAAAGAAGAAGGAAGTGCACATCTGCAAGCTGTGTTCCTCTGGGGAGCTGGGTGATAGACA
CAGAAGCCTGAGACGTTCATGGCCCAGCTGACCTGATGTGTTGCAGCCAAAAAGACAAGGAAAGAAGCCT
TTCTTAAGGTGGAGGACGGCAAGTGTTGAGACTGAAGAGTCCCCTCTGATTTCCAGAAGCTCACAGATTT
TTTTTAAGTCACTATTTTTAAAAATGGTAGCACATGCCTGTAATGCCAGCATGGGCTACAATGTGAGCAA
GACCTTCCCTCAAAACAGTTCATACCTTTCAGTGGATCATGCTGACACAAACCTGTACCCTATAGCACTT
GAGGGATAGAGATAGGAGGGTCAATAAAGGCCAGCCTCAGCTACTTACTGAGTTTGAAGCTAGGTTGGGC
TGCCTGAGACTTGTCTCTGAAACAAAAACAAATAAATTAGTGTATTTGAGCCAGGAGGATCACCTGCCTG
ATTTAAAAAGTAGAATAGGATGACAATATGACTCTACTTGGTGCCAGTCGTAATGGTCTGAGTTCTAACC
CCAGGACCCACATGGTAGAGGGTGAGAACCGACTTTTCAGAATTGTCTTCAGACCTCCACATGCACATCT
GCACATAGTATACTTAACATATATAAAGCGTATATACAATAAATTTAAAATATTGAGCTGAGCGTAGAGC
TCAGTAGTAGAAGATTTGCTTAAAATGTGTTAGGTTTACATTCAGTCTGGGACTGCTGTATTACTCCCGC
CCCCCAAAATGTTAAAAATTAAAAATGCATTTCAAAATGGTCTTTTAAGTATAATTCTGGGTCTAGAGAG
AGGGCTCAGCAGGTAGAGCATTGGCTCCTCTTCCAGAGGGGCTGAGTTTGTTTCTCAGTACACACCTGGT
AGCCTAACACTGTCTATAATAGCAGTCTGAGGAATCTGAAGCTCTCTCTTGGCCTCTGGGCGCCAGGTGT
GGACATGGTATACAGAGATAAATACAGGCAGAAACCTCTACACATAGAGATTACGGTTAAAGGATAAATA
CGGCTAATTGTTTGGTATATATTTTGCTTGTTAATTGTTAAGAACTTAACTAGTTTGGAAAAAAATTACC
CTGAAAGATAAGTACCCTGTTACCTGTGTGTGGTTTGGAAAGTATCGTTATATACTAAGACATTTGCTGG
AAAAGTACTTTGTTTTTGAGGCAGGGATTTGTTGTTGGCCTAGGTTGGACTTAGAACTTAGTATGTAGCC
CAGGCTAGTCCTAGACTTGGTAGTATTTCAGCTTGTGCTTCTGGAGTGCTGGGTTACACTTGTGCTTTAG
ATACTTTGTATTAAACAAGTTCGTTTGGGAGTTACATTCAGAGAAATTTCCCTTAATGTGTTGAACACCA
GTGGGATTAGTGCTTAGAGTTTAAACTTGCATTTCAGTTGTGTTTTGTGATCTATCATATGGTGCAGAGG
TAATCTGTTTGAAAGAGCATTGCAGTGTTGTCTGTGACGGTCCATGTTGATGGCATTTGTCCAGGAATTG
TTATTGTGCTTCTTCAGAAGTTTGGTGAGAACTTGTTGATAGTCTTAAGAAATTTTCTGGATTGTGTAAA
TGTTAAGTGATAAAGCAATGACCATCTGAAACTGAGCTTTAGAACTGTTTTTAAATTTAGGTTTTGGCTA
TTTTATGGTATATTCTTGATAAAACTACTTGACGTTTTCTTGGTAGAATGGTTTTCAGACTTGAAAGCAA
CATCAAATTAATATGTTTGGAATTTTGGTGTCTCTTTCCTTAAAAAACAAAACAAACTATACATTCTTAT
GAAATACTCTGCTGGTTTCAGACTCTTCTTCGTAATGTACAGTTCAGTGTGGCCTCTGCCTGTTGTTTCC
TGCATTGATTTTTGCCTCCATTTATTCTCTATTGCAGTCTAAAAGTTGGTTTTAATTGGTTGCCCACAGG
ATTGACTTGGCCTCTACTTCTTAAGAAAATACATCTCTTGTTTTACAAGGTGTGTTTGGTTTCAGCGCAG
CATGGCTGTGGTCATCCGTTTGCAAGGTCTCCCAATTGTGGCGGGGACCATGGACATTCGCCACTTCTTC
TCTGGATTGACCATCCCCGATGGGGGCGTGCATATTGTAGGGGGTGAACTGGGTGAGGCTTTCATCGTTT
TTGCCACTGATGAAGATGCAAGGCTTGGTATGATGCGCACAGGTGGTACAATTAAAGGGTCGAAAGTAAC
ACTGTTGTTGAGTAGTAAAACAGAAATGCAGAATATGATTGAACTGAGTCGTAGGCGTTTTGAAACTGCC
AACTTAGATATACCACCAGCAAATGCTAGTAGATCAGGACCGCCACCTAGCTCAGGGATGAGCAGCAGGG
TAAACTTGCCAGCAACAGTACCCAGCTTTAATAATCCTTCGCCAAGTGTAGTAACTGCTACCACTTCTGT
TCATGAGAGCAACAAAAGCATACAAACGTTTTCCACAGCCAGCGTAGGAACTGCTCCTCCAAGTATGGGG
ACTTCTTTTGGGAGTCCAACGTTCAGCTCAACCATTCCAAGTACAGCTTCTCCAATGAACACAGTCCCAC
CACCACCAATTCCTCCAATCCCATCGATGCCATCTTTGCCACCGCTGCCATCCATTCCCCCAATACCAGT
TCCTCCTCCGGTACCAACGTTGCCTCCTGTGCCACCTGTTCCTCCCATTCCCCCAGTCCCTTCTGTGCCA
CCTATGACCACATTGCCTCCCATATCAGGCATGCCACCCTTGAATCCACCACCTGTGGCACCTCTACCTA
CTGGAATGAATGGCTCTGGAGCACCTATAAGTCTGAACAATAATCTGAACCCTGTGTTTCTGGGTCCATT
AAATCCTGTTAACCCTATACAGATGAACTCTCAAAGCAGCGTGAAGTCTCTTCCCATCAACCCTGATGAT
CTATATGTGAGTGTTCATGGAATGCCCTTTTCTGCAATGGAAAATGATGTCAGAGAGTTTTTCCATGGGC
TCCGAGTTGATGCAGTGCATTTGTTAAAAGATCATGTAGGGCGAAATAATGGGAATGGATTGGTTAAGTT
TCTCTCCCCTCAAGATACATTTGAAGCTTTGAAACGGAACAGAATGCTGATGATTCAACGCTATGTGGAA
GTCAGTCCTGCCACAGAGAGACAGTGGGTAGCTGCTGGAGGTCATATCACTTTTAAGCAAAGTATGGGGC
CTTCTGGACAAGCCCACCCTCCTCCACAGACACTTCCAAGGTCAAAATCGCCCAGTGGGCAGAAAAGGTC
AAGATCAAGATCACCTCATGAGGCTGGTTTTTGTGTTTACTTAAAAGGGCTACCCTTTGAAGCAGAAAAC
AAACATGTCATTGATTTTTTTAAGAAGTTGGATATTGTGGAAGATAGTATTTATATAGCTTATGGACCCA
ATGGGAAAGCAACTGGTGAAGGCTTTGTAGAGTTCAGGAATGATGCTGACTATAAGGCTGCTCTCTGTCG
TCATAAACAGTACATGGGCAATCGCTTTATTCAAGTTCATCCAATAACTAAGAAAGGTATGCTAGAAAAG
ATAGATATGATTCGAAAACGACTTCAGAACTTCAGCTATGACCAGAGGGAAATGGTGTTAAATCCGGAGG
GGGAAGTCAGTTCTGCCAAAGTCTGTGCCCATATAACAAACATTCCATTCAGCATTACCAAGATGGATGT
TCTTCAGTTCCTAGAAGGAATCCCAGTGGATGAGAATGCTGTACATGTTCTTGTTGATAACAATGGGCAA
GGTCTAGGGCAAGCATTGGTTCAGTTTAAAACTGAAGACGATGCACATAAATCTGAACACTTACACCGTA
AAAAACTGAATGGGAGAGAAGCTTTTGTTCATATAGTTACCCTAGAAGATATGAGAGAGATTGAGAAAAA
CCCCCCAGCCCAAGGGAAAAAGGGCTTAAAGATACCTGTTCCAGGTAATCCTGCAGTACCAGTGATACCC
AGTGCAGGGATGCCCGCTGCTGGGATACCCAGTGCTGGGATACCCAGTGCAGGGATACCCAGTGCTGGAA
TGCCTAGTGCTGGAATGCCTAGTGCAGGGTTGCCTGCTGCTGGGTTGCCTGCTGCTGGGTTGCCTGGCTC
TGGAATGCCTGGCTCTGGAATGCCTGGCTCTGGAATACCGGGTCCCGGAATACCCGGTCCTGGAATACCC
GGTCCCGGAATACCTGGTCCTGGAATGCCCGGTCCTGGAATACCGGGTCCCGGAATACCCGGTCCCGGAA
TACCTGGTGCCGGAATACCTGGTCCCCCAATGCCTGGTCCCGCAATGCCTGGTCCCTCAATGCCTGGTCC
CGCAATGCCTGGTCCCGCAATGCCTGGTCCCGCAATGCCTGGACCAGCAATACCCGGTCCCGCACTGCCT
GGACCAGCAATACCTGGTCCTGGCATCCCCAGTGCAGGAGGAGAAGAGCATGTCTTCTTGACTGTAGGAT
CAAAGGAGGCCAATAATGGGCCACCATTTAACTTCCCTGGTAATTTTGGTGGGCCCAATGCTTTTGGGCC
ACCACTCCCCCCTCCAGGATTAGGGGGCGCCTTTGGTGATGTTAGGCCTGTTATGCCTTCGGTTGGAAAT
AGTGGTTTGCCTGGCCTAGGACTGGAAGTTCCAGGTTTTGGAGGTGCACCAAATAATATAAGTGGGCCAT
CAGGATTTGGGGGGATTCCTCAGAACTTTGGAAATGGCCCAGGTAGTTTAAATGCTCCTCCTGGTTTTGG
AAATGGACCCCCTGGTCTTGGAAGTGTTCCTAGTCATTTAAGTGGGCCTCCAGCCTTTGGGCCTGGGCCT
GGGCCTGGGCCGATCCATATTGGGGGTCCCCCTGGCTTTGGAGCCAGCTCTGGAAAACCAGGACCTACAA
TAATTAAGGTGCAGAACATGCCTTTTACTGTATCTATTGATGAAATTTTAGATTTCTTTTATGGTTATCA
AGTAATTCCAGGTTCAGTATGTTTAAAATACAATGAAAAAGGTATGCCTACAGGTGAAGCCATGGTGGCC
TTTGAATCTCGGGATGAAGCCACAGCTGCTGTCATTGACTTAAATGATAGGCCTATAGGTTCTAGAAAGG
TAAAACTCATGGCCCATTGTGTGACCTTGGTTCAGCTGTCCGTTTCCTGTGACCACCTCATTGACAAGGA
CATCGGCTCCAAGTCTGACCCACTCTGCGTCCTTTTACAGGATGTGGGAGGTGCCTGGGCTGAGCTTTGT
CGGACTGAACGTGTTCGCAACTGCTCGAGCCCTGCATTCTCTAAGACTCTGCAGATAGAATACTACTTTG
AGACTGTCCAGAAGTTACGCTTTGGAATCTATGACATAGACAACAAGACACCTGAGCTGGGGGATGATGA
CTTTCTAGGGGGAGCTGAATGCTCCCTAGGCCAGATTGTGTCCAGCCAGACGCTGACTCTACCCTTGATG
TTGAAGCCTGGGAAACCTGCTGGACGGGGAACCATTACAGTTTCAGCTCAGGAGTTAAAGGACAGCCGTG
TAGTAACCATGGAGGTGGAAGCTAGAAACCTAGATAAGAAGGACTTTCTAGGAAAATCTGATCCATTCTT
GGAGTTCTTCCGGCAAGGTGATGGGAAGTGGCACCTGGCATATAGAACTGAGGTAGTCAAGAACAACCTG
AACCCTACGTGGAAACGCTTCTCAGTCTCTCTCCAGCATTTCTGTGGCGGGGACCTCAACACACCCATCC
AGGTGCGCTGCTCAGACTATGACAGTGATGGGTCACATGATCTCATCGGTACCTTTCACACTACCTTGGC
CCAACTGCAAGCAGTCCCGGCTGAGTTTGAATGTATCCACCCTGAGAAGCAGCAGAGAAAGAAAAGCTAC
AAGAACTCTGGAACTGTCTGTGTCAAGACTTGCCGGGTAGAGACAGAGTATTCCTTCCTGGACTATGTGA
TGGGAGGCTGCCAAATTAACTTTACCGTGGGTGTGGACTTCACTGGCTCCAACGGTGACCCATCCTCACC
TGACTCCCTGCACTATCTGAGCCCTACAGGAGTCAATGAGTATCTGACAGCCCTGTGGAGTGTGGGCAGC
GTGGTTCAAGACTATGACTCAGACAAGCTGTTTCCAGCATTTGGATTTGGAGCCCAAGTACCCCCTGATT
GGCAGGTCTCACATGAGTTTGCCTTGAACTTCAACCCCAGTAACCCATACTGTGCAGGCATCCAGGGTAT
CGTAGACGCCTACCGTCAAGCACTTCCCCAAGTTCGTCTCTATGGCCCCACCAACTTTGCACCCATCATC
AACCACGTGGCCAGGTTTGCAGCTCAGGCTGCACAACAGAGGACTGCCTCGCAATACTTCGTACTGCTGC
TCTTGACTGACGGCGCTGTGACCGATGTGGAGGCCACGTGTAAGGCTGTGGTGGAAGCCTCAAAGCTGCC
CATGTCGGTGATCATCGTGGGTGTGGGTGGTGCTGACTTTGAGGTCATGGAACAGCTGGATGCTGATGGC
GGCCCACTTCGTACACGCTCTGGAGAAGCAGCTGCCCGAGACATAGTGCAGTTTGTGCCTTATCGACGAT
TTCAGAATGCTCCACGGGAGACACTTGCAATGACTGTGCTTGCAGAAGTGCCCACTCAGATGGTTTCCTA
CTTCAAAGCCCAAGGTTGGGCCCCATTAAAGACACTCCCAGCCCCAGCCAAGGGCCCTGCACAGGCCCCA
CAGGTGTAGGTCCCCTTGGAAGAGCAGGCTACAATCAATCTTCAGCTTGCACCATCCTCTGGGCGTGGAC
CAACCTGCACTCTTTCACTTGATGACTTTATATGTGCTTCTGCTATTGCTGCTCTTTGACCTGCCTGCCT
GCCTGCCTGGCACCCTCACATTCAGGAAAGACAGACTAGTAATTGTAAAGATCTATTCATTCCAGTCACA
TACTTTGAAAAGACAGAGTTTGAATATAAAGCAAGCATGTGGTTGTCCTTTTCTTGGGGCGAGCTGAGCT
GGGACCGTGAATGAGATGGAAAGTGCTACCTCATAGGAGATAGCAAAGGTGAGGGGGAAAAAGATGTTTT
AGAGCAGGCTAAGGACTGCTCCTTAGACTTCCTATGCTAGCTCTGTCCCTCTGTTTCTTGGGAACATTTG
TGTAGCCCAGGCTGGCCTGCAATTTAGCATCCTGCCACAACCTCTTAGACGCTAGAATTGCAGGCATGTA
CTATCACGCCTGGTTTACAGTCCTGATTTTTCATTTGCTTTTTTTTTTTTTTCTTTTCTTTTTTTCGGAG
CTGTTTCATTTGCTTTTTGACATATGATCTTATATGTTCCAGGCTGGCCCTACATTGTGTAGCCAAGGAT
AACCTGAATTCTTGCTCTTCCTACTCCAGCTTCCCAAGTGCTAGCATTATAACCAGGCCTCAAGCGTGCT
TCACTTTTAACAGCTCAACAATTTAATAGCTTTTTTATATTAAAGATTTAATAAGCATATTCATTTTGGG
AAAACTTTATAGGACACATCCTAACCCACTTTAGAGTCTTTGGACTCAAGGTCCTGGAGTAGCTGGACTA
CAATTCCCTCAGTGCCTGGATGAGAAAACAGGTGTTGTTTGCAGGGTTATGGGAGGGAGGCTCCTAAATG
TAGAATTAAAATTTCCCATAACCTGTGGCTCGGTCATGGTAAGGGGACCACATTGTGAATCACAGATCCC
AGGAGACAGGTGTTTTAAATTTTGTTTGCTAATCTAATGAAACATTGTTTCAGATATCAGTATTATATAA
AAATAGGAAATGGGAACAAAGATTGGTGGCTCATGGTTGTAATCCCAACACTCAGAAGTCTGAGGCAGGA
GCATTGCTGTCTGTGTGATGTGGACTTAAGGTACACTGAGTTTCAGATCAGATAGAACAACTTTAAAAAG
CTAGCACATGTGCTGTTTGTATCTGGTTTGCATTTATTTTGGATGCCTTCTCCACCAGAACTTAGTCTCC
TCTCCTTTTCATGGCTGTTATTCTTTTGTAAGAATATACCAGAGTTTAGCAATTCCCTTCCTTACAGAGA
CTCGTTTTATTGTGCTTACACACCCTTTTGAGAAATTGGTTTTTAATGTGGAAACGGTAGACCGCAGGGG
ATATTTAGAATGTTAGCAGTTATTACAGAGAAGTGTGGTCATCTCATGTTAGCCCGTGCTCACCTTCCTT
CTCCAGACCTACTTTCCATTTTCTTCCATTATTTCACACATTTCCTTGTTTCTCAGTCACCTGTTCTCGA
GCTGTTAGAGCTTTTATTCTGATGTTCTTACATGATGAAAATATTTTCCCCTCAGCTGTTACCATTTCAT
GTTTTTATACTCGATATGCAAATTTATTTTTTATATGCCATCCTTTTAAAAAATATATCTGTATATGAAT
AATAATATATACCTTCCTCAGTGA

Результат:

https://img-fotki.yandex.ru/get/480022/158289418.471/0_181862_523af6b2_orig.png

Заказ 20170906_010:

>XM_008762414_frag
GCTTTTGTTCATATAGTTACCCTAGAAGATATGAGAGAGATTGAGAAAAACCCCCCAGCC
CAAGGGAAAAAGGGCTTAAAGATACCTGTTCCAGGTAATCCTGCAGTACCAGTGATACCC
AGTGCAGGGATGCCCGCTGCTGGGATACCCAGTGCTGGGATACCCAGTGCAGGGATACCC
AGTGCTGGAATGCCTAGTGCTGGAATGCCTAGTGCAGGGTTGCCTGCTGCTGGGTTGCCT
GCTGCTGGGTTGCCTGGCTCTGGAATGCCTGGCTCTGGAATGCCTGGCTCTGGAATACCG
GGTCCCGGAATACCCGGTCCTGGAATACCCGGTCCCGGAATACCTGGTCCTGGAATGCCC
GGTCCTGGAATACCGGGTCCCGGAATACCCGGTCCCGGAATACCTGGTGCCGGAATACCT
GGTCCCCCAATGCCTGGTCCCGCAATGCCTGGTCCCTCAATGCCTGGTCCCGCAATGCCT
GGTCCCGCAATGCCTGGTCCCGCAATGCCTGGACCAGCAATACCCGGTCCCGCACTGCCT
GGACCAGCAATACCTGGTCCTGGCATCCCCAGTGCAGGAGGAGAAGAGCATGTCTTCTTG
ACTGTAGGATCAAAGGAGGCCAATAATGGGCCACCATTTAACTTCCCTGGTAATTTTGGT
GGGCCCAATGCTTTTGGGCCACCACTCCCCCCTCCAGGATTAGGGGGCGCCTTTGGTGAT
GTTAGGCCTGTTATGCCTTCGGTTGGAAATAGTGGTTTGCCTGGCCTAGGACTGGAAGTT

Результат:

https://img-fotki.yandex.ru/get/206909/158289418.471/0_181864_d3038f35_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/206909/158289418.471/0_181865_f7fb020f_XL.png
Оригинал: https://img-fotki.yandex.ru/get/206909/ … f_orig.png

https://img-fotki.yandex.ru/get/232875/158289418.471/0_181866_1ba42b85_XL.png

Обнаружена программная 53532-спираль

https://img-fotki.yandex.ru/get/206909/158289418.471/0_181867_98254bf5_XL.png

Обнаружена программная 52233-спираль

https://img-fotki.yandex.ru/get/372788/158289418.471/0_181868_c919f8c8_XL.png

Обнаружена программная 52533-спираль

207

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 085

Online service of protein structures

Ищем аминокислотную последовательность: GGPGP:

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Заказ 20170907_001:

https://www.ncbi.nlm.nih.gov/nuccore/1174664874

>XM_004079588.3 PREDICTED: Oryzias latipes proline-rich receptor-like protein kinase PERK2 (LOC101162002), transcript variant X1, mRNA
atgcgtggtctatgtgagagcagacacgttccagaccggctccacccggggaacgcagct
ggatttccaacgatgtggctgctcggtgttgctattttcctgcttcggttcggttctgct
gggtccatgacaccaggtctgaacatcactgctggacctggagatgacgtcactctgaca
tgtggagacacggacatcatgaagaatccaacctttgagtggaacagaattgacctggag
gaggaagaacgtgtgataacatacaggagtggtggtgttgatctagacggtcagcatgaa
tctttcaagaaccgagtgtttctgaaggaccgtcagatgaaggatggagatctgtctgtg
gttctgaagaacgtgaccatgaatgacactggaacatatgagtgtagagttctacaacac
aatggttcacacagagaaatgaagacgatctgcatcatccatctgtccgtggatcctcca
ggtggcccgtctccaggtgatccgtctccaggtggcccgtctccaggtggcccgtctcca
ggtggcccgtctccaggtggcccgtctccaggtggcccgtctccaggtcacccgtctcca
ggtgatccgtctccaggtggcccgtctccaggtggcccgtctccaggtggcccgtctcca
ggtcacccgtctccaggtcacccgtctccaggtgatccgtctccaggtggcccgtctcca
ggtggcccgtctccaggtcacccgtctccaggtgatccgtctccaggtgacccgtctcta
ggtgacccgtctcagggtgacccgtctccaagtgacccgtctctaggtgacccgtctcag
ggtgacccgtctccaggtgacccgtctccaggtgacccgtctccaggtgacccgtctcca
ggtgacccgtctccaggtgatccgtctcagggtgacccgtctccaggtgacccgtctcca
ggtggcccgtctccaggagaacaaggaggactggaaggaagagaggagggaggagacaag
aaaggaggcagtcgtggtcgtcttggcctgatcattcttgctgctgctgtcgttcttgtt
gttgttctctggatctccaagaagaaaaaaggtccaaaccaaagttccagtggttccaac
aaccagcaggacattgaatttggtcgtctaaactcagattctgatgcagagagaaacaac
aaacacagatcagcctcatctggatga

Результат:

https://img-fotki.yandex.ru/get/232875/158289418.471/0_18186d_61cbcbec_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/236988/158289418.471/0_18186e_1abcdd31_XL.png
Оригинал: https://img-fotki.yandex.ru/get/236988/ … 1_orig.png

https://img-fotki.yandex.ru/get/249078/158289418.471/0_18186f_c464f7be_orig.png

Последовательность (GPSPG)*n образует программную 55323-спираль.

https://img-fotki.yandex.ru/get/232848/158289418.471/0_181870_bd1fdb34_orig.png

Последовательность (DPSPG)*n образует программную  55323-спираль

208

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 086

Online service of protein structures

Кушелев: Пространственные модели программных спиралей, которые встретились в трёх последних заказах:

https://img-fotki.yandex.ru/get/237815/158289418.471/0_181872_392240e4_XL.png

https://img-fotki.yandex.ru/get/470815/158289418.471/0_181873_36c9714a_XL.png

https://img-fotki.yandex.ru/get/470815/158289418.471/0_181874_f8328fe0_XL.png

https://img-fotki.yandex.ru/get/470815/158289418.471/0_181875_b8d654ff_XL.png

https://img-fotki.yandex.ru/get/224193/158289418.471/0_181876_eba80a41_XL.png

https://img-fotki.yandex.ru/get/224193/158289418.471/0_181877_782c23e_XL.png

https://img-fotki.yandex.ru/get/243077/158289418.471/0_181878_dee3eeec_XL.png

209

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 90 087

Online service of protein structures

Заказ 20170907_002:

https://www.ncbi.nlm.nih.gov/nuccore/1174664876

>XM_011487175.2 PREDICTED: Oryzias latipes proline-rich receptor-like protein kinase PERK2 (LOC101162002), transcript variant X3, mRNA
atgcgtggtctatgtgagagcagacacgttccagaccggctccacccggggaacgcagct
ggatttccaacgatgtggctgctcggtgttgctattttcctgcttcggttcggttctgct
gggtccatgacaccaggtctgaacatcactgctggacctggagatgacgtcactctgaca
tgtggagacacggacatcatgaagaatccaacctttgagtggaacagaattgacctggag
gaggaagaacgtgtgataacatacaggagtggtggtgttgatctagacggtcagcatgaa
tctttcaagaaccgagtgtttctgaaggaccgtcagatgaaggatggagatctgtctgtg
gttctgaagaacgtgaccatgaatgacactggaacatatgagtgtagagttctacaacac
aatggttcacacagagaaatgaagacgatctgcatcatccatctgtccgtggatcctcca
ggtggcccgtctccaggtgatccgtctccaggtggcccgtctccaggtggcccgtctcca
ggtggcccgtctccaggtcacccgtctccaggtcacccgtctccaggtgatccgtctcca
ggtggcccgtctccaggtggcccgtctccaggtcacccgtctccaggtgatccgtctcca
ggtgacccgtctctaggtgacccgtctcagggtgacccgtctccaagtgacccgtctcta
ggtgacccgtctcagggtgacccgtctccaggtgacccgtctccaggtgacccgtctcca
ggtgacccgtctccaggtgacccgtctccaggtgatccgtctcagggtgacccgtctcca
ggtgacccgtctccaggtggcccgtctccaggagaacaaggaggactggaaggaagagag
gagggaggagacaagaaaggaggcagtcgtggtcgtcttggcctgatcattcttgctgct
gctgtcgttcttgttgttgttctctggatctccaagaagaaaaaaggtccaaaccaaagt
tccagtggttccaacaaccagcaggacattgaatttggtcgtctaaactcagattctgat
gcagagagaaacaacaaacacagatcagcctcatctggatga

Результат:

https://img-fotki.yandex.ru/get/246987/158289418.471/0_18187a_6a403849_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/246987/158289418.471/0_181879_3cbcea01_XL.png
Оригинал: https://img-fotki.yandex.ru/get/246987/ … 1_orig.png

Те же программные 55323-спирали

210

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 20170907_003:

https://www.ncbi.nlm.nih.gov/nuccore/1174664875

>XM_011487172.2 PREDICTED: Oryzias latipes proline-rich receptor-like protein kinase PERK2 (LOC101162002), transcript variant X2, mRNA
atgcgtggtctatgtgagagcagacacgttccagaccggctccacccggggaacgcagct
ggatttccaacgatgtggctgctcggtgttgctattttcctgcttcggttcggttctgct
gggtccatgacaccaggtctgaacatcactgctggacctggagatgacgtcactctgaca
tgtggagacacggacatcatgaagaatccaacctttgagtggaacagaattgacctggag
gaggaagaacgtgtgataacatacaggagtggtggtgttgatctagacggtcagcatgaa
tctttcaagaaccgagtgtttctgaaggaccgtcagatgaaggatggagatctgtctgtg
gttctgaagaacgtgaccatgaatgacactggaacatatgagtgtagagttctacaacac
aatggttcacacagagaaatgaagacgatctgcatcatccatctgtccgtggatcctcca
ggtggcccgtctccaggtgatccgtctccaggtggcccgtctccaggtggcccgtctcca
ggtggcccgtctccaggtggcccgtctccaggtggcccgtctccaggtcacccgtctcca
ggtgatccgtctccaggtggcccgtctccaggtggcccgtctccaggtggcccgtctcca
ggtcacccgtctccaggtcacccgtctccaggtgatccgtctccaggtggcccgtctcca
ggtggcccgtctccaggtcacccgtctccaggtgatccgtctccaggtgacccgtctcta
ggtgacccgtctcagggtgacccgtctccaagtgacccgtctctaggtgacccgtctcag
ggtgacccgtctccaggtgacccgtctccaggtgacccgtctccaggtgacccgtctcca
ggtgacccgtctccaggtgatccgtctcagggtgacccgtctccaggtgacccgtctcca
ggagaacaaggaggactggaaggaagagaggagggaggagacaagaaaggaggcagtcgt
ggtcgtcttggcctgatcattcttgctgctgctgtcgttcttgttgttgttctctggatc
tccaagaagaaaaaaggtccaaaccaaagttccagtggttccaacaaccagcaggacatt
gaatttggtcgtctaaactcagattctgatgcagagagaaacaacaaacacagatcagcc
tcatctggatga

Результат:

https://img-fotki.yandex.ru/get/206909/158289418.471/0_18187c_74c0eed4_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/246987/158289418.471/0_18187b_44c3a647_XL.png
Оригинал: https://img-fotki.yandex.ru/get/246987/ … 7_orig.png

Те же программные 55323-спирали