151

Re: Online service PROTEIN PICOTECHNOLOGY

https://yadi.sk/d/nWEkBJRdhpP4D
Подробнее: http://nanoworld.org.ru/topic/1150/

Заказ N95 из 100:

>TBCA_YEAST
ATGGCACCCACACAATTGGATATAAAAGTCAAGGCCTTGAAGAGGCTGACTAAGGAGGAAGGGTACTACC
AACAAGAACTGAAAGATCAGGAAGCACATGTGGCAAAACTTAAAGAAGACAAGTCAGTTGACCCATATGA
CTTGAAGAAACAGGAGGAGGTCCTTGATGACACAAAAAGATTATTACCTACTTTATATGAGAAGATTAGA
GAATTTAAAGAGGATTTAGAACAATTTCTAAAAACTTACCAGGGTACCGAAGATGTCAGTGATGCAAGAT
CCGCTATTACGTCTGCACAGGAATTACTCGATTCTAAA

Результат:
https://img-fotki.yandex.ru/get/231315/158289418.437/0_17e029_26c4f047_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/235925/158289418.437/0_17e02a_a73bf2c4_XL.png
Оригинал: https://img-fotki.yandex.ru/get/235925/ … 4_orig.png

152

Re: Online service PROTEIN PICOTECHNOLOGY

https://yadi.sk/d/nWEkBJRdhpP4D
Подробнее: http://nanoworld.org.ru/topic/1150/

Заказ N96 из 100:

>tnf_alfa
GTCAGATCATCTTCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGCAAACCCTCAAGCTGAGG
GGCAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGAGATAACCA
GCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCC
TCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCCGTCTCCTACCAGACCAAGGTCAACCTCC
TCTCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCC
CATCTATCTGGGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGAC
TATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTG

Результат:
https://img-fotki.yandex.ru/get/233354/158289418.437/0_17e02b_5dc859b2_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/118982/158289418.437/0_17e02c_9caf081d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/118982/ … d_orig.png

153

Re: Online service PROTEIN PICOTECHNOLOGY

https://yadi.sk/d/nWEkBJRdhpP4D
Подробнее: http://nanoworld.org.ru/topic/1150/

Заказ N97 из 100:

>TP4A1_HUMAN
ATGGCTCGAATGAACCGCCCAGCTCCTGTGGAAGTCACATACAAGAACATGAGATTTCTTATTACACACA
ATCCAACCAATGCGACCTTAAACAAATTTATAGAGGAACTTAAGAAGTATGGAGTTACCACAATAGTAAG
AGTATGTGAAGCAACTTATGACACTACTCTTGTGGAGAAAGAAGGTATCCATGTTCTTGATTGGCCTTTT
GATGATGGTGCACCACCATCCAACCAGATTGTTGATGACTGGTTAAGTCTTGTGAAAATTAAGTTTCGTG
AAGAACCTGGTTGTTGTATTGCTGTTCATTGCGTTGCAGGCCTTGGGAGAGCTCCAGTACTTGTTGCCCT
AGCATTAATTGAAGGTGGAATGAAATACGAAGATGCAGTACAATTCATAAGACAAAAGCGGCGTGGAGCT
TTTAACAGCAAGCAACTTCTGTATTTGGAGAAGTATCGTCCTAAAATGCGGCTGCGTTTCAAAGATTCCA
ACGGTCATAGAAACAACTGT

Результат:
https://img-fotki.yandex.ru/get/361460/158289418.437/0_17e02d_29c41d0d_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/508799/158289418.437/0_17e02e_4b8644d7_XL.png
Оригинал: https://img-fotki.yandex.ru/get/508799/ … 7_orig.png

154

Re: Online service PROTEIN PICOTECHNOLOGY

https://yadi.sk/d/nWEkBJRdhpP4D
Подробнее: http://nanoworld.org.ru/topic/1150/

Заказ N98 из 100:

>DUS26_HUMAN
CATGCCGACGAGGTCTGGCCAGGCCTCTATCTCGGAGACCAGGACATGGCTAACAACCGCCGGGAGCTTC
GCCGCCTGGGCATCACGCACGTCCTCAATGCCTCACACAGCCGGTGGCGAGGCACGCCCGAGGCCTATGA
GGGGCTGGGCATCCGCTACCTGGGTGTTGAGGCCCACGACTCGCCAGCCTTTGACATGAGCATCCACTTC
CAGACGGCTGCCGACTTCATCCACCGGGCGCTGAGCCAGCCAGGAGGGAAGATCCTGGTGCATTGTGCTG
TGGGCGTGAGCCGATCCGCCACCCTGGTACTGGCCTACCTCATGCTGTACCACCACCTTACCCTCGTGGA
GGCCATCAAGAAAGTCAAAGACCACCGAGGCATCATCCCCAACCGGGGCTTCCTGAGGCAGCTCCTGGCC
CTGGACCGCAGGCTGCGG

Результат:
https://img-fotki.yandex.ru/get/372432/158289418.437/0_17e02f_6700b616_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/244154/158289418.437/0_17e030_1dfbc452_XL.png
Оригинал: https://img-fotki.yandex.ru/get/244154/ … 2_orig.png

155

Re: Online service PROTEIN PICOTECHNOLOGY

https://yadi.sk/d/nWEkBJRdhpP4D
Подробнее: http://nanoworld.org.ru/topic/1150/

Заказ N99 из 100:

>MGLL_HUMAN
ATGCCAGAGGAAAGTTCCCCCAGGCGGACCCCGCAGAGCATTCCCTACCAGGACCTCCCTCACCTGGTCA
ATGCAGACGGACAGTACCTCTTCTGCAGGTACTGGAAACCCACAGGCACACCCAAGGCCCTCATCTTTGT
GTCCCATGGAGCCGGAGAGCACAGTGGCCGCTATGAAGAGCTGGCTCGGATGCTGATGGGGCTGGACCTG
CTGGTGTTCGCCCACGACCATGTTGGCCACGGACAGAGCGAAGGGGAGAGGATGGTAGTGTCTGACTTCC
ACGTTTTCGTCAGGGATGTGTTGCAGCATGTGGATTCCATGCAGAAAGACTACCCTGGGCTTCCTGTCTT
CCTTCTGGGCCACTCCATGGGAGGCGCCATCGCCATCCTCACGGCCGCAGAGAGGCCGGGCCACTTCGCC
GGCATGGTACTCATTTCGCCTCTGGTTCTTGCCAATCCTGAATCTGCAACAACTTTCAAGGTCCTTGCTG
CGAAAGTGCTCAACCTTGTGCTGCCAAACTTGTCCCTCGGGCCCATCGACTCCAGCGTGCTCTCTCGGAA
TAAGACAGAGGTCGACATTTATAACTCAGACCCCCTGATCTGCCGGGCAGGGCTGAAGGTGTGCTTCGGC
ATCCAACTGCTGAATGCCGTCTCACGGGTGGAGCGCGCCCTCCCCAAGCTGACTGTGCCCTTCCTGCTGC
TCCAGGGCTCTGCCGATCGCCTATGTGACAGCAAAGGGGCCTACCTGCTCATGGAGTTAGCCAAGAGCCA
GGACAAGACTCTCAAGATTTATGAAGGTGCCTACCATGTTCTCCACAAGGAGCTTCCTGAAGTCACCAAC
TCCGTCTTCCATGAAATAAACATGTGGGTCTCTCAAAGGACAGCCACGGCAGGAACTGCGTCCCCACCC

Результат:
https://img-fotki.yandex.ru/get/484172/158289418.437/0_17e031_24ce9b9e_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/244154/158289418.437/0_17e032_ffda7c47_XL.png
Оригинал: https://img-fotki.yandex.ru/get/244154/ … 7_orig.png

156

Re: Online service PROTEIN PICOTECHNOLOGY

https://yadi.sk/d/nWEkBJRdhpP4D
Подробнее: http://nanoworld.org.ru/topic/1150/

Заказ N100 из 100:

>IBB1_SOYBN
GATGATGAGTCTTCAAAACCATGCTGTGATCAATGCGCATGCACAAAGTCAAACCCTCCT
CAATGCCGCTGTTCAGATATGAGACTGAATTCGTGCCATTCAGCTTGTAAATCGTGTATT
TGCGCATTATCGTATCCTGCACAGTGTTTTTGTGTTGACATAACCGATTTCTGCTATGAA
CCTTGCAAGCCCAGTGAGGATGACAAGGAAAAC
Результат:
https://img-fotki.yandex.ru/get/478477/158289418.437/0_17e033_3e5f6bf6_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/760582/158289418.437/0_17e034_fcc7b987_XL.png
Оригинал: https://img-fotki.yandex.ru/get/760582/ … 7_orig.png

157

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 88 933

Вкусная реклама книги "Пикотехнология белков"

Online service of protein structures is already functioning!

https://cloud.mail.ru/public/EMXP/r6hMgmQ8G - Полный комплект файлов (приложение 9) для книги "Пикотехнология белков" включает вторичные структуры в компактном и развернутом виде в формате png и htm. В комплект входят MIDI-файлы с музыкой сборки белков.

https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_XL.jpg

158

Re: Online service PROTEIN PICOTECHNOLOGY

как зделать ?  рекламу САЙТА

159

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 89 004

Online service of protein structures is already functioning!

Makarenko пишет:

как зделать ?  рекламу САЙТА

Кушелев: Кстати, да, кто знает, как грамотно разрекламировать онлайн-сервис белковых структур?

Менеджеры, которые смогут найти коммерческие заказы на структуры белка, получат 80% от каждого найденного заказа.

160

Re: Online service PROTEIN PICOTECHNOLOGY

Online service of protein structures

Заказ 20170901_001:

https://www.ncbi.nlm.nih.gov/nuccore/NM … port=fasta

Результат:

https://img-fotki.yandex.ru/get/249479/158289418.46a/0_18130d_6b7b80c9_XL.png