Original: https://img-fotki.yandex.ru/get/5700/na … 6_orig.png

Input data: tgtgctaaacgcgttgttagagacccacaaggtatcagagcttgggttgcttggagaaatcgatgt
Details: http://onlinelibrary.wiley.com/doi/10.1 … 4857.x/pdf
PDB-file: https://yadi.sk/d/DwyG9EZg_JnbGQ
Input data: tgtcatttatcctgcagtgctttgctgcaagataacatcgctgatgctgtagcttgt
Input data: tgtcacttgtcttgt
Input data: tgcaacatcccgtgctcagccctgctgagctcagacataacagcgagcgtgaactgc
Input data: atggaagctaggagccgggctcccagaagacagctgtgcccgcct
Input data: atgaggtctttgctaatcttggtgctttgcttcctgcccctggctgctctggggaaagtctttggacgatgt

1. Cys 95 - Cys 113 Human lysozime-1
2. Cys 96 - Cys 117 Human lysozime-2
3. Cys 78 - Cys 82  Human lysozime-3
4.  Cys 94 - Cys 98 Gallus lysozime-1
5.  Met 1 - Cys 13  Mouse lysozime
6.  Met 1 - Cys 24  Gallus lysozime-2

The probability of a random closure of 6 disulfide bridges is 10 ^ -84, i.e. the randomness of the correct operation of the program Piotech is excluded.

Virus model (fragment)

Virus shell model

Virus shell model. Single electrons shown.

Full data: https://yadi.sk/i/K9jwT9lakQ0zAA

Same protein, tertiary structure.

Also. Another view

Protein-DNA interaction mechanics


In 2018, Deep Mind won the CASP competition, using not the amino acid sequence, but the nucleotide sequence to find homologues: https://deepmind.com/blog/alphafold/

We have moved on. In 1992, we managed to discover 3D genetic code, which allows us to determine the structure of a protein without homology with 100% reliability. As well as the usual genetic code allows you to determine the primary structure of the protein.

Our results in the competition CASP

The organizers of the CASP did not pay attention to our result, since X-ray diffraction analysis is considered the benchmark, but it cannot distinguish pi-helix from alpha-helix and programmed collagen helix of  triple helix. Therefore, our results were too accurate for the CASP to be correct. They did not want to send us a nucleotide sequence, since it was believed that enough amino acid sequence. Deep Mind turned out to be the bridge that allows you to go from homology on amino acid sequence to homology on nucleotide sequence. Indeed, the basis of homology is X-ray diffraction analysis, so Deep Mind did not notice its errors, and the conflict with X-ray diffraction analysis did not work out. But now you need to go further. From homology to the direct use of a 3D genetic code.

You have a chance to become the first users of the newest high technology based on the 3D genetic code scientific discovery.


Профессиональный Online service: http://picotechnology.ru

X-ray diffraction analysis does not help determine the structure of these proteins, even for a trillion dollars

Формы, механизмы, энергия наномира. Сообщение 88 042

Пикотехнология белков, ДНК, РНК - 3


Human Genome Protein Structure

You can get the structure of any protein here and now.
The first 100 orders for the account of Nanoworld Laboratory.
For example, in this form:



Закажите структуру белка сейчас! Первые 1000 заказов за счёт лаборатории Наномир.

Для заказа достаточно опубликовать в этой теме ссылку на кодирующую нуклеотидную последовательность интересующего Вас белка. Например, в таком виде:



или так:

https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

Можно просто задать саму последовательность:


Результат, т.е. вторичная структура белка будет опубликована в этой же теме в таком виде:


Развёрнуто: https://img-fotki.yandex.ru/get/117896/ … 6_orig.png

Если интерес заказчика возрастёт, и он захочет увидеть третичную структуру, то буду пробовать определить и её, хотя 3D-версия Пикотех пока до конца не настроена. Тем не менее, для большого класса белков она показывает адекватные модели.

Сервис постоянно совершенствуется, поэтому результаты будут улучшаться.

"Нет предела совершенству" smile

http://img-fotki.yandex.ru/get/5506/126580004.42/0_b37ab_6493b0b7_S.gif http://img-fotki.yandex.ru/get/9116/158289418.af/0_ae267_2d0606e3_orig.gif

Цены по старой технологии: http://nanoworld.org.ru/topic/1702/

For our overseas friends.

Что такое программа "Пикотехнология белков", и как её грамотно использовать

2D and 3D protein structures up to the picometer
The Picotech program can not completely replace  X-ray structural analysis. However, it greatly strengthens the weakest points of the X-ray diffraction, namely, it shows reliably the secondary structure and the short-range order of the arrangement of the atoms of the tertiary structure at the time of assembly of the protein molecule by the ribosome.
The sensitivity of X-ray structural analysis is such that it does not notice not only individual atoms, but also individual amino acid residues. Moreover, the "tails" of protein molecules that do not crystallize, the PCA generally "does not see", and these "tails" can consist of up to 50 amino acid residues.
A special class is formed by 97% of protein molecules that do not crystallize. About them, the PCA simply does not know anything, and the Picotech program also reliably shows their secondary structure and short-range order of the arrangement of atoms in the tertiary structure.
Your application must contain only the code of the protein of interest to you from the PDB database, or mRNA for it
We will model your protein complex with ligands of any nature
The lead time for the order is 1-7 days, depending on the complexity of the project.
Digest https://picosoft.nethouse.ru/
Online service PROTEIN PICOTECHNOLOGY  http://nanoworld.org.ru/topic/1699/

Human Genome Protein Structure

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8


Jon: Good day, Mr Kushelev.

We are interested in your structure of protein online service and would theoretically like to pay for the work. But first, a couple of questions.

1. How much does the service cost?
2. Do you have examples of proteins that you have analyzed? Can we see the results?


1. Free (today)
2. Yes!

Example N1: http://nanoworld.org.ru/topic/1698/

https://img-fotki.yandex.ru/get/195990/ … 3_orig.gif

Example N2: http://nanoworld.org.ru/post/109797/#p109797

https://img-fotki.yandex.ru/get/107080/ … d_orig.gif


Jon: Mr Kushelev,

This is very interesting. Which form will the clients receive the results in? I assume not just a picture. I would need it in some numerical form so that I can use it in my models.

Kushelev: Secondary structure and PDB file.


DNE file: https://yadi.sk/d/hTZpqPhd_l78XQ

https://getfile.dokpub.com/yandex/get/h … wgyC-6zzOA
Full secondary structure: https://yadi.sk/i/K9jwT9lakQ0zAA

PDB file: https://yadi.sk/d/rFWdCW65J-5ODQ


https://getfile.dokpub.com/yandex/get/h … Te2qx0hyPw
Details: http://nanoworld.org.ru/topic/1699/page/89/


Jon: Okay, this works.

So, do you have a list of already analyzed proteins? Do you offer a database?

We do have a list of the ones we need to get analyzed.

Kushelev: There is no list. There are examples: http://nanoworld.org.ru/topic/1887/

Russian original: Кушелев: Списка нет. Есть примеры: http://nanoworld.org.ru/topic/1887/

Jon: Let's start with this one. I am pasting several more in a moment.


Here are several more sequences of proteins.


Kushelev: Sorry, but it is not NUCLEOTID sequences...

Program Picotech work with NUCLEOTID only.

For Example:

>AYPS01005575.1 Helicosporidium sp. ATCC 50920 contig-5575, whole genome shotgun sequence


Jon: And, finally, these:

https://www.ncbi.nlm.nih.gov/nuccore/U3 … rt=genpept

Kushelev: It is good.

Order 2018-11-16_011:


1. https://yadi.sk/d/F_DbocRcuqzjsg
2. https://yadi.sk/d/F3OrUEqfdJ-zLQ
Error input data

3. https://yadi.sk/d/TCV5sof4tCdJqA
4. https://yadi.sk/d/vDAE6Q77HqgCnw
5. https://yadi.sk/d/6j90J5rzT1klhg
6. https://yadi.sk/d/9XH6TN4YDsm-ng
Error input data

7. https://yadi.sk/d/_EGsHDGOMCUM5w
Error input data

8. https://yadi.sk/d/Q6brIsEsZk3QeQ

Secondary structure:

https://getfile.dokpub.com/yandex/get/h … cLbftLJNzQ

https://getfile.dokpub.com/yandex/get/h … dmDApeM3zw
Error input data

https://getfile.dokpub.com/yandex/get/h … M8h8WYrbOA

https://getfile.dokpub.com/yandex/get/h … TgV5r_bPjg

https://getfile.dokpub.com/yandex/get/h … 8NcGhn8Rug

https://getfile.dokpub.com/yandex/get/h … Awfw7HfSIQ

https://getfile.dokpub.com/yandex/get/h … fDIF2hQahA
Error input data

https://getfile.dokpub.com/yandex/get/h … zQETnbv8oA
Error input data

https://getfile.dokpub.com/yandex/get/h … Na6_CKlJTg


Jon: I understand, you work only with nucleotides. Do look at the latter example then.

Kushelev: Secondary structure:

https://getfile.dokpub.com/yandex/get/h … yxrJpt3mHQ

Red - Alpha-helix
Blue - Pi-helix
Orange - 310-helix
Green - beta-helix/sheet

DNE-file: https://yadi.sk/d/DHn2Qyyvqjnctg

PDB-file: https://yadi.sk/d/Gt6mYy0_MghmIg (automatically)

https://getfile.dokpub.com/yandex/get/h … YRpQXQubTw


Jon: Very interesting.

Kushelev: Kushelev: Need manual adjustment of chain turns on Pro and Met

Kushelev: Secondary structure:

https://getfile.dokpub.com/yandex/get/h … yxrJpt3mHQ

Full secondary structure:

https://getfile.dokpub.com/yandex/get/h … eNDPlMmU7A

Looking for 17 Pro adjustments and 2 Met adjustments

Jon: And what are the notes and musical instruments?

Kushelev: Build music, transposed from hypersonic range

Details on English: http://nanoworld.org.ru/topic/1603/

I can not do a manual correction quickly. We need to finish the interactive version of the program or make a plastic model:

https://getfile.dokpub.com/yandex/get/h … Ob0HAqtQQg
Details: http://nanoworld.org.ru/topic/2007/page/8/

https://getfile.dokpub.com/yandex/get/h … M8h8WYrbOA

Looking for 6 Pro adjustments and 0 Met adjustments

DNE-file: https://yadi.sk/d/euAf7OK6aEg_qw

PDB-file: https://yadi.sk/d/4ft_fstFg4vboA

https://getfile.dokpub.com/yandex/get/h … hMhNhLPsew

Jon: Dear Mr. Kushelev,

Me and my colleagues are seriously impressed by your work, your efficient methodology and your incredible work ethic.

We have looked at the results - the fasta files, pdb and dne. The accuracy of your method is unparalleled in the modern world, as well as the speed with which you are able to come up with the structures. Again, we are highly impressed.

We would also like to know which software you are using for visualization. We are using tools which are capable of producing similar visualizations, but are still curious as to the exact programs you are using.

We would like to ask your permission to use the calculations you have made in our soon-to-be published work. We will credit your organization. Just help us to understand which organization is it, or should we instead credit you personally, as you seem to be the inventor of this method.

In the pdb file you write:

Kushelev: The strong correlation dependence of spatial structure
of the protein from its nucleotide sequence was
theoretically predicted by physical modelling,
experimentally  discovered and statistically confirmed.

Jon: n order for us to be able to present the results of your analysis in our paper, we would need references to experiments confirming the veracity of the method, as well as statistical calculations. Please, provide those as soon as possible.

Finally, we would like to ask you to look at this sequence and see if you are able to provide results for it as well:


Mr Kushelev, if this is going to work out, we might be looking at a very serious commercial partnership here. This is exactly what we need.

Kushelev:  Currently there are two programs:
1. Picotechnology 2D
2. Picotechnology 3D
The current version of the Picotech 2D was written by Valentin Yakim according to my algorithm.
Denis Savin wrote the current version of Piotech 3D according to my algorithm and corrected Valentin Yakim.
The Picotech 2D program determines the secondary structure of a protein. This is the result of her work:

https://getfile.dokpub.com/yandex/get/h … M8h8WYrbOA

Программа Пикотех 3D написана в виде скрипта в среде 3DS Max. Это - результат её работы:

Autotranslation to English: The Piotech 3D program is written as a script in the 3DS Max environment. This is the result of her work:

https://getfile.dokpub.com/yandex/get/h … Te2qx0hyPw

Picotech 3D maintains the structure in the PDB standard: https://yadi.sk/d/4ft_fstFg4vboA

Viewing a PDB file is possible in a standard browser, for example, Swiss Viewer or HyperChem.

To create an accurate 3D model of a protein molecule, we need to create a new version of Picotech 3D interactive. Without the program, this can be done manually from the elements of a plastic constructor, for example, printed on a 3D printer:

https://getfile.dokpub.com/yandex/get/h … Ob0HAqtQQg

This is a long time. Therefore, it is better to write a program.

>We would like to ask your permission to use the calculations you have made in our soon-to-be published work. We will credit your organization. Just help us to understand which organization is it, or should we instead credit you personally, as you seem to be the inventor of this method.

Kushelev: I will give you contact with the manager. He will solve these questions. As for the publication, it is possible to publish, but my verification of the correctness of the data is desirable.

Jon: In order for us to be able to present the results of your analysis in our paper, we would need references to experiments confirming the veracity of the method, as well as statistical calculations. Please, provide those as soon as possible.

Kushelev: The first simple calculation was published in 2003. I give you a link to a more complete text that has been prepared for publication since 1993:
Russian original with images: http://www.nanoworld.org.ru/data/01/dat … 000509.htm
Translation to English: http://www.nanoworld.org.ru/data/01/dat … 950224.htm

In the 2015th year, the book "Picotechnology of Proteins" was published in Russian: http://nanoworld.org.ru/topic/1150/

https://img-fotki.yandex.ru/get/103691/ … b31_XL.jpg

In paper form, it can be purchased at publishers by number: ISBN 978-3-659-92862-8

In the electronic version you can purchase a book from the authors, from me or Victoria Sokolik. An electronic version of the book is more suitable for translation into English. You will probably be interested in translating and publishing this book in English.

As for model experiments, only their results are published in the form of a table of a composite genetic code:

http://img-fotki.yandex.ru/get/5502/nan … f_orig.gif

Details: http://nanoworld88.narod.ru/data/212.htm

Report:  http://nanoworld88.narod.ru/data/302.htm

Jon: Finally, we would like to ask you to look at this sequence and see if you are able to provide results for it as well:


Kushelev: Let's see ...

     misc_RNA        1..271
                     /product="internal transcribed spacer 1"
     rRNA            272..434
                     /product="5.8S ribosomal RNA"
     misc_RNA        435..617
                     /product="internal transcribed spacer 2"

Kushelev: What is it? Coding sequence or primary structure of RNA

        1 tcgatacctg tccaaaacag aacgacccga gaacgattga tcatcactct cggcgggccg
       61 gtttcttagc cgattctgtg cccgccgatt ccgtggtttt gcgagtggtt ccatcaagat
      121 ttttaatcct gattgggcta tgagcttagc tttcggaaat tcacaaaacc ccggcacgaa
      181 aagtgtcaag gaacatgcaa ctaaacagcc tgcttccgcc gccccggaaa cggtgagtgt
      241 gcgggatgct gtgctgcgat ctaaagtcta aaacgactct cggcaacgga tatctcggct
      301 ctcgcatcga tgaagaacgt agcgaaatgc gatacttggt gtgaattgca gaatcccgtg
      361 aaccatcgag tctttgaacg caagttgcgc cctaagcctt ctggccgagg gcacgtctgc
      421 ctgggtgtca caaatcgtcg tccccaatcc tctaaggata gaggacggaa actggtctcc
      481 cgtgtgttac cgtacgcggt tggccaaaat ccgagctaag gacgtctgga gcgtctcgac
      541 atgcggtggt gaattcaagc ctcttgatat tgttgaacgc tcctgtccga agctttagat
      601 gacccaaaga cctcaac
Kushelev: If this sequence is considered as CDS, then the structure of the protein can be obtained. It is necessary?


Let's start with reading in the forward direction.


https://getfile.dokpub.com/yandex/get/h … eqbC_LZnfg
Input data eror

Shift the reading frame by 1 position:


https://getfile.dokpub.com/yandex/get/h … 0jh2l56i2w
Input data eror

Shift the reading frame by an additional 1 position:


https://getfile.dokpub.com/yandex/get/h … TOOE0nbqZQ
Input data eror

Take a complementary sequence with a reverse:


https://getfile.dokpub.com/yandex/get/h … 9ghe6bC7pw
Input data eror

Shift the reading frame by 1 position:


https://getfile.dokpub.com/yandex/get/h … j3t7GfQQfQ
Input data eror

Shift the reading frame by an additional 1 position:


https://getfile.dokpub.com/yandex/get/h … oN89Lo0HSg
Input data eror

Conclusion: None of the 6 options for reading this nucleotide sequence is a protein molecule code.

However, fragments of this sequence may correspond to the code of protein molecules. Let's look at these fragments ...

rRNA            272..434
                                                               aacgactct cggcaacgga tatctcggct
      301 ctcgcatcga tgaagaacgt agcgaaatgc gatacttggt gtgaattgca gaatcccgtg
      361 aaccatcgag tctttgaacg caagttgcgc cctaagcctt ctggccgagg gcacgtctgc
      421 ctgggtgtca caaa

Variants of reading the code (fasta):

1. https://yadi.sk/d/OQPr7nxy7RGFiA
2. https://yadi.sk/d/vIko-4964HXHDw
3. https://yadi.sk/d/jnZNfq9jvt1Ndw
4. https://yadi.sk/d/fhNaNDnUq2v-DQ
5. https://yadi.sk/d/-k9w4w-5Xb7OnA
6. https://yadi.sk/d/O9O1J_ayM_nKjQ

Secondary structure:

https://getfile.dokpub.com/yandex/get/h … t_pCP-5B4Q

https://getfile.dokpub.com/yandex/get/h … qrhKhRBDuQ

https://getfile.dokpub.com/yandex/get/h … tccQXtcLNg

https://getfile.dokpub.com/yandex/get/h … Ell5Hvjnig

https://getfile.dokpub.com/yandex/get/h … dgLgQNC-ow

https://getfile.dokpub.com/yandex/get/h … PIS8OhyLsA

Conclusion: Two ways of reading (4, 6) correspond to the structure of the protein molecule.



https://getfile.dokpub.com/yandex/get/h … Ell5Hvjnig

Full secondary structure: https://yadi.sk/i/lwMbhUSh6w6AzQ

DNE-file: https://yadi.sk/d/1W7WDu7w9k8ZuQ

https://getfile.dokpub.com/yandex/get/h … WYKAwF5fSw

https://getfile.dokpub.com/yandex/get/h … ft3oPwZ7kA

https://getfile.dokpub.com/yandex/get/h … 2ZdFWj4U7Q



https://getfile.dokpub.com/yandex/get/h … PIS8OhyLsA

Full secondary structure: https://yadi.sk/i/mic8YsF9K5PqDQ

DNE-file: https://yadi.sk/d/k055aYr315N8JA

https://getfile.dokpub.com/yandex/get/h … 4zWuKyU65g

https://getfile.dokpub.com/yandex/get/h … 6UN480wi9Q

https://getfile.dokpub.com/yandex/get/h … e_FCsKTVIA

For option 4, you need a manual correction of the 3D model for 2 Pro, for option 6 - one correction.

Jon: Prodigious job, Mr Kushelev!

I have a couple of questions here.

1. Give us your manager's contacts please

2. Which journals has the article you linked to been published in?

Kushelev: http://nanoworld.org.ru/post/110594/#p110594]Online service PROTEIN PICOTECHNOLOGY

Jon: Which journals has the article you linked to been published in?

Kushelev: Picotechnology was not the main scientific direction of the Nanoworld laboratory, so there are two key publications. First was prepared for the journal Biochemistry, but was published here:

http://nanoworld88.narod.ru/data/195_fi … 9c4_XL.jpg
Details: http://nanoworld88.narod.ru/data/195.htm


https://img-fotki.yandex.ru/get/103691/ … b31_XL.jpg
Details: http://nanoworld.org.ru/topic/1150/

There are a number of scientific publications in collaboration:


Key points are know-how

For example, the model experiment "translation mechanism"

http://nanoworld88.narod.ru/data/272_fi … 94c2_L.jpg
Details: http://nanoworld88.narod.ru/data/272.htm

Part of the know-how we can publish in a joint article with You.

Jon: We also came up with these several questions:

1. Will you theoretically be able to produce protein structures for 10,000 protein sequences? We can send you the file.
2. You say that for now the service is free. When will it become paid?
3. What did you have in mind in terms of a commercial offering? What is your business model?

Kushelev: 1. Yes. Preferably in GBK format. For example: https://yadi.sk/d/JHCejNbusyMvcQ
2. When I need helpers to complete orders
3. This question can be solved in the process of discussion with investors and managers.

Jon: Mr Kushelev,

Do not worry about the plant RNA. The response you gave us satisfied us.

1. Very well. We will see what we can do.
2. Will you need assistants to fulfill an order for 10,000 sequences?

3. We understand that. If you already have an understanding of at least some details, we would be very grateful to be exposed to any documentation or ideas you have.

Please understand that in order for us to understand whether this is an opportunity we can leverage depends on the business model available.

The way we see it, there are three main directions this can go:
a. We license your technology and use it ourselves
b. We can hire your lab to fulfill our orders, based on a contract
c. We buy your technology wholesale, with full ownership rights

The first option seems to be the most realistic, since it minimizes logistics and allows us to have a straightforward financial relationship. The license does not have to be one-time, instead it can be subscription based, we will be paying you a substantial sum of money, say, every year. Obviously, each time we install your technology in yet another lab, this will mean a purchase of one more license from you. Authors of similar technologies end up earning very solid income based on licenses alone.

We would probably organize business trips for you to various countries around the world, so that you can train our people to use the technology correctly. You will be paid separately for each workshop. As our network is vast, that might mean an additional income source for you as the author of the technology, since these business trips might bring you thousands of dollars every year.

The second option is not unheard of, but scientific institutions in Europe and in South America prefer to not have too many 3rd party contractors. Thus, this will limit your opportunities. Still, I can readily guarantee a contract for Norway subsidiaries, probably Ireland and France. We might also have Poland labs ready to work with contractors.

The third option depends on you. Buying ownership of your technology would mean excluding you from using it, but not from claiming authorship. Authorship cannot be bought and you will remain the author, you can publish, etc. You just won't be able to do what you are doing now - providing the service itself. Our companies would be the only ones doing it.

In return you get a one-time fee. Of course, the fee is typically large. Last time I was part of such a purchase, the inventor ended up making several millions of dollars. But the exact sum depends on several things, such as:
- the estimated market
-the efficiency of the technology
-how it compares to alternatives
-whether it is scalable

Our experts are looking at your papers, results and images as we speak, and so far everyone is highly impressed. I can tell you that the evaluation of your know-how is going up every minute. If we make the deal, you are probably going to be a very wealthy man. But I am in no position to make business decisions of this sort, so take my opinion with a grain of salt.

Still, none of us have seen an alternative solution that would come even close to what you are doing. The deterministic nature of your results is revolutionary.

Kushelev: Kushelev: To answer this question I need to see the file. GBK is desirable. Send the GBK file. Let's see what happens in automatic mode.

It makes sense to start with option b. It's easier for me to carry out orders than other options. In the future, any options are possible.

Jon: Let us wait for your manager then.

Kushelev: K!




Формы, механизмы, энергия наномира. Сообщение 88 044

Пикотехнология белков, ДНК, РНК - 3

Онлайн сервис белковых структур уже функционирует!

Ну что же, пока заказчики не в курсе, продолжим тестировать онлайн-сервис.



>ENA|ALI34243|complement 270 nucleotides



Развёрнуто: https://img-fotki.yandex.ru/get/3014/15 … 4_orig.png




Формы, механизмы, энергия наномира. Сообщение 88 045

Онлайн сервис белковых структур уже функционирует!



>ENA|ALI34281|complement 1116 nucleotides



Развёрнуто: https://img-fotki.yandex.ru/get/201221/ … 2_orig.png

В исследуемом белке обнаружена программная спираль:

Программная 53235352-спираль строится под музыку с размером 8/8




Онлайн сервис белковых структур уже функционирует!



>ENA|ALI34296|complement 447 nucleotides



Развёрнуто: https://img-fotki.yandex.ru/get/9809/15 … 2_orig.png

В исследуемом белке обнаружен один виток альфа-спирали NNKL и один виток пи-спирали SQSQSS




Формы, механизмы, энергия наномира. Сообщение 88 047

Онлайн сервис белковых структур уже функционирует!



>ENA|ALI34365|complement 1830 nucleotides



Развёрнуто: https://img-fotki.yandex.ru/get/97884/1 … 0_orig.png

В исследуемом белке обнаружен переход программной 335-спирали, характерной для коллагена первого типа в программную 553-спираль, которые строятся под музыку с размером 3/8 (в темпе вальса, точнее в темпе коллагена). Далее программная спираль переходит в бета-спираль длиной 4 аминокислотных остатка.



Формы, механизмы, энергия наномира. Сообщение 88 048

Онлайн сервис белковых структур уже функционирует!





>ENA|ALI34379|complement 1002 nucleotides


Развёрнуто: https://img-fotki.yandex.ru/get/177849/ … 1_orig.png

В исследуемом белке обнаружена программная 53333-спираль



Формы, механизмы, энергия наномира. Сообщение 88 050

Рекорды сверхдлинных спиралей белковых молекул

Онлайн сервис белковых структур уже функционирует!






Развёрнуто: https://img-fotki.yandex.ru/get/177849/ … 4_orig.png

В исследуемом белке обнаружена программная 53323-спираль рекордной длины (124-69+1=56 аминокислотных остатков), которая строится под музыку с размером 5/8





Это - "пятиугольная спираль"

Ещё обнаружена программная 52532225333-спираль, которая строится под музыку с размером 11/8






Фрактальная программная 52532225333-спираль состоит из участков простых альфа-, бета- и пи-спиралей. На вид трудно определить, что это - спираль



Формы, механизмы, энергия наномира. Сообщение 88 056

Рекорды сверхдлинных спиралей белковых молекул

Онлайн сервис белковых структур уже функционирует!





>ENA|ALI34611|complement 966 nucleotides


Развёрнуто: https://img-fotki.yandex.ru/get/196102/ … 5_orig.png

В исследуемом белке обнаружена программная 5533235355333533-спираль рекордной длины (277-170+1=108 аминокислотных остатков), которая собирается под музыку с размером 16/8

Без предварительной коррекции углов



С предварительной коррекцией углов










Формы, механизмы, энергия наномира. Сообщение 88 068

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures is already functioning!





>ENA|ALI34671|complement 714 nucleotides


Развёрнуто: https://img-fotki.yandex.ru/get/3603/15 … 6_orig.png

В исследуемом белке обнаружена программная 55323233-спираль рекордной длины, которая строится под музыку с размером 4/8






Формы, механизмы, энергия наномира. Сообщение 88 083

Online service of protein structures is already functioning!





>ENA|ALI34696|complement 765 nucleotides


Развёрнуто: https://img-fotki.yandex.ru/get/170815/ … 0_orig.png

В исследуемом белке удалось обнаружить программную 5333-спираль.

Нам она уже встречалась:




Модель с предварительной коррекцией композиционных углов.