251

Re: Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/74 … URUTCAW014

https://www.ncbi.nlm.nih.gov/nuccore/749158428

>ENA|XP_011130843|975 nucleotides
atgcccggaatgatggccattaactcagggactggtggacccatgtctggtggtcccatg
tctggtggtcccatgtccggtggccccatgtccggtggtcccatgtccggtggccccatg
tccggtagtcccatgcctggtggtcccatgtccggtggtcccatgtccggtggtcccatg
cctggtggtcccatgtctggtggacccatgccgtacaaccaacaaggaatgatgggccca
ggaatgttcatgaatcccgcccaggtaccgccaggggtcatgcatccaggagcgatgcat
ggaatgccgccgggcatgatgcagatggccgggatgtcatctcagggcgggccgttgggt
ccaatgagcataggctccggcggccacctcggaggcatgggccagccgggcggaggaggc
tccaatacaatgggcatgatgcaagccatggggcaaggtccgggatcgaaccacggacct
atggctaaccgcatgcccccaggccagatgccgggaccgggccaaatgccccctggaccg
ggtcaaatgccccctggaccaggtcaaatgccacctggaccgggtcaaatgcctcctggg
cccagtcctggccagctgcctcctggatccggtgcaggacagcagcagtcgtcgggcggc
caacagcccacttcaggccagcccaatggttcgcagcaggggggaacggcgagtccttct
ggaatggtgacgccgaacatgaacggagggaaccccactccgcccgctcaggacggtcag
cgatttcctttctcagtggaggcacggcggttcgcagtggagtcctttacaggtactggt
cggtgcaactttaacaaggccgcgctcaaaaagggatcggaatgcttcttcatggatcga
cgagtacgcaaactatgtccggttttaacgcacgctccggttgaacgcacactgatgaat
accctacacaaataa

252

Re: Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … URUTCAW014

https://www.ncbi.nlm.nih.gov/nuccore/1020961614

>ENA|XP_016161693|621 nucleotides
atgtccagggccaccttcagcctcatgtttgccctctcagggctcactcctgtcatggag
ctgagatgggggttcaccaacatgagagcaggttcgctgcccacctggcgctcagcagag
gcgctccggcaggggggtgatgctgcggctgggatctctcctgccgggaataccctgcac
ggccccccggagcggagctgccccgggcatccctgcatccctgccccgggcatccctgcc
ccgggtatccctgccccgggcatcctttccccgggcatcccttccccgggtatccctgcc
ccgggtatccctgccccgggtatcccttccccgggtatccctgccccgggtatcccttcc
ccgggtatccctgccccgggcatcccttccccgggtatccctgccctgggtatccctgcc
ccgggtaccctagctccgggtatccctgccccgggtatccctgccccgggtatcccttcc
ccgggtatccctgccccgggtatccctgccccgggcatcctttccccgggcatcccttcc
ccgggtatccctgccccgggtatccctgccccggaactctatacctctcctcctcttggt
aaaaccgggaagtatgactga

253

Re: Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/74 … URUTCAW014

https://www.ncbi.nlm.nih.gov/nuccore/748390038

>ENA|KIH61623|1602 nucleotides
atgtcgaagtgccctggaaatgaggcgcttctgcagttttccatgcgccttctcgtgctc
gtcgctctcgtcggcacctcggaagccttcctcttcaacctgctaggcctaggaggcggc
ggaggatcatcttgcggaggaggatgcggatgcagcggaggatcatcatgcggagcagtt
gcagcggcagcaccaacctactcggcaccagcttcagcaggatacgcagtcgctccacct
cctccatctggaggatacgcagtcgcccccggcggtggtggtggtggatatgcaccaccg
ccacccccacctctaccatcatactctcctccgctaagttcgccacctgttggatcttat
ggcggcccctctggtggtagctacgctggagctgcaggaggcggtggttacggtggacct
gctggaggcggtggttatggaggaccaactggaggaagctacgctgcacccggtggcggt
ggattcggaggaccacaatcagcgccagcaactggaggatttggtggacccgccggagga
tcatacgcagctggacccgctccaggaggaccagctccaggaggctcctatgcaggagct
ggacccgttccaggtggacctgccccaggtggtccgtacggaggaggcggacccgcacca
ggtggattcggaggagctggaccagctaacgacggcccagcctcaagctacggaggaccg
gccccaggaggacctgcaccaggaggctcatacgcaggagctggacccgccccaggtgga
cctgccccaggtggctcatatgcaggcgctggacccgccccaggagggcccgctccgggt
ggctcctacggaggacctgcgccaggaggacccgccccaggtggctcatatgcaggggct
ggaccggccccaggtggatatggaggacctgggagcttcggaggacccgcccaaggagga
cctgccccaggtggctcatatgcaggagctggacctgcgccaggaggacccgcccctggt
ggctcatatggaggccctgcgccaggaggacccgccccaggtggatcatacgtgggaact
ggacccgctccaggtggattcggaggacctggaccagctagcgatgccggaagctttgga
ggccccgccccaggcggacctgcacctggaggtccatacgtacaagccggccccgctcca
ggaggatttggcggatctggtccagccccaggctacggagggcctgccccaggaggacct
gcaccaggtgggagctggacccgcggacccgcaccaggaggacctgcaccaggtggttca
tatgcaggagctggacccgccccaggtggatacggaggacctggaccatctaacgatgcc
ggaagctttggaggccctgccccaggaggacctgcgccaggtggctcatacgcaggagcc
ggtcccgctccaggtggacctgctccaggaggacccgctccaggtggtgcttacgccggc
ggacctcagggtggtcccgccaacgacgtctctgtatcgactggtggtgccggtggagcc
tacgtcaatccccaaaggaaacataagcgacattacccatga

254

Re: Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/68 … URUTCAW014

https://www.ncbi.nlm.nih.gov/nuccore/682387203

>ENA|KFY68880|3939 nucleotides
atgcaggcgcctgacatgacggcgaatgacggcgctgtgtcgctagatgatggattagac
aacggccctgggaagctatttgctgagagccggaacgaggagggcgtggttaagtatacc
atgttctccggcaaaccgttaaggtggagagacgatattctgccgccagaaacctatcag
gagactctgcgcgacaaagcccttcaagctcaggaaggatatgttttccatgcacaagct
ctgcggatactgggaatcagagtcttccgcactggagactatcacattgtgacaacacta
cgaggaaatcgcgatgtggttaaatttcaaaccaaggagttccttccagggggacagaag
tggacgggccctcgcgacattagccatctcgcctttctgtctgtggaggatggggagctc
ccggtttatcatttttggctcgatccgactatctttgagaagaagccggagcagatgaca
ctcgcagaaacgatcgatgcagaagctagcaagcccacggctgaagaagaagccaagcaa
agtgaagacgggcttaaaactcgtctaatgcccaatataactccttcagatcaagtatgg
attgataagctagccgagtttcaaaaacttctcgccaataatgaaccagacgaccgtaag
cggacacttatggaccttatgaaggagacttttcttgaagatcaaatccggcgattggca
gcctcgggagagcattctcagctttcaatgttgcaagggagagaccaactgctgtatttt
gataacctcgacaacggcgcgttcaagggagttaaaaacaacgccgctacgaaattttgc
atggtttacttcggccttcctgttgagcctctgaccttgaccaatattcttaacgcgaga
aggaaccgagatgatgcccgggacaaagtcgagcccgattacagcatactacctagaata
tacggcgaaaaggccgatttggagttcttggatagctaccacgagagagcctatggatat
ccggcgctacggaaaccaaaggctaaaaggccctacaaggccattccagaagaggtctct
gacctaatccgggagcagcaacggattgagcaagaggtatatcctcagccaaatatgata
tgtggggggaattatgatgctttatacggcagggacagctatgaatttgcgtttcaaaaa
actggaaatggccctccctccacgttcgagaatgtcctaactcttcgtggcggcgctggg
ccatcccaaattccggacgataccgatgatgatgacgatgtgatggaagatgttactatg
ggtgatgagggcctgtctgagggctctgacggaaatggcggggagaccgtctctagtctc
gccccatactcaggagacgtaaatggtttgccatcaagtcaccagcatacttcttggatc
gatggcttctgtggaggacttcgaggtggggcttcgtcgcccagaagcaatgaaaggggc
ggtgaagaacagaccggggctttcccccaaccatcaaatgccaacaacggctctggcgca
aacacagacaacccccccgcgtcggtacctgtgccacttccaccacttcaatctatggaa
tccgttcttgcttctttacagcaagatcctcggcagtcgtccacgtatcgtcgtcgaacg
gcacctgctactaataagaacatattcgaccctagcctatatcgggaatatatggtttca
acagcgaagaatctagaacaagatgaccttcgcgtgtccgcataccacaaagcgcagtct
gtccacgaaccccacgcggcaaagccggaaccaccgagatatggcaagtcagttgagaat
cagctagtcacggggcccacaatgccaggtgtatttacaaacagttcaactctctctgaa
attcgacaattgcaagcacgcaatggagaattggaaaggttgttattgggccgtggcaca
tactgcggtatgtgtgacaagaacatatccttcaccagcaatgaacagcaagacgcccat
tttgcaggccatgtggacggactgcattcctgtgggttttgtggaattagcttcaatgcg
tttactcaatcagagagaaaagctcatcttgctagccatgcagatactagatttacaaag
caagcctcgaatacgccccggcaacctgcaaacacagctgggccttccagactaacaccc
atcaattccagcccaaggcaagtcacgcaaactactgtcgtggagggcgataccatactg
tactgccagaactgcagtgtggacttggcccatttcaccactcctgcccaacttattcaa
cacgcacgcagctgttctgggaggagtcgtccgccaagcgagccggcctactgtaaattc
tgcggcattgagattgttaggctaggcagcgcggatgacattacgaaccaccgcaatttg
tgcaaaggctcagccgccggccaagaccgacaacgagggctttgggctgtagcaggaatt
agtaccagcgatgatcgggagttgacgtactggaagctctgtgccctgactggagtccct
gatcttcattacaaaccccgcaacccagctccaagatcgtacgagtgtcgctactctggc
tgcgatgctgacttgctccaagttgcaaaggatggaactctagaggctcaccacaagaag
cacacttccaacggcgacagactcaagaacatatgccaggcagatggctgcggggaggat
cttgccgagtgtgagaaacgcgggaaagagcggctccagcgacatctaacgagacatatt
aagaacgaatgcacgttcccgggctgcgataccatcttccaagacgaagatatttcacca
agcacacgtgaaattgaacttgaagctaagaaaaagtggattgatcacgcccatagccat
ctaggcgttgacgaggacgagttgattcatgatttcccagacagtgaccctccaagtggt
gacgatgataacgacgaccatggtggtggacgcaatggaactagcggtcacacccatcga
ggaaatggtggaaacacaggtaataaccccgctgcacccccagccccaaaaggtcctgcc
ccgaaaggtcctgctccgcaaggtccaaccccgcaaggcccagcccccaaaggcccggct
ccaaaaggcccggccccaaaaggtccggccccgaaaggtccagcccctaaagccccagcc
gaaccgccaacgtattttatgtccctccctaaggagtggattgaagccataaaaagactc
cccgaaaggttctatgtaggatcgaggcagaaacagaagatggcatttatctgcccagtc
tgttatttatccatacaaggacttcaactttcctggcaccgtagcgtctgccccgatggc
acaaagggttgtggagtggacaatgataacaaccttctcatcttcagcgctatgagcgct
ggccgcgtccgcagccccaagacgagctacgaccaagctgacatgaaagatgagggtgct
gggagttggggggttgctcgacaacttccgcaagtggcgcagtacatcgctagaaatccg
ccactggcggaaatggcgcctctcccacttgcgcacgctgctttggttaagccgaccgaa
gcagagctgaagacgggaatggtggtaaggaggcaacaagcaaattcgcatgatacagtt
gttgaaaagaaaaggaagagggcacaaaagaaggggccaaagcgtgcggctacgactgca
gcgcctggggagccgcccgctaaggtggcaaaggaggtagaaggtagcagcactaagact
ttacccaaggaaactcagactgtggcgccaacgacaccggtagtgcctcatgcggagaaa
ggaggcggcggcgggttgtttgtaacaccagatacttga

255

Re: Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/86 … UZ52Y02014

https://www.ncbi.nlm.nih.gov/nuccore/861613553

>ENA|KMQ85698|complement 525 nucleotides
atgttgtggggttacattattttgaagaatcttggtggtagcggcgcgtatcccggcgcc
ccgtatcccggcgccccgtatcccggcgccccgtatcccggcgccccgtatcccggcgcc
ccgtatcccggcgccccgtatcccggcgccccgtatcccggcgccccgtatcccggcgcc
ccgtatcccggcgccccgtatcccggcgccccgtatcccggcgccccgtatcccggcgcc
ccgtatcccggcgccccgtatcccggcgccccgtatctcggcgccccgtatcccggcgcc
ccgtatcccggtgccccataccccggtgcagatgccggtaatacatatattggtgctgtt
ggcgttacgtatgtcggcggtgctaatggtgttggcattatgtacgtcgacggagccaac
gctgctggcgttacgtacgccgatgatgcgtacgaaaaacgactggcatatctcctccgc
cgctccttatttaccgcccgccgtactgcttcgttgacacgctaa

256

Re: Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/26 … UZ52Y02014

https://www.ncbi.nlm.nih.gov/nuccore/268534713

>ENA|XP_002632490|543 nucleotides
atgttccaggagttgactccagctccagagctccagctccagagctccagctccagagct
ccagctccagagcttcagctccagagctccagctccagagctccagctccagagctccag
ctccagagctccagctccagagctccagctccagagctccagctccagagctccagctcc
agagctccagctccagagctccagctccagagctccagctccagagctccagctccagag
ctccagttccagaactccggctccagaactccggctccagaactccggctccagagctcc
ggcttcagagctccggcttcagagctccggctccagagctacagctccagagctcctggc
tctggagctcctggctctggagctcctggctctggagctcctggctctggagctcctggc
tctggagctcctggctctggagctcctggctctggagctccagctccagagctcccctcc
cctctctggaggctagagaaaaggagaactgattcttccctccacttccctcttctttta
tag

257

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 87 889

Пикотехнология белков, ДНК, РНК - 3

Первые партии (99 и 57 последовательностей) обработаны новой версией программы Пикотех2017-2D:

Полный комплект 99 файлов: https://cloud.mail.ru/public/BCAE/9Y2WosHvL
Полный комплект 57 файлов: https://cloud.mail.ru/public/CoMT/WUUhhkFSq

001

https://img-fotki.yandex.ru/get/25921/158289418.417/0_17a3de_c77a2039_orig.png

https://img-fotki.yandex.ru/get/107473/158289418.417/0_17a3df_27dabcb5_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/107080/ … 0_orig.png

002

https://img-fotki.yandex.ru/get/95493/158289418.417/0_17a3e4_9f4bc4c6_orig.png

Развёрнуто:

https://img-fotki.yandex.ru/get/108697/158289418.417/0_17a3e3_38281f96_orig.png

003

https://img-fotki.yandex.ru/get/197756/158289418.417/0_17a3e6_5d111dc7_orig.png

Развёрнуто:

https://img-fotki.yandex.ru/get/177902/158289418.417/0_17a3e5_b2d755b7_orig.png

004

https://img-fotki.yandex.ru/get/372432/158289418.417/0_17a3e8_7281460b_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/372432/ … 0_orig.png

Фрагменты белка, которые строятся в музыкальном размере:

https://img-fotki.yandex.ru/get/25921/158289418.417/0_17a3e9_56cc6e31_orig.png

9/4

https://img-fotki.yandex.ru/get/224193/158289418.417/0_17a3ea_e0f35d1d_orig.png

2/4

https://img-fotki.yandex.ru/get/242441/158289418.417/0_17a3f4_f942e69f_orig.png

4/4

005

https://img-fotki.yandex.ru/get/242441/158289418.417/0_17a3f6_97e0f844_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/198860/ … 5_orig.png

Как выглядит участок 2333-спирали при разных вариациях композиционных углов 2 и 3:

https://img-fotki.yandex.ru/get/214545/158289418.417/0_17a3fd_3f22111b_XL.png

https://img-fotki.yandex.ru/get/177849/158289418.417/0_17a3fe_1ae8029f_XL.png

https://img-fotki.yandex.ru/get/196600/158289418.417/0_17a3ff_a6138e2a_XL.png

https://img-fotki.yandex.ru/get/221708/158289418.417/0_17a400_36e21c1d_XL.png

https://img-fotki.yandex.ru/get/244154/158289418.417/0_17a401_de2382d1_XL.png

https://img-fotki.yandex.ru/get/197807/158289418.417/0_17a402_f3a3be44_XL.png

Другой фрагмент этого белка строится под музыку с размером:

https://img-fotki.yandex.ru/get/98645/158289418.417/0_17a403_822744d2_orig.png

7/4+4/4=11/4

006

https://img-fotki.yandex.ru/get/53145/158289418.417/0_17a405_6f956bb3_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/17893/1 … 4_orig.png

Музыкальный размер 4/4

007

https://img-fotki.yandex.ru/get/216915/158289418.417/0_17a407_711dc578_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/230197/ … b_orig.png

008

https://img-fotki.yandex.ru/get/196534/158289418.417/0_17a409_79b7e778_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/233044/ … 8_orig.png

009

https://img-fotki.yandex.ru/get/4118/158289418.417/0_17a40a_871af908_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/226827/ … 4_orig.png

010

https://img-fotki.yandex.ru/get/176508/158289418.418/0_17a40d_95335e45_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/102548/ … 1_orig.png
Интересный ритм. Барабан пропадает, но потом снова появляется в нужном месте. Музыкальный размер 4/4 сохраняется.

258

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 87 894

Пикотехнология белков, ДНК, РНК - 3

Полный комплект 99 файлов: https://cloud.mail.ru/public/BCAE/9Y2WosHvL
Полный комплект 57 файлов: https://cloud.mail.ru/public/CoMT/WUUhhkFSq

011 (из 99)

https://img-fotki.yandex.ru/get/16100/158289418.418/0_17a412_32039363_orig.png

Развернуто: https://img-fotki.yandex.ru/get/225650/ … 8_orig.png

012

https://img-fotki.yandex.ru/get/246987/158289418.418/0_17a414_e2d2b9b8_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/216915/ … 6_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/100269/158289418.418/0_17a415_b241563b_orig.png

Программная спираль 3555 строится под "мерцающий ритм" в размере 8/4

https://img-fotki.yandex.ru/get/152444/158289418.418/0_17a416_f7ebe24a_orig.png

Программная спираль 53332332 строится в размере 4/4

https://img-fotki.yandex.ru/get/214545/158289418.418/0_17a417_1652f627_XL.png

https://img-fotki.yandex.ru/get/42692/158289418.418/0_17a418_84d7529c_XL.png
Программные спирали очень чувствительны к изменениям композиционных и транспозиционных углов.

https://img-fotki.yandex.ru/get/4211/158289418.418/0_17a419_cb345b41_XL.png

https://img-fotki.yandex.ru/get/95629/158289418.418/0_17a41a_aa05a9f2_XL.png
А если учесть, что в состав программных спиралей входит Pro (у него есть композиционный (жесткий), транспозиционный (средней жёсткости) и пролиновый (мягкий) квазиортогональные углы, причём часто многократно в одном цикле программной спирали,

https://img-fotki.yandex.ru/get/214545/158289418.418/0_17a41b_1702f3b8_XL.png

https://img-fotki.yandex.ru/get/197807/158289418.418/0_17a41c_aa57faf5_XL.png
нетрудно понять, что без учёта физико-химических взаимодействий определить параметры программной спирали затруднительно.

https://img-fotki.yandex.ru/get/6435/158289418.418/0_17a41d_a41cf23e_XL.png

https://img-fotki.yandex.ru/get/216168/158289418.418/0_17a41e_5d276770_XL.png
Тем не менее интуиция может помочь в интерактивном режиме

https://img-fotki.yandex.ru/get/103213/158289418.418/0_17a41f_77ae296c_XL.png

https://img-fotki.yandex.ru/get/169883/158289418.418/0_17a420_4f607539_XL.png
скорректировать геометрическую заготовку. Ведь радикалы аминокислот могут подсказать...

013

https://img-fotki.yandex.ru/get/50388/158289418.418/0_17a423_2f621648_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/118528/ … 6_orig.png

014

https://img-fotki.yandex.ru/get/214545/158289418.418/0_17a425_e78736b0_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/214545/ … 0_orig.png

015

https://img-fotki.yandex.ru/get/165720/158289418.418/0_17a427_ebb0a870_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/42692/1 … 4_orig.png

016

https://img-fotki.yandex.ru/get/54522/158289418.418/0_17a429_d53e13e6_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/198026/ … a_orig.png

017

https://img-fotki.yandex.ru/get/174352/158289418.418/0_17a42b_ccac2980_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/56406/1 … 1_orig.png

Музыку сборки этого белка стоит послушать. Первая часть звучит со звуками барабана в размере 4/4. Вторая часть звучит без барабана, но в том же размере. Интересно посмотреть и на форму первой и второй половины белковой молекулы...

https://img-fotki.yandex.ru/get/251308/158289418.418/0_17a42c_e7cb17bd_XL.png
Белки такого типа нужно смотреть в интерактивной версии Пикотех 3D, а лучше с учётом физико-химических взаимодействий.

018

https://img-fotki.yandex.ru/get/246155/158289418.418/0_17a42e_36163e29_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/9327/15 … a_orig.png
Музыка сборки имеет чёткий ритм в размере 4/4

019

https://img-fotki.yandex.ru/get/148218/158289418.418/0_17a430_13b7fc31_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/4128/15 … 0_orig.png

020

https://img-fotki.yandex.ru/get/198998/158289418.418/0_17a432_39844a0_orig.png

Развернуто:  https://img-fotki.yandex.ru/get/99813/1 … 0_orig.png

259

Re: Пикотехнология белков, ДНК, РНК - 3

Формы, механизмы, энергия наномира. Сообщение 87 895

Пикотехнология белков, ДНК, РНК - 3

021

https://img-fotki.yandex.ru/get/55431/158289418.418/0_17a434_9f6000da_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/170815/ … c_orig.png

022

https://img-fotki.yandex.ru/get/198488/158289418.418/0_17a435_6ed12706_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/177902/ … 3_orig.png

https://img-fotki.yandex.ru/get/217607/158289418.418/0_17a437_ec9bb545_orig.png
Интересно посмотреть, что за программная 2533352-спираль строится под музыку с размером 7/4 ?

https://img-fotki.yandex.ru/get/195990/158289418.418/0_17a439_6cefbf7_XL.png
Ось симметрии 11-го порядка...

https://img-fotki.yandex.ru/get/54787/158289418.418/0_17a43a_896ed417_XL.png
После укладки за счёт изменения углов пролина симметрия может измениться.

023

https://img-fotki.yandex.ru/get/93500/158289418.418/0_17a43c_cceca49d_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/195431/ … b_orig.png

Дважды встречается  программная 5523-спираль.

https://img-fotki.yandex.ru/get/94893/158289418.418/0_17a44d_f28fb008_XL.png
Это - напряжённая структура. Чтобы правильно её построить, нужно учитывать изменение трёх углов (композиционного, транспозиционного и пролинового).

024

https://img-fotki.yandex.ru/get/6715/158289418.419/0_17a610_158c21f7_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/216915/ … 1_orig.png

https://img-fotki.yandex.ru/get/59023/158289418.419/0_17a611_1322ce46_orig.png
Интересная программная 2255533-спираль. Интересно увидеть её 3D-модель...

https://img-fotki.yandex.ru/get/194835/158289418.419/0_17a612_5c9532e8_XL.png

https://img-fotki.yandex.ru/get/195771/158289418.419/0_17a614_e98fae98_XL.png

https://img-fotki.yandex.ru/get/46310/158289418.419/0_17a615_956c7de9_XL.png

https://img-fotki.yandex.ru/get/197923/158289418.419/0_17a613_e3d0f7c7_XL.png
Ось симметрии 12-го порядка...

https://img-fotki.yandex.ru/get/198026/158289418.419/0_17a616_a687b82d_XL.png
Строится эта спираль под музыку с размером 7/4

025

https://img-fotki.yandex.ru/get/52461/158289418.419/0_17a618_c6dc185_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/52656/1 … c_orig.png

026

https://img-fotki.yandex.ru/get/9739/158289418.419/0_17a61a_aa33d28b_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/55231/1 … 4_orig.png

027

https://img-fotki.yandex.ru/get/236239/158289418.419/0_17a61c_b9bc136d_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/169608/ … 7_orig.png

https://img-fotki.yandex.ru/get/169608/158289418.419/0_17a61d_66a05e58_orig.png
Программная 532333232333-спираль. Интересно посмотреть 3D модель и послушать музыку3 сборки...

https://img-fotki.yandex.ru/get/467152/158289418.419/0_17a624_9b5d9d41_XL.png
Вариант углов до коррекции.

https://img-fotki.yandex.ru/get/235015/158289418.419/0_17a626_a81691b2_XL.png
Очевидно, что структура напряжённая.

https://img-fotki.yandex.ru/get/172272/158289418.419/0_17a625_4a6b0fa9_XL.png

https://img-fotki.yandex.ru/get/235015/158289418.419/0_17a627_7958fbe4_XL.png
Вариант углов с коррекцией "bp".

https://img-fotki.yandex.ru/get/195431/158289418.419/0_17a629_770e6e52_XL.png
Очевидно, что структура напряжённая.

https://img-fotki.yandex.ru/get/195431/158289418.419/0_17a628_e2b2ebde_XL.png

https://img-fotki.yandex.ru/get/9223/158289418.419/0_17a61e_feb60b93_XL.png
Трижды повторяется музыкальный фрагмент. Первый фрагмент отмечен розовым, затем идёт повтор (не отмечен), затем ещё повтор (отмечен розовым).

028

https://img-fotki.yandex.ru/get/251308/158289418.419/0_17a62c_4345405f_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/194869/ … a_orig.png

029

https://img-fotki.yandex.ru/get/195132/158289418.419/0_17a62e_f2aab1b4_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/362774/ … 3_orig.png

https://img-fotki.yandex.ru/get/52656/158289418.419/0_17a631_b4cb8bfa_orig.png
Программная 323553555355-спираль

https://img-fotki.yandex.ru/get/6705/158289418.419/0_17a633_54126116_XL.png

https://img-fotki.yandex.ru/get/4611/158289418.419/0_17a635_7fc59498_XL.png

https://img-fotki.yandex.ru/get/104083/158289418.419/0_17a634_c925eb32_XL.png

https://img-fotki.yandex.ru/get/106972/158289418.419/0_17a632_65a5bdf_orig.png
Программная 3235553533555355-спираль

https://img-fotki.yandex.ru/get/198488/158289418.419/0_17a636_6f370c21_XL.png

https://img-fotki.yandex.ru/get/216168/158289418.419/0_17a638_8bb3df65_XL.png

https://img-fotki.yandex.ru/get/108497/158289418.419/0_17a637_b91ef8a4_XL.png

https://img-fotki.yandex.ru/get/198998/158289418.419/0_17a639_21fc4e56_XL.png
Программные спирали строятся под эту ритмичную музыку.

030

https://img-fotki.yandex.ru/get/3602/158289418.419/0_17a63b_6f5ef5f2_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/118982/ … 7_orig.png

Посмотрим форму характерного участка, который собирается под ритмичную музыку.

https://img-fotki.yandex.ru/get/216168/158289418.419/0_17a63d_5a0ba598_XL.png
До предварительной настройки углов

https://img-fotki.yandex.ru/get/196486/158289418.419/0_17a63e_21177b71_XL.png
После предварительной  настройки углов

https://img-fotki.yandex.ru/get/194835/158289418.419/0_17a63c_840cbea1_XL.png
Музыка сборки характерного участка

260

Re: Пикотехнология белков, ДНК, РНК - 3

https://img-fotki.yandex.ru/get/235015/158289418.418/0_17a559_5b81271a_orig.png
Кушелев: Любопытная программная 52552323-спираль. Интересно посмотреть 3D-модель...

https://img-fotki.yandex.ru/get/202385/158289418.418/0_17a60b_893d438a_XL.png
Ось симметрии 11-го порядка

https://img-fotki.yandex.ru/get/3614/158289418.418/0_17a60e_56d5c366_XL.png

https://img-fotki.yandex.ru/get/48807/158289418.418/0_17a60d_8d45e452_XL.png

https://img-fotki.yandex.ru/get/202385/158289418.418/0_17a60c_17c2b17e_XL.png
На самом деле ~3.5 элемента (по 8 аминокислотных остатков) на виток гиперспирали.