61

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 061

Вышел 616-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

616 Цепи - фрактальные эталоны длины и угловых величин!
Двигатель-Emdrive "подошва Кришны" в скульптуре
Идол - это девайс/гаджет с фальшивой головой!
Открыта структура белка, содержащего прямой альфа-спиральный участок из 440 аминокислотных остатков Pro.
Качественная копия инопланетного девайса
Обнаруживаем белковые механизмы с помощью онлайн-сервиса белковых структур
Программная изомерия белковых структур

https://img-fotki.yandex.ru/get/772910/158289418.46d/0_18143a_a139e40_XL.jpg

https://img-fotki.yandex.ru/get/231315/158289418.46d/0_18143f_22b87e6d_XL.jpg

https://img-fotki.yandex.ru/get/232875/158289418.46d/0_18143d_f7f25f0_XL.jpg

https://img-fotki.yandex.ru/get/468374/158289418.46d/0_181435_721fbc5e_XL.jpg

https://img-fotki.yandex.ru/get/370413/158289418.46c/0_1813fc_d49b7085_XL.jpg

https://img-fotki.yandex.ru/get/479589/158289418.46d/0_181449_2cb40ae_XL.jpg

https://img-fotki.yandex.ru/get/470815/158289418.46d/0_18144a_5e21fd3_XL.jpg

https://img-fotki.yandex.ru/get/235925/158289418.46d/0_18145d_7cb1f105_XL.jpg

https://img-fotki.yandex.ru/get/467315/158289418.46e/0_181488_504c5b35_XL.png

https://img-fotki.yandex.ru/get/237726/158289418.46f/0_1814dd_8bba739_orig.jpg

https://img-fotki.yandex.ru/get/246987/158289418.470/0_1815bd_3aafce81_XL.png

https://img-fotki.yandex.ru/get/508985/158289418.470/0_1815b7_46b88843_orig.gif

https://img-fotki.yandex.ru/get/467152/158289418.470/0_18165f_350e860c_M.png https://img-fotki.yandex.ru/get/467152/158289418.470/0_181662_ded21d8b_M.png

62

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 059

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ 20170905_013:

https://www.ncbi.nlm.nih.gov/nuccore/JQ … rt=genbank

>JQFK01000531.1 Pichia kudriavzevii strain SD108 contig03168, whole genome shotgun sequence
atgtcgccaatggttcccgccagtggcccctcggcaccagcagtcccttcaatggctcca
caactaggagatatatttgccggtggtattccaaaactgaaacatgtgtccaaaccaagg
aaccctacttctcctcctggttcagcaccttcggttccaacggggagacccacaggaaga
ccttctaaaccaccaactacaaatggcgtcccctccataccgtctgctctaccaccgtcc
ttaccgtctgcttcacctccatccataccgcctgctcccccaacaccagctcctcctctt
ccctcagcatcggcaccatcgattccttccttcaatgctccatcgacaccctcattgcct
ccacagagaccaaacgtcccctccaaaagaccaaatacagccttcccaaaatcgtctgct
ccaccacagctaccttccctatcggctccacctcttcctggatccactcctccacctctt
cctggatccactcctccacctcttccgtcgggaaacgctttaccatctgcttcgtcatct
tcatcaccacaacctcctcctccacctccacctccaccaccaccaccacttagtggtaat
gctcctcctgctccgtcaaaaccatcatcaggcgcatcggctcctccaattacagccggt
ggactaccatttttaaatgaaatcaacaagagaagagatgaccggtttgttgttgatgat
gcaaaggtctcaaaagctagcggaggcattccaccatcaccacaacacaagaatccttca
ctgcctttaacctcggcacctcctgtgccttcctctcatgcaccaaatccaccgaatcta
ccgtctgctcctcctcctcctgctttagcaacaaacactcgcttgccaaataggccttct
gcatcaccttctccttttacaaattcgccaaagccacgttcaccattgccaagtaggtcg
tcaccgcaacctcctccactgccatcttctagtgctcctccactgccatcttctaatgct
cctccactgccatcttctaatgctcctccactgccatcttctagtgcacccccacctcct
cctgctcctcctgctcctcctgctcctcctgctcctcctgctcctcctgctcctcctgct
cctcctgctcctcctgctcctcctgctcctcctgctcctcctgctcctcctgctcctcct
gctcctcctgctcctcctgctcctcctgctcctcctgctcctcctactatttccggctcc
tcatcctcaaagattacttcatctgctcctaaaacatcaggtttaggtggaggtttacct
tttcttgatgaaataaaccagcgtagaaacgataaatttgttgttgatgataacatagtt
gcccagaagaaaaagcaaacaacaagtgcaccaccggcccaagaaactatcgaa

Результат:

https://img-fotki.yandex.ru/get/221708/158289418.470/0_1814e1_78ead022_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/247911/158289418.470/0_1814e2_dbd6ae3f_XL.png
Оригинал: https://img-fotki.yandex.ru/get/247911/ … f_orig.png

https://img-fotki.yandex.ru/get/246987/158289418.470/0_1814e3_930a3853_XL.png
Пролировая бета-спираль переходит в пролиновую пи-спираль по функции Кушелева

https://img-fotki.yandex.ru/get/470815/158289418.470/0_1814e4_dc391517_XL.png
Программная 25233333-спираль (8-дольный ритм)

Пространственная структура этого фрагмента (длина увеличена):

https://img-fotki.yandex.ru/get/205820/158289418.470/0_1815be_a129c222_XL.png

https://img-fotki.yandex.ru/get/246987/158289418.470/0_1815bd_3aafce81_XL.png

Интересная симметрия... Ось симметрии 4.5-порядка

https://img-fotki.yandex.ru/get/237726/158289418.470/0_1814e5_86a2efef_XL.png
Аминокислотная последовательность (APP)*n образует прямую пи-спираль длиной 59 аминокислотных остатков

Пространственная модель белка:

https://img-fotki.yandex.ru/get/508985/158289418.470/0_1815b7_46b88843_orig.gif

Мы видим длинную пи-спираль и подставку (упор) под неё.

https://img-fotki.yandex.ru/get/229553/158289418.470/0_1815b8_6a200d79_XL.png

https://img-fotki.yandex.ru/get/470815/158289418.470/0_1815b9_b486f825_XL.png

https://img-fotki.yandex.ru/get/233740/158289418.470/0_1815ba_886a2b87_XL.png

Эта белковая структура показывает, что композиционные углы настроены с точностью, достаточной для обнаружения белковых механизмов. На подобных структурах можно делать более точную настройку композиционных углов.

63

Re: Формы, механизмы, энергия наномира - 90

Заказ 20170905_011:

https://www.ncbi.nlm.nih.gov/protein/76 … XBU142C016

>CP005169.1 Saccharomyces cerevisiae YJM1433 chromosome X complement 3429 nucleotides
atgagtgaacccgaggtgcccttcaaggtggtggctcagttcccatacaagtccgattac
gaggacgatttaaattttgaaaaagatcaagagattattgttacgtctgttgaagacgcc
gaatggtactttggtgaataccaggattcaaatggcgacgttattgagggtatcttcccg
aaaagttttgttgctgttcagggatctgaagttggaaaggaagccgaatcatctccgaat
accggttccactgagcaacgtacaatccagccggaagtagaacaaaaggacctaccagag
cccatttcccctgaaacgaagaaagaaactctgtccgggccagtgccagttccagccgct
acagtgccagttccagccgctacagtgccagttccagccgctacagcagtatcagcacag
gtccagcatgatagtagtagtggtaatggcgaaagaaaagttcccatggattctccaaaa
ttgaaggctcgcttatctatgtttaatcaagatataacggagcaagttcctttaccaaaa
tcaactcacttggatttagaaaacatacctgtgaaaaaaacaattgtggcagatgctcct
aaatactatgtcccccctggaattccaacaaatgatacgtccaatcttgaaaggaaaaag
tccctaaaggaaaacgaaaaaaagattgttcccgaaccaattaatcgtgcacaggtggaa
agtggaagaatagaaactgagaatgaccaattaaagaaggatctgccccagatgagcctt
aaagaaagaattgctcttttacaggagcaacaaagattacaggctgcaagagaagaagaa
ctcttgagaaaaaaggctaagctcgaacaagaacatgaacgtagtgcggttaacaagaat
gagccctatacggaaactgaagaagcagaagaaaatgaaaaaactgaaccgaaacctgaa
tttacgcctgaaactgagcacaacgaggaaccgcaaatggaattattggcacataaagag
attactaaaacctcacgcgaagcagatgaaggcacgaatgacatagagaaagaacaattt
ttagatgagtacacaaaggaaaatcagaaagttgaggagtcacaagcagacgaggcaaga
ggagaaaatgttgctgaggaaagcgaaataggttacggccatgaagacagagagggagat
aatgatgaggaaaaagaagaggaagatagtgaagagaatcgtagggccgcattgagagaa
agaatggctaaactatctggcgctagtagattcggtgctcctgttggttttaaccccttc
ggtatggcttctggagttggaaataaaccatcagaagagccgaaaaagaaacagcataag
gagaaggaggaggaggaacctgaacagctccaagaactacctcgtgccatacctgttatg
ccatttgttgacccaagttctaacccattttttaggaaatcaaatctaagtgagaagaat
caacccactgaaacaaagacgctagatcctcatgcaaccacagagcatgaacagaagcaa
gaacatggtacacacgcctatcacaatttagctgctgttgatgatgcacatcccgaatac
tctgaccatgattctgatgaagatactgacgaccacgagtttgaggatgcaaacgatggg
ttgagaaagcattcgatggtggagcaagcttttcagataggtaataatgagtcagagaat
gttaattccggagaaaaaatttaccctcaagaaccaccaatctcccaccgtactgcagaa
gtatcacatgatattgaaaattcatcacaaaacacaactggaaatgttttgcctgtctct
tccccacaaacaagagttgctcgcaacgggtcgataaattctttgactaaatctatttca
ggggaaaatcggcggaaatccataaacgagtatcatgatacagtttccactaattcatct
gcattaacagaaaccgctcaagatatttcgatggcagctccaccagctccagttctaagt
aaggtgtcacatcctgaggacaaggtgccacctcatccagtgccttctgcaccctctgca
ccaccagcaccctctgtacctccagcactctctgcacctccaacacctccagcacctcca
gcacctccagcacctccagcacctccagcacctccagcacctccagcacctccagcacct
ccagcacctccagcacctccagcacctcttgcgctgcctaaacacaatgaagtagaagaa
catgtcaagtcatctgctccccttccacctgtatccgaggaatatcatcctatgccaaat
actgctccgccacttccacgtgcaccaccagtaccaccggctacttgtgaatttgactct
gaaccaacagccactcattcacatacagctccttctcctccaccacatcaaaatgtcacg
gcctctacaccttcaatgatgagtacgcaacaacgtgtgccaacctcagtactatctggg
gcagaaaaagaatcacgaaccctaccgccccatgtgccttcattggcgaatcgtcctgtg
gattcattccatgagtcagatactacaccgaaggtggcctctataagaaggtcaacgacg
catgatgtaggcgagatttccaacaacgtcaagatagagtttaatgcacaagaaagatgg
tggattaataaaagcgcacctcctgctataagcaatctgaagttgaactttttgatggag
atcgatgatcatttcatttccaaaagattacatcaaaaatgggtggtaagggatttttac
ttcttgtttgaaaactattcgcaactaagattctccttgacctttaatagtacaagccca
gagaaaacggtaacgactcttcaagaacgctttccatcgccagtcgaaacacaatcagca
cgtattcttgatgaatacgctcaaaggtttaatgcaaaagttgtagagaaatctcattca
ttaataaattcacatattggggctaagaatttcgtgtcacaaattgtatccgaattcaaa
gacgaagttatacaacccataggagcaagaacgtttggcgcaactatattgagttataaa
cctgaagaaggaatcgaacagttgatgaagagcttacagaagattaaaccaggtgacatt
cttgtaattagaaaggccaaatttgaagctcataaaaagatcggaaaaaacgaaattatc
aacgttggaatggactccgccgctccgtattcgagtgttgttactgattatgattttaca
aagaataagtttagagttatcgaaaatcacgagggaaagattattcaaaacagctacaag
ctaagccacatgaaaagtgggaagttaaaggttttcagaattgttgcgagaggatacgta
ggttggtaa

Результат:

https://img-fotki.yandex.ru/get/233577/158289418.46f/0_1814d2_af5cd371_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/470815/158289418.46f/0_1814d3_7eba4049_XL.png
Оригинал: https://img-fotki.yandex.ru/get/470815/ … 9_orig.png

https://img-fotki.yandex.ru/get/243077/158289418.46f/0_1814d4_506785ab_XL.png

Последовательность (VPVPAAT)*n образует программную 5232532-спираль (семидольный размер)

https://img-fotki.yandex.ru/get/249307/158289418.470/0_1815c0_89896b32_XL.png
Пространственная модель  5232532-спирали (вид вдоль оси симметрии)

https://img-fotki.yandex.ru/get/233044/158289418.46f/0_1814d5_2177ec3b_XL.png
Программная 5233-спираль

https://img-fotki.yandex.ru/get/756497/158289418.46f/0_1814d6_49ee9f59_XL.png

Последовательность (APP)*n образует программную 232-спираль

64

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 023

Online service of protein structures

Заказ 20170905_009:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

Scheffersomyces stipitis CBS 6054 hypothetical protein partial mRNA

Результат:

https://img-fotki.yandex.ru/get/371503/158289418.46f/0_1814c8_29c6c203_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/371503/158289418.46f/0_1814c9_bf8e1d8b_XL.png
Оригинал: https://img-fotki.yandex.ru/get/371503/ … b_orig.png

https://img-fotki.yandex.ru/get/467152/158289418.46f/0_1814ca_bfcede38_orig.png

Последовательность (APP)*n преимущественно образует программную 322-спираль

https://img-fotki.yandex.ru/get/249078/158289418.46f/0_1814cb_5ed82148_orig.png
Последовательность (HPPHHP)*n образует программную 322133-спираль

Эта схема вторичной структуры белка напоминает геодезическую шкалу:

https://img-fotki.yandex.ru/get/756497/158289418.437/0_17e237_4f6cd6af_XL.jpg
Подробнее: http://nanoworld.org.ru/topic/1743/

https://img-fotki.yandex.ru/get/232875/158289418.470/0_1815c1_f0d734a6_XL.png
Пространственная модель  322133-спирали

65

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 065

Online service of protein structures

Заказ 20170906_001:

https://www.ncbi.nlm.nih.gov/nuccore/1129837577

>SHO75672.1
atgtcgttgcaggtgaacctgtcgtcgcctgctattcgcagcgcgtatgagaaagtgcta
gatggagtctatgactatcttgtactgtcatacaaaaagttgtcgaatgatttagacgta
tccgcgagtgggaaaggcacactggatgatctctctgaggagttctcggacggcaagatc
cagtatgccctggcccgtgtcgtggacccgaacacgaagctgccgaaattcgtgttgatc
aactggtgtggtgatggtgttcctgaaagccgaaaaggcctgtttccctcgcacagtgcg
actgtcgcggatttcttcaaggtgtatcatgtgtcgatcagcgcacgcacagacctggac
gtgacgccggatgccatcctgcgcaaggtcaaagacagcagtggcagcaaatatggtacg
gctagctcgcgcgcttcggagcccattgtcccagctggcacatcgtacaagccgattggc
agacccgacattcgtggtatgcaagccaaggccccgaaagacacgatcactcctgtgggt
acttcctatacgcctgctcgcgaagagctacagcgtctccgtgagggaaagctgcaaaac
ccccctgctcctcctgcagcgccccgtccttctgcgccccagccaagtgggccgccccct
ccaagtgtaccgcagcctcgcacagcggctgccgcaccgccgccgccacctccggccgcg
tcaacgccacctgcacaaggcagtgatgttccacccaaacctgcagacgaagataagatt
cagccagtcggcacggcctatacacccgtgtcactacctcgtcctggaaagctttctttg
gaccgaacaaagatgttttcaaagccaagtgagacggattcggtgcctccagttcgtcgg
tcaacacccgggcgacttacctggagccagcgacaagctatggccaaagccgctgacgag
gaggcggagctaccgagtcagacggaggctacgccagcaccccctgcccccgaagcgcct
cctgctccggctcctcccgcgcctccagctcctcccgcgcctccagcgccttctgctccc
cctgcacctgaagcccctccagcgcctccagctcctccagcgcctcctgcgcctccagcg
cctcctgcgcctcctgcgcctgaagctccgcctgcacccgaggcacctgtacactcggtc
gacgacgctgttgctcgaatgcagggaatgtctctgggcacctctgagggcctatgtgct
atggttctctacgactacgatgctgaggaggacaatgaactttccctgcgcgagggtcag
aaactgatccatgttgaccaggtggacgaaggctggtggtctgctacaggaccggatgga
tcggtcggcttattccccgccaattatgttgagctgttggaacgtcatgtgccttcacag
gaggagcccattgcgccagaaccacccgctgcaccgccggcgccaactgcgccaccggct
ccagcggctccaccggcgccgcctgcacctccagcgccgcctgcgcctccagcgcctaca
gcacctccagcacctccggcacctccagcacctccagcacctccagcacctccagcacct
ccagcaccgccttcacctccagcacctccagcacctccagcaccgcctgcacctccagct
ccgtcggcctcggccccggagactgccgcggctcctacgaacagtgcgattgccctgtat
gactacgacatcgatgaagacaatgaaattgctcttgcggaaggcgatcgcattgttgac
attgagtttgccagtgacgattggtggagcggcacgaatgagcgcacaggtgccaccggc
ttgttccctgccaactatgtcgagtaccaatcgtag

Результат:

https://img-fotki.yandex.ru/get/206909/158289418.470/0_1815d4_6481d386_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/484029/158289418.470/0_1815d5_251e04cd_XL.png
Оригинал: https://img-fotki.yandex.ru/get/484029/ … d_orig.png

https://img-fotki.yandex.ru/get/372429/158289418.470/0_1815d6_72f3596d_XL.png
Первая последовательность (APP)*n  не образует программной спирали

https://img-fotki.yandex.ru/get/467152/158289418.470/0_1815d7_58a3af0d_XL.png
Вторая последовательность  (APP)*n  образует программную 223-спираль

66

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 066

Online service of protein structures

Заказ 20170906_002:

https://www.ncbi.nlm.nih.gov/protein/82 … XBU142C016

https://www.ncbi.nlm.nih.gov/nuccore/827069103

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_008097846.1 Colletotrichum graminicola M1.001 hypothetical protein partial mRNA
ATGCCACCGAAGGCAGGTTCTGGATCGGGTGGCGGCAAGAAAGGAGGCGGTAAGAATGGGGGCAGCAAGG
GAAACGGCGGCGGGAAGAAAGCTGGCGGGAGACAGACCGCGTCGTGGAGGATCAACCACGAGCCCAGACA
GACTCGATCCCAGGCTCGTGGAGCCGGAAGTCGGCCACTGGTCGCTTTGGACATGAATACTGGAGTGGCG
ACGACCGCATCGCACCAAGTAAATCGAAGGGCGACGCCGCCGCCACCAGCACCACCAGCGCCACCAGCAC
CGCCAGCACCGCCAGCACCGCCAGCACCGCCAGCACCGCCAGCACCGCCAGCACCGCCAGCACCGCCAGC
ACAGCAAGGGCAGCAAGGGCAGCAAGGACATCAAGGACATCAAGGACATCAAGGGCAGCAAGGACAGCAA
GGGCAGCAAGGACAGCAACAACTTCCACCACCTCCTGCTGCTGGTCCTCCGCTGCCGCCAGGTCCACCTT
CAGTTCCCACGGCGGACAATCCTAGCGACGACAACGATGATAGTGATGATGGCCAAAATAGTGATGGTAG
TGACGGTGGAGATGAAGGAAACAAGAACGACGACGGCGATGATGATGACGATGGAAACGAGGGAAACAAA
GGCGACAAAGAGAATGACGGCGACGACGATAATGGTGAGGATGGCGGTGGTGGCGGTGATGGCGGTGATC
GCGAGGATGGTGGGGATGGTGAGGATGGTGAGGAGAATGGAAACAATGGCGATGAGAACGATGAGGGAAA
CAAAGATGGCGAGAATGGAGCCTTCGATGGTTCAGGTACGGGCAGCAACTCCGGCAGTAACGGTGGCACA
AACCCCGACGGGGGTGCTGGTCCCAACCAGAACGACGGTTCGGCCACGGGCTCCAGTCTCAGCGGAACCG
CTGGCCAGGACGGAAACCAAGGGCAGCCAGGTACACCAGGGGGCCAAACGACTTCCCGGAGCACGGGTGT
TCCCGCGTCGCCCGATAGCTCACCGGAAACCGAGCCCTTCCCCCCGTACACGGAGCCCTCTCCGTCGACG
TACATAGATACAAGCCCGCCCGCAGGCCGTGGGGGTCGCCAAGACGATAATAGTAGTAACCTTGGAGGCG
ATGGGGATGATGGGAATGAAGAGAGCGGGCACGAAGACCAAGAAGGGGAAGAAGAAGACGAGGAGGAGGA
GGAGCAAGAGGAGGAGGAAGAAGACGAAGAAGAGAAGCCGGATAACGGGGCCAATCATTCCCCAAGACAC
CGATCACCAAGTTCCTCTCCAGGCCCATCTGCATCGGGGCAGCATGGGTCGCAGACATACCCAGGGCCAA
GAGGGGGGAATATGCCCTCGGCTGGGGGCGCCGAACGGTCTGGAACCGCGCCCGGACGCAGTACCGGCCC
CGGCTCTGGCCGAGGCGGCGCCGGTCGCGGTCGCGGTCGCGGTGACGGTGGCAACCGTGCTGCGCCATTC
CGGAGGATCGGCGCACTCGGAAAGTCCCTGCTTCCTGCTGGGGACCAGGCAACCGGGCATCAGCAAAAGC
GGGGACGAGAACAAGACGGGGACGGGACTCGGCCGGCTAGAAGGCGCAAGACGGACTCGGCCGAGCTGGA
GAACCCCGCGCAGCCCGCCTCCGCTCGCGGACCCAGGACGGGCACACCGGGGAAGAGACCGAGCGGCTTG
TTTGACACGCAGGAGACACCGACGAAGAGACCGAGGCTCGGATAA

Результат:

https://img-fotki.yandex.ru/get/245409/158289418.470/0_1815d8_2f9b4f34_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/232875/158289418.470/0_1815d9_1a48d270_XL.png
Оригинал: https://img-fotki.yandex.ru/get/232875/ … 0_orig.png

https://img-fotki.yandex.ru/get/249307/158289418.470/0_1815e6_e4870be0_XL.png

Последовательность (APP)*n образует программную 252-спираль, переходящую в другую программную 233-спираль, образованную последовательностью типа (GHQ)*n, которая в свою очередь переходит в программную

https://img-fotki.yandex.ru/get/402270/158289418.470/0_1815ec_9794a46b_XL.png

https://img-fotki.yandex.ru/get/206909/158289418.470/0_1815ed_d6ed28a2_XL.png
553253-спираль, образованную последовательностью (GQQ)*n

https://img-fotki.yandex.ru/get/373867/158289418.470/0_1815e7_4de2657b_XL.png
В этом же белке встречается спираль Кушелева (Q-спираль или 35-спираль), образованная аминокислотными остатками (GR)*n

67

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 067

Online service of protein structures

Заказ 20170906_003:

https://www.ncbi.nlm.nih.gov/protein/10 … XBU142C016

https://www.ncbi.nlm.nih.gov/nuccore/1029178971

>OAL43592
atgcaaattcgtggctactggacgagaagcctgacactcgcttcgccttcttctcctcct
gagcattcgtttccgccttctggcgacattgctgtcgctcaccccaacatgatgccttcc
atcaccaccaccattttgaccacggcggtcactttgacgagcttcgtcactgtgaccggt
gctgccggcgggccaccagctccaggcgggccaccagctccaggcgggcccccagctcca
ggcggcgcggacatcattgccgctattgagaagctccctcagtgcgcgcaaggcgtcgtg
tttgaagccctctcaagcagctactgcagcccgcatgactacgcctgcatctgtggagag
ctcgaaaagttcgacatcggaggcaaggtcaagtccaagtgcggacccaaggacttcgag
gcatacgtcaagttcctgggcgaggtgtgccacccggctcctccaccaccaactcccact
ccgtataagccgtcctcggagtaccccaagccccctccgccatattctacccctatccct
ccccccaagccgtcttcaacacccatctactctcctcctcccaagccgtcttctacaccc
atctactctcctccccccaagccatcttctacaccaatctactctcctccccccaagccc
tcttctacaccaatctattctccgccccccaagtcttcggagaagccgcccaagtcctcg
gcctacccatctccacctccccccgtcacgcctccggtctaccccacgccaccgcctcca
ccgcccgtcgtcaacaacgtgacgattcccgtccccgtgcccggcaaaaatatcaccttg
acgacgacgattaccaagatcttcaccgtcactgagggcggcaaggaaaagaccatcacg
caggtcatcactacgcccgtcaccctgcctgctcccccggcgcccccagctactcctcct
cctgcgcccccggctccccctgctcctccagctcctcctgcttccccggcgcccccagct
cctcccgctcctcccgctcctccagcgcccccagcccctccagctcccccagctcctccc
gctcccgaagcgcccccagctccccccgcgcctccagctcctcctgctcctgcgcctccc
gctccagctccccctgctcctgctcctcccgctcctgctcctcccgcccctgtggttccc
accgaggtggcaccgccaacaccggagttcactggcgcggcagccggtatccgcgtcccg
gagtttgcttcgttcaagggcgccgcgctcgcgggtctcatgggacttatgggcttggct
tttgccgagttgtaa

Результат:

https://img-fotki.yandex.ru/get/205820/158289418.470/0_1815f9_69389917_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/249782/158289418.470/0_1815fa_1236b1b1_XL.png
Оригинал: https://img-fotki.yandex.ru/get/249782/ … 1_orig.png

https://img-fotki.yandex.ru/get/479032/158289418.470/0_181607_1e85ecef_XL.png
Последовательность (GGPPAP)*n  образует программную 552232-спираль

https://img-fotki.yandex.ru/get/402270/158289418.470/0_181654_7997094c_XL.png

https://img-fotki.yandex.ru/get/765674/158289418.470/0_181655_b60e1256_XL.png

https://img-fotki.yandex.ru/get/246987/158289418.470/0_181656_afeac3aa_XL.png

https://img-fotki.yandex.ru/get/369579/158289418.470/0_181608_91e3986b_XL.png
Последовательность (APP)*n не образует программных спиралей

68

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 068

Online service of protein structures

Заказ 20170906_004:

https://www.ncbi.nlm.nih.gov/protein/57 … XBU142C016

https://www.ncbi.nlm.nih.gov/nuccore/576993497

EUC66439.1

>EUC66439.1
atgcgcacagccaacgctcttttttctggcgctctgttctcccttgctattcaggtcgtg
gctggtttctcattcgaggatgtaccccgtacgaatctctttgcgcgcgcagacccatgc
cctcctggtcagtacttcgacaacggatgcaggcgctgtccggcgggctcttactgtggc
ggcaaggacgcgaagcagtgtgaccaaggacaatactctgatccaggggcgtctgtctgt
tctccgtgtccagctggatcgtataccaaccaaaagggcaccaccaaatgtaccactgtc
cagtgcgggtggtacggctccgggtccaacgcagacaacaacaggggggcaaccgaacag
aaacaatgtggcagcggatccttcagctcggaaggtagcacggtttgcacaaaatgtccc
gcgggttcctattgtaattctgcgaccacatgcgcaccttctctatgtcaacctggaaga
ttctcggataaggaaggtgcgagtgattgtacagaatgtcaagcgggcgaatatatcaac
aggtatggatcgacgtcctgctgtaaatgttgtgccggtagcttccaaagctccaccggc
caaacacactgccaggcttgtccagagcaaactcgaccgaatggtcaaggtaaagttttg
gttacatccgacctcggctccaagagcagtcagcaatgccatgcgtacaactttggcgac
ccagcacctttgcctgccgcttgcgttgatagcaatgtgacgcaattccaggccacttgt
cctcactcgctgaaggcttacatctttgaaaagatggacggaggcgctcctattgtaccg
gttcttttgccctctggtgcaatccactttgctagagtcggcccatcggacaccagccag
gagattatccagatactactcgccaccgaaggtgtcaaggcagatatcctaggtgatctg
gagaatgtcgttggcgagggggtagattgggaatggtctcttcagcatgtgcggaaagaa
ccgaggggtagggtatggcaggatgaagaattggagcaactagatgatgaaatcctaagc
aatgatttcccggcggaacagctcatcccaaatcgacccgaggcaaaacatgatttacaa
cggcatttttcggcatttccgctcacatcacatctacattcccctacagttcgtttaata
tcccaacacccttacctcagttttcatgtcactttcgaacgggttccagaaataaccgat
gggtttgttatgcaatggtttattgcacactcctcgactgtagaggacataatcaacgat
attggggataaccttggccttgcggtataccttgccggaccaggtggagggaaggtggat
tacgctattgaggtatttgcgccagatagtgggaaggacgtcgaacggctggacccttct
gcgagtgttacggccgtactacgaaaactagcgcctggaagaaggatacgtttagtggtg
cccgaagaatggtatcgccgccccaaggcaaagtccttctcttctcacctttcgctcacc
gaagacgacacgctcaagcttgctgccccaatcgatgaaccgaaccttccaaatagtgaa
ggagagtccggtgaaaacggcgacgggaccgccaagcagaactcccaacaacccccatcc
gttccatccagtcccgttctccctcgacctcgaccattctcggctgcctctaattcgtcc
gatgctgactccccttctcgacaatccactttttcgactcatcggttatcctccatgttt
gacagttggctgagtatatctcctactggcgcgattacactaccatcacagcctaatgcg
gcaccagagaggattagtgttagttcgcccttgcctattgacccaggagatatgcggagc
ggaagccaagatccgggaaatatgttggagactgaagaacagaagactgagtttgaggag
ttcatggacgagtttggtatcaaaactgaacagagaccaaagatgcgggacatgacctgg
gaccggaagaagtacttgattgaccagagcaagaaccgcgcctcggcggctcccgcatta
tacaataataacaatgcgtcttctgctaccgttggtccggcgagtgcaagttcgttggtt
cccaagttgctccctcaattatccggaactgcgcttgggaaattctccgtagcacgattt
ggaagttggaccgccgcctcagcacctaatggtgcaactaccgcattcatgcccggcgaa
ctgtctccaaggtctccaaagggctctatcaaacgacagatgtcatttggttcaaggcgt
actagcttggagccaacagcagaggagatatccgggctcggatcaccaccaaggtcacct
cccctctctcctaaaccaagcctctgggcctcgtggtggggtgctcccggtcatccagta
acggcggaaggggaaaggtcgagcgataaagggaagagtgctgtcgcggagctagctcgt
cttggtcaaggcgcgccgccccctcgagcaaaccaatctactgtcgcgccatatgttact
ggaataactgggagtaaatttcatagcacgacgttggtaaaacacttggtcagcctgagg
atacatgctgcaacagccaaactggattggatcaaggaattcattggaccaggtcaagga
atggaagcgctctccactttgatcgttgcgctagtcaagaataaggagaagaggaggaac
ttgactcaatcagaatccatgtcacttctcgaatgcaccaagtgccttcgtgtgatcgtc
aatacggatcctggcttgtcaaagatactcacgatgccaaacctaatgttccaaatagcg
acttgcctcgacaccggaaacgtaaaaatacgttcgaatgtagcagatttactggcaggg
atatctgtggtttcggaggaccaagggcataagatggtgcttgacgcgctttccgacttt
gcaactgtgaatcgcgaattccgattcgagcagcttattgatacgcttcgagttcctgag
ttgacgctggatgatgtggacgaagcattttggtccgaaagaatgcctgctcttgttctt
cttatcgccataactgcatcctgcccggatcttgaacagagaatagcgctgagagatgag
cttagtaggcgaggtttcaacgaaatcatggttagtttaaggtacctcagcccaccctca
atcgttacagaacggctcgatggctactctgaagacaaactcgacgatgaagaagacctt
cgagcgcgcattcgaaagcagtttgagcaatcagaaaaagaacgggaagattgggctggc
tccgagactgggctggtattcgagagaattttaaccctttctgaggaatatgacggagtc
cccgatatcatccttgagatatttcgctcccatgtccggatcctggaacaacctaccaca
ttgggggttaaatcgcgagttttcatcattctgcatagatttatttcccaactggccacc
ttggaagatgtagagcacgaatgggtccctttactcagacgactactcgattcagttaaa
gacataaccggggtttgtccagagtttgccgatgataactctaggcagaccagtactaca
gtcgatgaacttcgcgggcagttggaagacatggtgaaggagaaacaagactctttggag
aaaatacggagtctcgaaatagagctcgatacgctgaaatcgatgcaggagagttctata
gtcaaagggtctgggcaggagaacatgcatggtattgtgcagaggcttgtacagaaggaa
aaggcgaatgttcgtcttcaggctgacatggataggctgcgtaacgagaacgagaagctt
attgaagcgtcggaagaacaagagcgcatcaaacgtgaacgagatcgagcgaaatggagt
gctatgactgaagaaatgtcaaatagtagggctaaggtcgcagaactcgaaagttcgctc
cgcgagaaagaaaaaatggttctctacttgaagcgcgcgatggaggctctttcttcgagg
tttgaatctgccaatagcacacgtgaagcagtttccgaacggcctgacgataacttcgat
gcggagagtataactaaacaggcagtagatgagctttctgccaaggaccagcaaatagcc
gaaatgcgtcgggaactagaggagctcaacaagaaactcgaggaagttcaatcaagcttg
aagcagcagtcggcggagcgtgaattcaagactcgcgtcccgccgccgccaccccctcca
cggcgtcagtctcagcctttcggcgactctgatataggaagtgcacctgctctccctcca
tcgccgcctccccctccccctcctctcgtactgagccgttcacatagccttagcgccatc
gccgcacctccgccgccgccacctcctcctccgccaccacccccgccaccgtcccttccc
gtcaatttggttatcgccccctcaagcagcgctcctccaccgcctccaccgcctccacca
cctccaccatcggcatcattcattccttatacatcctcgggggtttcatcgcctcccgct
cctcccgctcctcccgctcctcccgctcctcccgctcctcccgctcctcccgctcctccc
gctcctcccgctcctcccgctccaccgccgcctcccatgataccacctccatccaacgtg
ggagcaccctcagcatggaaagcatccaaacggaccagtgtctccgcccctcctccaagc
aagaaactcaagcctttcttctgggacaaggtctcaactgcagggggtgttcaaacagtt
tggggacagcttggcatgatgggagggcaggttgatctcaccgacttggaagatgtcttc
actctggaccaggcaccacctaaacctgtcagtacttcgaatacgacaaagaacaagccg
cagcaagttacaactatgttggacatcacacgcgccaataacgttgccataatgctcaag
acactgaagctgtctcctgtcgctattcgcgaagctatcctagccgtagatgacacacgg
ttgtccgcagaggatctggtcgcaatatcaaagcaactccccaccgttgaggaggcaaat
cggatacaagatttcggagacgtcggtaaacttgcagaggcggaccgatactttagcgag
atcctgaaaattcccagactccaagaacgtttatcatgcatgatttaccgccggcgtctc
gaactggatattattgaagcccagccagacttgtcaatacttcatgatgcagctgtggaa
ctttgcacctcagataaactgcgcaggctacttcaggttgtgttagctgtcggtaacgca
ttgaataaatccacattccgtggcggcgcatctggtttcaagctaaaatcgctaatgaag
ttgaaagaaacgaaaaccgcgaaaggagaatcagagtgtccgactctactccactacctt
gcccgagttttgttacgctctgagcctccagccattctttttatcgaacaagtcccccat
ctggaatctgctgccagggtctcggtccaaactgtgatgtcaggcgtaaatagcatcgaa
gcggggcttaagaagactacctccgaaatcatatcctgtaggaagtcttcaaattttcct
tctgataaattcgggtctgttatgcagcctttcattaggagctcagctgaaagtgtctat
tcgctgaagtctcttgccgagtcaactcaagccaagctcgctgagatggtatcatatttc
ggagaaacttctgaaggacccgagcccacgaagccggaggatgtgttcgaagtgattcta
gctttctcttcatctttgcagaaagctgcgctggatgtcaacgcaactatggcgcgaacg
cttccctcagtactaattgcagcaagcgaagaattgacatccactacgcccaagcaagaa
aaggaagaacttttatcttcatcagattccgttccccgaagcatcaacaatgtgtatctt
tctgctggccgcggtgatcttgaccaagcaattcggagcctgcgcaccggccgacgagcg
cgccaagataggccattgagcaagatcttccttgatggaggaagcaatcgccgtagccga
ttgtttgattca

Результат:

https://img-fotki.yandex.ru/get/232875/158289418.470/0_18165d_7eb35b40_XL.png

Фрагмент:

https://img-fotki.yandex.ru/get/467152/158289418.470/0_18165e_887262f5_XL.png

Развёрнуто (фрагмент):

https://img-fotki.yandex.ru/get/467152/158289418.470/0_18165f_350e860c_XL.png
Последовательность (APP)*n образует программную 335-спираль, характерную для структуры классического коллагена. В данном случае Ala замещает Gly.

69

Re: Формы, механизмы, энергия наномира - 90

Формы, механизмы, энергия наномира. Сообщение 90 069

Online service of protein structures

Заказ 20170906_005:

https://www.ncbi.nlm.nih.gov/protein/11 … XBU142C016

>SIQ78668
atgtccccgggctggaccgatccgccgtcggcgaccggcgtcatcgtggagaccgccggt
gacgtgctggtgctgcgtaccgaggcggacgcccgggaaccgttcgtcgcgctggctttg
gcgctgcccgtcgaggccgggcagaccgcggtggtgagcgcgccgacggtgacgggccgt
accgacttcttcgagctccttccggacctgctgatcgagcacctcggcggcagcgccggg
gcggtccgggtcgtcgcgacgggcgcgtacgccccctcggtccaggcggttcccgcggcg
cggaagctggccgagtgggtcggccaggacgtgctcgtgccggtcgtcgggctggtggtg
gcgcccgatggagggcatctcctgccggccgacgcgctcggctcgatctgggttacgtgc
tcgcccgacgggccgccccgcccggcggccgcctggccaccgccggccccggcacaggcc
gagcccgtaccgcctccggcgccatccgcaccttcgtcaccagctcccgcgcctcccgcg
cctcccgcgcctcccgcgcctcccgcgcctcccgcgcctcccgcgcctcccgcgcctccc
gcgcctcccgcgcctcccgcgccgcccccactgcccgcgtccgcggctgtgccgtcggcg
ccgtccacgacttcgtcacccgcgtccgggtgcgtggagttgtcgcccgcaccggcgtcg
cccgaggcgccaccccgaccggtacgccgcgagtggcccgacgggggaccctggtggctg
gtgtcccggggtgacggtgtggtcgcggtgccgcgcgagcgtccgcccctcgtctggctg
ccgccccgccccgcgcccaccgcacccgcacggagcagagccgccaccccgccgcccgac
ctgcccggcgtacgtacccgggctggctggtccttcgtggacgaaccaatcggcgacccg
ccgactccggcgctcgccggcttcgtcgtggaggtcaccgtcggcgcgaccgggttccgg
gtcggcggccgtccgaccccaccgcgagcgttcgcgaagctggtcgcggcttgccgcccg
gacgcgcgccaacctgtcgtgctcgtgccccggggcgcgaccgcctccgggtcggcggcc
gacctgctctacggcggcctggccgacgcgctggccgtccatgtctacgccgccgacggg
gaggtgcagcagaccagcagcggactgctgcggaccactggcgtcttccgccgctggagc
ccccggcgcggccgaccgggcgaggggcgaccggcgcgccagatcagggtggtcggccag
gtgctaccgccgctgccgggcacggccggccgtcgcgtcgtgcccgccgaccgtctgccg
ggcgccgagacgacgcggaccgttccgccgtccgccctggacccggcggccggcgagtcg
cgcatcgagctgaagcccgcggtcgagccggttccggcggccggcgcttcgcacaccgat
ccgagcccggcggtcgagccggtgccggcacccggcgggccgggacggcagccggacgcc
caggccggtgtcgacgccgccggcgacccgggcatcgaacccgatcccgagccggagccg
gtggacgcatcgttcgccgcactgctcgatccggggcgctggcacacccggtcggcggtt
cccccgatcacggtggttcccgtgccgccggaaccggcggaacccgcgccggcctccgcc
gatccggctgcggcgtcgtccgccgcgccgcccgcgatgtcgcccggcgccgcaccggcg
gttcccgccgaactgccgacgtcgcgggcggcgacggcacccggcgacggagccggacct
gtcacgctggcgcctccgggtgtcacggccgggccggtccccggcgctccggcggccgcc
gcggtggaccgccccgagccggtcgctccggtgcggatcagccttcccggcgcagctgcg
agcgtccccggcctgcccgagggcgtggtggcgtcgagggccgacgcgacctccgtcggg
gtgtccgggtcctccaccgccgcggcgcgcctccgcggcagcgacgcggccgacggcggc
gcggacgctccggccaacgcgtccggagggctcgccggtcccgccacgaccgtgccgcga
gcacgctggcttccgagcgccgatccggagctgacggtcgcgaaccgtgcggcgctgcgc
caggcggtcggcggccgctacgacgcccacgcccgggtggtcacccggaccctggccgag
tcgccggggctgcgggccgcggcgggcgcggtcgccgacctcgcggccgggctcgtcgcg
gtgcgcgcttactgcgacggtggacgtgagtacgtcaacgagatgctgcgcggtggcggc
gacgatgaggcggccgagcgggtcgaactgctggcccgctgggccacgtacgggctgcgc
cggctcccgtcggtgttcggcccggtcttccggcccggtcccgccgacttcgcgcacgtg
cgcgcgtaccgccccggtgacgtgctcgccgagccggctttcgtcgacgtggacctggct
gccggcccggtcccgccgtctggggtggagttcgcgatctggtcggtcagcgcccatcgg
ctcggcgggctggccgccgacaccggcccgggcggcgccgtcttccagccgggcagccgg
ttcctggtgctcgcggtcgaggagcagcccggcgagggcgcgccggtgcgggtgatgctg
caggatctcggcgccgcgtacggcaccgagccgcgccgcggggggcgcaacgactcggag
cggatcctggcccagctgcgggcggcgccgcgtaccggtgcgagccggacgatgggcttc
gccccagggctggacgacgagggccgccccttccagcggccggcggaactcgccggcgct
gccgtggtgaacaagggtgggagcgcgtga

Результат:

https://img-fotki.yandex.ru/get/371503/158289418.470/0_181660_b7604fc0_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/371503/158289418.470/0_181661_caf3bc0a_XL.png
Оригинал: https://img-fotki.yandex.ru/get/371503/ … a_orig.png

https://img-fotki.yandex.ru/get/467152/158289418.470/0_181662_ded21d8b_XL.png

Последовательность (APP)*n образует другую т.е. не 335, а 535-спираль

70

Re: Формы, механизмы, энергия наномира - 90

Двигатель-Emdrive "подошва Кришны" в скульптуре

Кушелев: Оказывается двигатель-Emdrive "Подошва Кришны" запечатлен не только на иконах и гравюрах, но и в скульптурных композициях, причём самими инопланетянами...