321

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 88 042

Пикотехнология белков, ДНК, РНК - 3

Онлайн сервис белковых структур уже функционирует!

Полностью в автоматическом режиме определить структуру белка по кодирующей нуклеотидной последовательности можно будет позже, но заказывать структуры белка в онлайн-режиме можно уже сейчас!

Для заказа достаточно опубликовать в этой теме ссылку на кодирующую нуклеотидную последовательность интересующего Вас белка. Например, в таком виде:

Заказ.

https://www.ncbi.nlm.nih.gov/nuccore/749158428

или так:

https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

Можно просто задать саму последовательность:

atgcccggaatgatggccattaactcagggactggtggacccatgtctggtggtcccatg
tctggtggtcccatgtccggtggccccatgtccggtggtcccatgtccggtggccccatg
tccggtagtcccatgcctggtggtcccatgtccggtggtcccatgtccggtggtcccatg
cctggtggtcccatgtctggtggacccatgccgtacaaccaacaaggaatgatgggccca
ggaatgttcatgaatcccgcccaggtaccgccaggggtcatgcatccaggagcgatgcat
ggaatgccgccgggcatgatgcagatggccgggatgtcatctcagggcgggccgttgggt
ccaatgagcataggctccggcggccacctcggaggcatgggccagccgggcggaggaggc
tccaatacaatgggcatgatgcaagccatggggcaaggtccgggatcgaaccacggacct
atggctaaccgcatgcccccaggccagatgccgggaccgggccaaatgccccctggaccg
ggtcaaatgccccctggaccaggtcaaatgccacctggaccgggtcaaatgcctcctggg
cccagtcctggccagctgcctcctggatccggtgcaggacagcagcagtcgtcgggcggc
caacagcccacttcaggccagcccaatggttcgcagcaggggggaacggcgagtccttct
ggaatggtgacgccgaacatgaacggagggaaccccactccgcccgctcaggacggtcag
cgatttcctttctcagtggaggcacggcggttcgcagtggagtcctttacaggtactggt
cggtgcaactttaacaaggccgcgctcaaaaagggatcggaatgcttcttcatggatcga
cgagtacgcaaactatgtccggttttaacgcacgctccggttgaacgcacactgatgaat
accctacacaaataa

Результат, т.е. вторичная структура белка будет опубликована в этой же теме в таком виде:

https://img-fotki.yandex.ru/get/218038/158289418.408/0_1789ea_a6723a52_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/117896/ … 6_orig.png

Если интерес заказчика возрастёт, и он захочет увидеть третичную структуру, то буду пробовать определить и её, хотя 3D-версия Пикотех пока до конца не настроена. Тем не менее, для большого класса белков она показывает адекватные модели.

Сервис постоянно совершенствуется, поэтому результаты будут улучшаться.

"Нет предела совершенству" smile

http://img-fotki.yandex.ru/get/5506/126580004.42/0_b37ab_6493b0b7_S.gif http://img-fotki.yandex.ru/get/9116/158289418.af/0_ae267_2d0606e3_orig.gif

322

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 88 044

Пикотехнология белков, ДНК, РНК - 3

Онлайн сервис белковых структур уже функционирует!

Ну что же, пока заказчики не в курсе, продолжим тестировать онлайн-сервис.

Заказ:

https://www.ncbi.nlm.nih.gov/nuccore/937513727#

>ENA|ALI34243|complement 270 nucleotides
atgccaactctgatgccaaagattcgtgtcaccgtcctttattttgccttcatacatgaa
ataactagaaaaaaggaggaaataatggagttgtccacaaatacttcaataaaggaacta
atattaattatactaacccggtatccaaacataaaaaacataaagaacataaaaatttct
gtcaattaccgcattgtcaattcgaactcaaacttaattctaaaaaatgctgacgaagta
gcccttctaccaccgatttctggaggatag

Результат:

https://img-fotki.yandex.ru/get/177902/158289418.422/0_17abd4_bc2ddfcd_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/3014/15 … 4_orig.png

323

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 88 074

Средняя цена определения одной структуры белка ~10 000 USD

diprospan пишет:

ссылок то нет на такие купли и продажи.
значит - миф.

Кушелев: А зачем Вам ссылки? Изучите прайс на определение структуры белка в лаборатории РСА, "и будет Вам счастье" smile

А следить за числом структур в PDB можно на сайте PDB. Там ежедневно появляется около 50 новых структур, за которых кто-то заплатил в среднем 10 000 евро.

Кстати, материал с ценами белковых структур недавно проходил на форуме лаборатории Наномир. Вы, вероятно, не следите за темой...

http://www.reitingi.lv/ru/news/sabiedribap/15235.htm

Лаборантка уничтожила белковые кристаллы стоимостью полмиллиона долларов

https://img-fotki.yandex.ru/get/3214/158289418.424/0_17ad16_4f161f18_orig.jpg

Бывшая сотрудница Национальной ускорительной лаборатории SLAC из-за депрессии уничтожила белковые кристаллы стоимостью полмиллиона долларов. О преступлении, которое может сильно затормозить приоритетный научный проект, пишет газета San Jose Mercury News. Злоумышленница была арестована.
Сильвия Оомахен (Silvya Oommachen), работавшая лаборанткой, прошла мимо охраны в помещение, где при низких температурах хранились белковые кристаллы. Она достала из морозильной камеры 42 плашки, в каждой из которых хранилось по 96 образцов белков, и оставила их на столе при комнатной температуре. Пребывание в тепле в течение длительного времени привело к разрушению кристаллов.

Оомахен оставила в комнате три записки. На одной она написала один из своих сетевых псевдонимов, на другой - ругательство, а на третьей - дату, когда она вынула белки из холодильника. По словам самой Оомахен, она сделала это, чтобы сбить с толку полицию.

Причиной поступка лаборантки стали неурядицы в личной жизни и на работе. По словам коллег, у Оомахен были очень плохие отношения с ее начальником. В июне женщина перестала ходить на работу, после чего ее уволили. Полицейские полагают, что Оомахен разрушила образцы, "чтобы немного исправить свою плохую карму".

На восстановление кристаллов у сотрудников лаборатории уйдет несколько недель. Выращивание белковых кристаллов - весьма трудоемкий процесс, требующий тщательного подбора условий. Уничтоженные образцы были получены в рамках проекта Protein Structure Initiative, цель которого - найти менее трудоемкие и более эффективные способы выращивания белковых кристаллов. Кристаллы необходимы ученым для того, чтобы определять трехмерную структуру белков.

Преступление Оомахен вызвало дискуссии о требованиях безопасности в научных учреждениях. Их чрезмерное ужесточение мешает нормальной работе. Однако произошедший случай показал, как легко один человек может причинить огромный ущерб научному проекту.

***
Кушелев: 42 плашки, в каждой из которых хранилось по 96 образцов. Это стоит 500 000 долл. Вот и считайте, сколько стоит один образец.

Для определения структуры белка выращивают плашку (96 образцов). Одна плашка стоит  500 000 / 46 = 10 869 USD

324

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 88 114

Пикотехнология белков, ДНК, РНК - 3

Полный комплект файлов:

99 файлов: https://cloud.mail.ru/public/BCAE/9Y2WosHvL
57 файлов: https://cloud.mail.ru/public/CoMT/WUUhhkFSq
102 файла: https://cloud.mail.ru/public/7fLa/qDsMgc7jw

Продолжение темы: Онлайн сервис белковых структур уже функционирует!

325

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 89 862

Пикотехнология белков, ДНК, РНК - 3

Skype:

[29.08.2017 10:51:27] Кушелев Александр Юрьевич: Благодарю! Нужно объяснить им, что технология определения структуры белковой молекулы базируется на научном открытии композиционного генетического кода. И дать ссылку на книгу:

https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_XL.jpg
Подробнее: http://nanoworld.org.ru/topic/1150/
[29.08.2017 10:52:02] Кушелев Александр Юрьевич: А можете дать адрес форума, где Вам ответили?
[29.08.2017 10:52:36] А: Будет сделано !!
[29.08.2017 10:54:53] А: я размещаю рекламу в разных местах где могут быть биологи big_smile
[29.08.2017 10:58:39] Кушелев Александр Юрьевич: ЗдОрово! Вам по почте написали первый ответ?
[29.08.2017 10:59:31] А: да
[29.08.2017 11:00:25] А: ожидаю ещё ответов ! big_smile
[29.08.2017 11:01:14] Кушелев Александр Юрьевич: ЗдОрово!
[29.08.2017 11:11:05] А: вот как я ответил " Я прочел что технология определение структуры белковой молекулы базируется на научном открытии композиционного генетического кода"
[29.08.2017 11:12:32] Кушелев Александр Юрьевич: Отлично!
[29.08.2017 11:13:47] А: судя по его аккаунту и по его многочисленым ответам на вопросы по биологии он биолог !
[29.08.2017 11:32:52] Кушелев Александр Юрьевич: Здорово!
[29.08.2017 12:03:23] А: Вот ответ "Что за зверь такой "композиционный генетический код"? Просто генетичексий код знаю и перевеcти его в аминокислотную последовательность нет никаких проблем. Даже школьник такие задачки на небольших последовательностях решают. А тут... Композиционный! Загуглил все выводит на посты этого Кушелева и его НАНОМИР. Похоже никто больше это открытие открытием не считает... Очень похоже на псевдонауку и очковтирательство. Или умственное помешательство, но картинки в 3Д он все же как-то мастерит."
[29.08.2017 18:42:09] Кушелев Александр Юрьевич: Вы предложите ему изучить книгу "Пикотехнология белков" (Виктория Соколик, Александр Кушелев):

https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_XL.jpg
[29.08.2017 18:42:37] Кушелев Александр Юрьевич: Попросите прокомментировать рецензии профессоров: http://nanoworld.org.ru/topic/1150/
[29.08.2017 18:43:14] Кушелев Александр Юрьевич: Спросите, считает ли он умственно помешанными этих профессоров?
[29.08.2017 18:43:51] А: Хорошо
[29.08.2017 19:31:25] А: вот общался с одним биологом  его зовут Александр Панчин вот в общем наш диалог "Здравствуйте Александр тут один онлайн сервис утверждает у них есть  новый вид анализа белка который намного быстрей и самое главное дешевле так вот вопрос это реально ?
[29.08.2017 19:34:12] А: Александр : наверноеб не знаю
Я: Вот посмотрите http://nanoworld.org.ru/topic/1699/
Александр : точно не так
[29.08.2017 19:48:23] А: он про цену говорил Александр : "точно не 10 тыс евро
если речь идет про блот какой-нибудь"
[8:44:52] А: Ответ Биолога с mail .ru:
"На первый взгляд рецензии выглядят нормально, но я не глубокий специалист в моделировании. Люди с такими именами и степенями, судя по данным в интернете, существуют и трудятся в научных институтах Украины и выпускают научные статьи в рецензируемых научных журналах (в отличиие от самого Кушелева). И первый автор Виктория Соколик тоже вроде реальный биолог, а вот второй автор Кушелев вообще непонять кто, это человек который как раз пиарит некую программу Picotex, предлагая всем свои модели, называя методы в честь себя любимого (что считается крайне не этичным в научном мире). Собственно о его душевном равновесии и вопрос. Ведь именно этот Кушелев судя по всему создатель данного форума и периодически заливает своими постами стены других, да так рьяно, что любой спамер позавидует. "
[9:32:19] Кушелев Александр Юрьевич: Напишите ему, что переход на личности - дурной тон. Есть пикотехнология, которую создал Кушелев и развивает Виктория Соколик. Есть рецензии профессоров. Если по существу и с аргументами возразить нечего, благодарю за высказанное мнение. Новая технология безусловно будет внедряться, а негативные, но безосновательные мнения только ускорят этот процесс smile

326

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 90 074

Пикотехнология белков, ДНК, РНК - 3

Программная изомерия белковых структур

https://img-fotki.yandex.ru/get/229553/158289418.471/0_181716_3412fc48_XL.png

Подробнее: https://subscribe.ru/archive/science.ne … 64146.html

327

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 90 110

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

Online service of protein structures

Заказ: 20170908_007:

https://www.ncbi.nlm.nih.gov/nuccore/11 … mask=65536

OLQ12821.1

>OLQ12821.1
atgtgcgatccagtgtacacgttgggcgtcgtgggtattctggacagcgagtatcttcca
gcatctatctacacggggaagtggtggtggttgttggtggtggtggtggtgctgctgctg
ctgctgctgctgctgctggtgctggtggtggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtggtggtggtggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctggtgctg
gtgctggtgctggtgctggtgctggtgctggtgctggtggggtgcgaagcgcactggcag
ttgatcggacaccttttacaccgcaacatgcaaaagtga

Результат:

https://img-fotki.yandex.ru/get/368408/158289418.472/0_1819be_e42c2fa6_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/245409/158289418.472/0_1819c8_7ebc8f8e_orig.gif

Обнаружена рекордной длины (4014-33+1=3982) 310-спираль Кушелева, образованная аминокислотной последовательностью (VL)*n

328

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 90 124

Пикотехнология белков, ДНК, РНК - 3

Online service of protein structures

Что такое программа "Пикотехнология белков", и как её грамотно использовать?

Программа Пикотех не может полностью заменить РСА. Однако она очень усиливает самые слабые стороны РСА, а именно достоверно показывает вторичную структуру и ближний порядок расположения атомов третичной структуры в момент сборки белковой молекулы рибосомой.

Чувствительность РСА такова, что он не замечает не только отдельных атомов, но и отдельных аминокислотных остатков. Более того, "хвосты" белковых молекул, которые не кристаллизуются, РСА вообще "не видит", а эти "хвосты" могут насчитывать до 50 аминокислотных остатков.

Особый класс образуют 97% белковых молекул, которые не кристаллизуются. Про них РСА просто ничего не знает, а программа Пикотех так же достоверно показывает их вторичную структуру и ближний порядок расположения атомов в третичной структуре.

Online servise "Protein picotech": http://nanoworld.org.ru/topic/1699/

329

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 90 172

Пикотехнология белков, ДНК, РНК - 3

Рекорды сверхдлинных спиралей белковых молекул

Открываем экзотические структуры белков

Online service PROTEIN PICOTECHNOLOGY

Заказ: 20170909_044:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>ENA|XM_019084387.1 PREDICTED: Cyprinus carpio glutamic acid-rich protein-like (LOC109067455), partial mRNA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG
AAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAGAAGAAGAAGAAGAAGAAGAAGAAGAAG

Результат:

https://img-fotki.yandex.ru/get/361460/158289418.475/0_181ada_dd84714_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/361493/158289418.475/0_181adb_bb28e3c8_orig.png

333 аминокислотных остатка глутаминовой кислоты Glu образуют прямую пи-спираль!

330

Re: Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Заказ: 20170909_045:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>ENA|XM_019293038.1 PREDICTED: Corvus cornix cornix glutamic acid-rich protein-like (LOC109146232), partial mRNA
GAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGG
AGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGA
GGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAA
GAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGG
AAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGA
GGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAG
GAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAG
AGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGA
AGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAG
GAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGG
AGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGA
GGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAA
GAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGG
AAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGA
GGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAG
GAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAG
AGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAGGAAGAGGAAGG
CTGA

Результат:

https://img-fotki.yandex.ru/get/516998/158289418.475/0_181adc_d870f2ac_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/509531/158289418.475/0_181add_4363a8e2_XL.png
Оригинал: https://img-fotki.yandex.ru/get/509531/ … 2_orig.png

Полиглутаминовая кислота Glu образует программную 355-спираль длиной 395 аминокислотных остатков