11

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 88 027

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

https://www.ncbi.nlm.nih.gov/protein/68 … E63ERZV014

https://www.ncbi.nlm.nih.gov/nuccore/684373640

>ENA|XP_009164493|1281 nucleotides
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatggatggatggatggatggatggatggatggatggatggatgg
atggatggatggatggatagatatacagccggttcaaggagaagaatatacaacacggag
tctgaattaccttttagtcagagatatggtgaactacgggcaagccatcagagtgatcat
ggtagtcgcggtaccgtcatcatgacaccgtacttcggttcgtggacagccccgtacata
tacaacttggatgaaccgtttgtggttgtcattgtggttaggatatactctggtctattg
aaggctcgtggtggtttatag

https://img-fotki.yandex.ru/get/6114/158289418.421/0_17ab07_7085614a_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/3906/15 … 0_orig.png

12

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 88 029

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

https://www.ncbi.nlm.nih.gov/nuccore/937513727

>ENA|ALI35341|1074 nucleotides
atggttgacatgaaacataaaccatcaaattactctaatcttcctttttccatatttctt
tttgttgtgttcactgttagtactttgtactttttggggtatcaacaaaacaatagtgtt
tatgcgctcaatcaacaagactataaacgatattttcattttgttagtgaacaagacaca
gaatgtacagaaaatttgcctgaagaacagacacaaatgagtgaatctgtctgtatgcag
atatgtcccactgatccaacttctgcaattccagaacagtgtgtccaacaacaaccccaa
ggagaggatcaatcatcaaaggaagagcaacaacaaccgcctctagaccaacagcaacaa
caaccgcctctagaccaacagcaacaacaaccgcctctagaccaacagcaacaacaaccg
cctctagaccaacagcaacaacaaccgcctctagaccaacagcaacaacaaccgcctcta
gaccaacagcaacaacaaccgcctctagaccaacagcaacaacaaccgcctctagaccaa
cagcaacaacaaccgcctctagaccaacagcaacaacagcaaccagagagcgattttact
agtccaaacaatgcctctaccaataaatttgttggtgtacagaattttggaccaagcagt
tcaacaaatgtgaatttttcacccgcttctgaatgttacagagatttaactggaaagtgg
ataggaaatgatggcggaaagtattacattagacaaatagataagacggtttggtggttt
ggatttaataccctttcaattggagaaggttttagcaatgtttttcatggcattaggagt
gggaatggttcaggcgaccctacgatatttggtcaatggcaagatgttcctctgggagga
accaaaggcagcggatcgtttgatattcaaatagatccaacagggactaaattaacaaaa
ttcaattcgaatggtgatttctttggtgcatcagaatggacaaagtctgatccctgttca
agaatatcttcaggtgacatcacaggtccgagtggagaagtcctaaaacactaa

https://img-fotki.yandex.ru/get/53145/158289418.421/0_17ab0b_f9e20ab_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/195431/ … 6_orig.png

https://img-fotki.yandex.ru/get/232848/158289418.421/0_17ab0c_ad4eab32_orig.png

Программная 535333532-спираль строится под музыку с размером 9/8

https://img-fotki.yandex.ru/get/6726/158289418.421/0_17ab0d_9033ca41_XL.png

https://img-fotki.yandex.ru/get/167717/158289418.421/0_17ab0e_529c87c3_XL.png

13

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 88 050

Рекорды сверхдлинных спиралей белковых молекул

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34573

Результат:

https://img-fotki.yandex.ru/get/41743/158289418.423/0_17ac04_831ca574_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/177849/ … 4_orig.png

https://img-fotki.yandex.ru/get/196070/158289418.423/0_17ac05_aab676ed_orig.png
В исследуемом белке обнаружена программная 53323-спираль рекордной длины (124-69+1=56 аминокислотных остатков), которая строится под музыку с размером 5/8

https://img-fotki.yandex.ru/get/41743/158289418.423/0_17ac07_c96cd3e6_XL.png

https://img-fotki.yandex.ru/get/98619/158289418.423/0_17ac08_8070de12_XL.png

https://img-fotki.yandex.ru/get/3705/158289418.423/0_17ac09_140a4330_XL.png

https://img-fotki.yandex.ru/get/99813/158289418.423/0_17ac0a_443c4c8_XL.png

Это - "пятиугольная спираль"

https://img-fotki.yandex.ru/get/17835/158289418.423/0_17ac06_92392ac_orig.png
Ещё обнаружена программная 52532225333-спираль, которая строится под музыку с размером 11/8

https://img-fotki.yandex.ru/get/167717/158289418.423/0_17ac0b_86d7b16c_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.423/0_17ac0c_e41b8ba6_XL.png

https://img-fotki.yandex.ru/get/196245/158289418.423/0_17ac0d_32e0a68d_XL.png

https://img-fotki.yandex.ru/get/194869/158289418.423/0_17ac0e_b16c9081_XL.png

https://img-fotki.yandex.ru/get/167717/158289418.423/0_17ac0f_ab80e0eb_XL.png

Фрактальная программная 52532225333-спираль состоит из участков простых альфа-, бета- и пи-спиралей. На вид трудно определить, что это - спираль

14

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 88 056

Рекорды сверхдлинных спиралей белковых молекул

Онлайн сервис белковых структур уже функционирует!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34611

Результат:

>ENA|ALI34611|complement 966 nucleotides
atgtattacaataaattaacttcgggtttcatatctgcaattttcttattattagttata
agttcagttaacttttcgtcaatcaaattggttaatgctgctacaggtgatctggtaaat
tataacaataactttcaaatgtatacatccccaaatgatcctaataaagactctgccatg
caaaatgctgattgtgtagtgaatttcatgacaagttatgtgtacacagcttcttcagct
gaaaattgtaacaatagtggtagtggcatgagtagtagcagtagcaatagtccatcatca
atgtctccttctacaccaagtagccaaagtcaaggtttaacgtcaactgatggtcctcaa
acaggggtgaaagatggttctggtgtaggtgtagttcgagtcgtggatacaaattctaac
actggcagctacactcctgtacaatcctcttcatttgttacaaataatagcaatcctatt
gatactaacaatatgaatgtaaatgtaaatgatgataacaatgataacgacaaagatgca
aaagacaataacaacgataatgataacaatgataacgacaaagatgcaaaagacaataac
aacgataatgataacaatgataacgacaaagatgcaaaagacaataacaacgataatgat
aacaatgataacgacaaagatgcaaaagacaataacaacgataatgataacaatgataac
gacaaagatgcaaaagacaataacaacgataatgataacaatgataacgacaaagatgca
aaagacaataacaacgataatgataacaatgataacgacaaagatgcaaaagtatacaac
gaaaacactgtgaataaacaagagcgcaaattattgcttactacctgcttcgaacgagca
tatgacaatggagattatttgtccactggtgaaattgtagattgcgccagcaactacaac
agctaa

https://img-fotki.yandex.ru/get/196245/158289418.424/0_17ac50_855b4793_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/196102/ … 5_orig.png

https://img-fotki.yandex.ru/get/54787/158289418.424/0_17ac51_6fa63a20_orig.png
В исследуемом белке обнаружена программная 5533235355333533-спираль рекордной длины (277-170+1=108 аминокислотных остатков), которая собирается под музыку с размером 16/8

https://img-fotki.yandex.ru/get/6304/158289418.424/0_17ad04_d9642ce1_XL.png
Без предварительной коррекции углов

https://img-fotki.yandex.ru/get/99813/158289418.424/0_17ad05_57ff6901_XL.png

https://img-fotki.yandex.ru/get/109878/158289418.424/0_17ad06_3bae8933_XL.png

https://img-fotki.yandex.ru/get/50388/158289418.424/0_17ad07_1006b00d_XL.png
С предварительной коррекцией углов

https://img-fotki.yandex.ru/get/99813/158289418.424/0_17ad08_4f914574_XL.png

https://img-fotki.yandex.ru/get/174352/158289418.424/0_17ad09_4c05284b_XL.png

https://img-fotki.yandex.ru/get/196600/158289418.424/0_17ad0a_e83ab8ef_XL.png

https://img-fotki.yandex.ru/get/196142/158289418.424/0_17ad0b_d78de34e_XL.png

https://img-fotki.yandex.ru/get/109878/158289418.424/0_17ad0c_7efdee04_XL.png

https://img-fotki.yandex.ru/get/174352/158289418.424/0_17ad0d_d729d460_XL.png

https://img-fotki.yandex.ru/get/145691/158289418.424/0_17ad0e_4f755abe_XL.png

15

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 88 068

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures is already functioning!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34671

Результат:

>ENA|ALI34671|complement 714 nucleotides
atgacacttccaaaaggttacgtaaaacccaataaagaagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaa
ctagaagcagaacaaaaggccaaactagaagcagaacaaaaggccaaactagaagcagaa
caaaaggccattccacaaaattcacaaaatgattccttgattacaaataacttgaattca
aacaggctcgatggaaaacaaggaaatgtcgataaaactttggaaaataatttcaactat
tttctgatatgggaacaattacaagaggcataccttcataccatgaaagaagcaacttca
tcttatttcaggttattagatttttggttacagcaaaagaaccaagaagaataa

https://img-fotki.yandex.ru/get/196070/158289418.424/0_17ad11_965f0968_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/3603/15 … 6_orig.png

https://img-fotki.yandex.ru/get/3103/158289418.424/0_17ad12_8b2fb14d_orig.png
В исследуемом белке обнаружена программная 55323233-спираль рекордной длины, которая строится под музыку с размером 4/8

https://img-fotki.yandex.ru/get/174352/158289418.424/0_17ad13_100536f6_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.424/0_17ad14_fa386024_XL.png

https://img-fotki.yandex.ru/get/170749/158289418.424/0_17ad15_63cd4463_XL.png

16

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 88 085

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures is already functioning!

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

ALI34726

Результат:

>ENA|ALI34726|complement 735 nucleotides
atgttaaccattacgactattataggaaacataaagaaagatccacaattacatcaaaaa
tatgaagagtctgttaaaaaagataccgtcgagaacgtagtaattcagagatctgaaacc
gagaaggttagaatgagaaaagtttcagacaaagaaactgatatcggatttattttgcct
tctagaacccatcttaaagacggtgatgtagtttttcttgatgatactaaaatgatagtg
ataaaattatctcctgagcttgtggctatcttgaatattaaaaatcatttacacaataat
catgaacatgaggaccatgaccatgaacacaagcatgaacatgaggaccatgaccatgaa
cacaagcatgaacatgaggaccatgaccatgaacacaagcatgaacatgaggaccatgac
catgaacacaagcatgaacatgaggaccatgaccatgaacacaagcatgaacatgaggac
catgaccatgaacacaagcatgaccaagctaacgattatgaactcactaatgtggcacta
aaggtaggacatactattggaaacttacataggccactaaaaatcgaaaatcgtgatata
atttttcctattcaaagtccagatgaaataaacctatttttgagattgttgtcagatcta
aaagactatatagaaattcgttcagagcaactcatttttgaacctgatcagggatttgac
attcatgcacactga

https://img-fotki.yandex.ru/get/196102/158289418.424/0_17ad21_9a6213cf_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/104083/ … f_orig.png

https://img-fotki.yandex.ru/get/3312/158289418.424/0_17ad22_4f333972_orig.png
В исследуемом белке обнаружена программная 55353355333-спираль, которая собирается под музыку с размером 11/8

https://img-fotki.yandex.ru/get/198026/158289418.424/0_17ad2c_919fa45a_XL.png

https://img-fotki.yandex.ru/get/4000/158289418.424/0_17ad2d_55b3ec8e_XL.png

https://img-fotki.yandex.ru/get/104083/158289418.424/0_17ad2e_e0834b_XL.png

https://img-fotki.yandex.ru/get/5901/158289418.424/0_17ad2f_b5358f5a_XL.png

https://img-fotki.yandex.ru/get/196060/158289418.424/0_17ad30_9cab453d_XL.png
Проекция спирали имеет ось симметрии 11-го порядка. Интересное совпадение с музыкальным размером (11/8)

17

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообение 88 610

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures is already functioning!

Полный комплект файлов:

99 файлов: https://cloud.mail.ru/public/BCAE/9Y2WosHvL
57 файлов: https://cloud.mail.ru/public/CoMT/WUUhhkFSq
102 файла: https://cloud.mail.ru/public/7fLa/qDsMgc7jw

Заказ

100 из 102

https://img-fotki.yandex.ru/get/24/158289418.431/0_17cbe3_4905dccc_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/372432/ … 5_orig.png

В исследуемом белке обнаружена программная 5552-спираль длиной 749(!) аминокислотных остатков, которая строится под музыку с размером 4/8 = 1/2

18

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 89 992

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ 20170904_009:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

Ficedula albicollis basic proline-rich protein-like (LOC107604153), partial mRNA

Результат:

https://img-fotki.yandex.ru/get/202385/158289418.46e/0_181483_ec5f7954_XL.png

Прямой участок альфа-спирали содержит 440 аминокислотных остатков Pro. Рекорд сверхдлинных спиралей по количеству одинаковых аминокислотных остатков.

Развернуто:

https://img-fotki.yandex.ru/get/249479/158289418.46e/0_181482_12bff00d_XL.png
Оригинал: https://img-fotki.yandex.ru/get/249479/ … d_orig.png

19

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 89 995

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ 20170904_011:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

Ficedula albicollis basic proline-rich protein-like (LOC107604154), partial mRNA

Результат:

https://img-fotki.yandex.ru/get/467315/158289418.46e/0_181488_504c5b35_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/249078/158289418.46e/0_181487_ccd4cb83_XL.png
Оригинал: https://img-fotki.yandex.ru/get/249078/ … 3_orig.png

Новый рекорд! 503 аминокислотных остатка Pro образуют прямой участок альфа-спирали!

20

Re: Рекорды сверхдлинных спиралей белковых молекул

Формы, механизмы, энергия наномира. Сообщение 89 997

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ 20170904_013:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

Volvox carteri f. nagariensis hypothetical protein, mRNA

https://img-fotki.yandex.ru/get/470815/158289418.46e/0_18148b_b7347be2_XL.png

Фрагмент структуры:

https://img-fotki.yandex.ru/get/9091/158289418.46e/0_18148d_899f77ab_XL.png

Развернуто (фрагмент):

https://img-fotki.yandex.ru/get/236988/158289418.46e/0_18148c_9ef4814f_XL.png
Оригинал (фрагмент): https://img-fotki.yandex.ru/get/236988/ … f_orig.png

https://img-fotki.yandex.ru/get/249782/158289418.46e/0_18148e_996f5d80_orig.png
Рекордный (44 аминокислотных остатка Pro) Участок 23-спирали

https://img-fotki.yandex.ru/get/206909/158289418.46e/0_18148f_6eece227_orig.png
Рекордный ( 20 аминокислотных остатков Pro) Участок 255-спирали