51

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 498

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Файл в стандарте fasta: https://www.ncbi.nlm.nih.gov/nuccore/92 … port=fasta

Вторичная структура: https://cloud.mail.ru/public/KRSZ/q52PvJFyN

https://img-fotki.yandex.ru/get/172272/158289418.3e1/0_1767b2_ef2f7f1b_XL.png
Кушелев: Интересно, что это за ритм?

52

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 533

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Когда музыка важнее формы...

Обратите внимание, что музыка (крайний правый столбец) остаётся регулярной даже при нарушении вторичной структуры (второй столбец справа).

https://img-fotki.yandex.ru/get/50260/158289418.3e1/0_17680c_67b80e8f_orig.png
Подробнее: http://nanoworld.org.ru/topic/1610/page/54/

53

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 684

Пикотехнология белков, ДНК, РНК - 2

https://www.ncbi.nlm.nih.gov/protein/67 … RM6G1V3013

https://www.ncbi.nlm.nih.gov/nuccore/67602080

XP_666450

>ENA|XP_666450|3036 nucleotides
atgaatacatggttaaattttgtaatttttttgttaattgtatttttggcaaattataag
gaaaatggtatctttcttaataatcaatccaatatcattataagtgagttatgttattta
aattttccaggatttagccagaattctaaattaacaatagaagatgaaatcacacattgg
attttaagcaatattccgttaaatgaaataggaattttaatagctcaattggaatcaaaa
atcgaaaaattgactggtgaatttaataaaattaaagataattccaaaactcttaaaagc
aattatgatagtcatgcgtgccataatcctaatattaaaaaacaaaaaggaaatagatgc
gaagtatgtgataaaagagctaatgccattaaaaggttgcacttacaaatgaaagagctt
gcttctaagatcgttaaatatcaacttaagcttgataaatgcaaatatagaaaggatatt
cttactggaaaagtagctaatgaagatgttatgtatagaccatttacgagtccttattct
ggtagatcacaacaagatctagataatttgcaaatgagacgtaagcaaaaggctcatgct
agagaaaaacgacgacttcaaagattaaaggatgcaactagattacctatgaataaacac
gaactatatattcaaactcaaaaagaaagaaaacttgatcctaaaaatttggtaattagt
tattttcagccaaaaactcttattttgtttacagataaattattaacttcaatttcagaa
gtattggaagctttaattaattttgattttaaaaaatgtttgaatgattcatttcaaatc
caaattgaaaggattcaaaagactttaaagtcacattttcacaaaagaacagtaattcta
aatcaattagaagctgaaaagaatattttgaattatttaaaaaatactgataatttctta
gatcagagaattatgatacttaaaaatactttagctatattaaacaaatccatattattt
actgaagttttgcagatgctttgcttgtatgatgaaaagagaaatagttttacagcaacg
gctttacctcaaatatgtcaagaaattagttttgaaatgcttaaaaaagaattggaaaaa
tttaaggaatttaataaaataccattaaataaattattggaaaatttaaatggtcaaaca
gaaacaacttcaacaggagttactgtggaaaatgataaatttattaggtttagggcgata
tacagccaaattcaaccagttttacaatttatatatagaaaatgtgttgaattaagattt
actgtaaataatgaaaatttgaatcttaattttgatgaaaatttgtttccagttgtatca
agattaccaagagattattacgaaacaggtgatttatcttcacttaaagtattatttgga
tggttttcaacatcaaatcaaacaaatcttgcaaaaaatcttactactaatatgatttta
atgatactagaaagaattttgcaacttttaaaaacttttgaatatatattaaacaaattg
aaacaaattcaaaatcctgaatcgagagagcaatataatttacaatttttttcattaaaa
tttcaattaagtttgttaacagctcttttaacaatgcatatggtaaaaataaaagagatt
aaaccacccatgaagtttaatataaaagttaaatcaattgataagaatacacttactcag
ttagtgaataatgacacaaagttggtggaaggtagtcaaaagtgtcacaatttggtattg
gcattattatattatagatatttgcaattaggagtgatattggaaaatgggaaaaaactt
gataaaaaaaatgcaaataattatacagttttgttaagttttattcctgatttattagaa
gaaattcttaaagctataaataattgtaaagcaaagttagaatatgaagaattattggag
acagcaattcaatttttggatggaagtacaactacaagaggatcagaattgaaagatttg
tctatatatcaattaactatgggattagtttcttcattcatttatgaagacttttctatt
ttgactccgaatattaataagttggttaaatttcttgagaagttgttaaagaagatttta
gatgcacgaactatttctgggttgaatgtagaaaagaaaaatataagtagttcagctgat
acgggtttgcaacatacaagtttcttgagtagtaatagcatgtttaaagctcaaaagtat
atattttctgctgagtttttgaagcttttgcttgagttgtataaacttacgagtgaattg
aaatctccaagttcttataaaagtgctagtggtcatggtttctttgtaccagttaatatt
atgagtcctagatttactccaacacagagttgctctttctcaactctttctggagggttt
gttcctcctttaactgatgtttcttcagtggatgattcttcattatttgattctgaagaa
tctgtagaactagagccaagaccaggacctggagcaggaccaggaccaggaccaggacca
ggaccaggaccaggaccaggaccaggaccaggaccaggaccaggaccaggaccaggacca
ggaccaggagcaggacctagaccaggagcaggaccaggacctgtactaggaccaggaacc
ccagggaaaccaacaattccagcttggcctggatcatcaggaagaccaagtagaatacca
ggaggtgtaccagtattaccagcgtttccaaggttaaaccagcagttccaagtaaaccag
cagttccaagtaaaccagcagttccaagtaaaccagcaactccaagtaaaccagcaactc
caagtaaaccagcaactccaagtaaaccagcagttccaagtaaaccagcaactccaagta
aaccagcagctccaaacaaaccagcagttccaaataaaccaacagttccaagtggatctg
gcggaggagatggtgatgaaggaaattatccaataa

https://img-fotki.yandex.ru/get/216168/158289418.3e6/0_176ec4_dd437e16_orig.png

https://img-fotki.yandex.ru/get/55431/158289418.3e6/0_176ec5_a4317791_orig.png

Интересный фрагмент с длинной бета-спиралью:

https://img-fotki.yandex.ru/get/243369/158289418.3e6/0_176ec6_f7c98f37_orig.png

Посмотрим фрагмент белка без длинной бета-спирали:

https://img-fotki.yandex.ru/get/94893/158289418.3e6/0_176ec7_6a988a78_orig.png

Интересно построить 3D модель этого фрагмента

https://img-fotki.yandex.ru/get/243369/158289418.3e6/0_176ec8_a6567e_XL.png
Фрагмент белковой молекулы состоит из одинаковых "загогулин"

https://img-fotki.yandex.ru/get/131711/158289418.3e6/0_176ec9_dcd3d910_XL.png

https://img-fotki.yandex.ru/get/197700/158289418.3e6/0_176eca_c1547ae2_XL.png

https://img-fotki.yandex.ru/get/59613/158289418.3e6/0_176ecb_597bbb1e_XL.png

https://img-fotki.yandex.ru/get/243369/158289418.3e6/0_176ecc_209b0dc_XL.png
Каждая "загогулина" NQQFQV является мета-элементом пико-конструктора.

В отличие от аминокислот мета-элементы складываются в параллелепипеды, т.е. программирование идёт как бы на уровне кубиков с прямыми углами. Хотя ... может показалось, что углы прямые.

https://img-fotki.yandex.ru/get/195990/158289418.3e6/0_176ecd_342b8c8c_XL.png

https://img-fotki.yandex.ru/get/105284/158289418.3e6/0_176ece_863fbd6f_XL.png

https://img-fotki.yandex.ru/get/60881/158289418.3e6/0_176ecf_6216efd3_XL.png
На последней страницы ноты явно отличаются более ритмичным стилем, а в самом конце мелодичностью.

https://img-fotki.yandex.ru/get/28874/158289418.3e6/0_176ed0_f6aff6c0_XL.png
Согласитесь, что в этих нотах просматривается некая логика. И не забывайте, что эти ноты звучали в гиперзвуковом диапазоне более миллиарда лет назад...

For Didier: It is real protein music 1 000 000 000 years old!

Послушайте, как они звучат (все 3 страницы нот): https://cloud.mail.ru/public/9T28/qWWUN7LjB

Полный комплект файлов: https://cloud.mail.ru/public/6bMN/S3o8mRKNm

54

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Инопланетный след Лунной сонаты

Формы, механизмы, энергия наномира. Сообщение 86 693

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

diprospan пишет:

криптоспоридии на Земле существуют более миллиарда лет ? а источник информации ?
и как им удалось сохранить за миллиард лет буквенный набор матричной РНК неизменным ...

Кушелев: Кстати, отличная "рыба" для конструктивно-фантастического рассказа "Лунная соната"...

Сюжет: В далёком минус миллиардном году на нашей планете работала инопланетная экспедиция птицелюдей. Они любили слушать музыку. Одним из сочинений была инопланетная "Лунная соната". Пока один из птицелюдей "щёлкал клювом", кто-то из местных присмыкающихся типа "крокодила Гены" проглотил музыкальный центр с банкой классических произведений инопланетной музыки. Музыкальные бактерии вышли из под контроля и оказались в почве. Понятно, что за миллиард лет из 144 нот первого кластера в результате мутаций в одичавшей музыкальной бактерии сохранился только обрывок из 22 нот, но его хватило гениальному местному композитору, чтобы восстановить внеземную музыкальную гармонию полностью.

https://img-fotki.yandex.ru/get/169608/158289418.3e6/0_176ed4_634e7cb3_XL.png

https://img-fotki.yandex.ru/get/41743/158289418.3e6/0_176f7d_d032adbc_orig.jpg
Научные подробности: http://nanoworld.org.ru/post/85832/#p85832

55

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 86 974

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Музыка добелкового мира. 50 000 000 000 000 лет назад

Complement-reverse-midi-converter

[13:46:02] Кушелев Александр Юрьевич: Кстати по поводу "и ещё что-то". Есть идея сделать complement-reverse-midi-converter
Алгоритм очень простой. Нужно заменить ноты с номерами MIDI n на ноты с номерами MIDI 140-n
А во второй версии добавить возможность проигрывания наоборот, т.е. ноты с порядковым номером n заменить на ноты с порядковым номером N-n

Letter to Didier:

Hello, Didier! I have new idea:
Complement-reverse-midi-converter
The algorithm is very simple. It is necessary to replace notes with MIDI-numbers n to notes with MIDI-numbers 140-n
And in the second version to add the ability to play the opposite, i.e. Notes with the serial number n are replaced by notes with the serial number N-n
Details: http://nanoworld.org.ru/post/86311/#p86311

Warm wishes,
Your Alexander Kushelev

56

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 87 004

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Complement-reverse-midi-converter

Кушелев: Пока программа Complement-reverse-midi-converter ещё не написана, я решил вручную записать комплементарные ноты для простых музыкальных произведений.

Первое произведение предложил музыкант-профессионал. Оно называется "В лесу родилась ёлочка".

https://img-fotki.yandex.ru/get/196486/158289418.3f3/0_1779b5_649f73a8_L.jpg

Комплементарные ноты, которые получены из первой фразы этого произведения.

Исполняет профессионал (видео): https://cloud.mail.ru/public/6hh1/cdKKPBPgi

https://img-fotki.yandex.ru/get/468374/158289418.3f3/0_1779b6_2b120cd6_M.jpg

Копия на фейсбуке: https://www.facebook.com/10000455610133 … 252110972/

https://img-fotki.yandex.ru/get/235925/158289418.3f3/0_1779b7_efb7b2e9_orig.png

57

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 87 008

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани / Didier Marouani от Кушелева

Complement-reverse-midi-converter

Комплементарное преобразование нот может сделать ... зеркало!

https://img-fotki.yandex.ru/get/233608/158289418.3f3/0_1779b8_1df7624_L.jpg
Видео: https://cloud.mail.ru/public/Lz51/j4dYcZPHW

58

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Формы, механизмы, энергия наномира. Сообщение 87 100

Письмо Дидье Маруани / Didier Marouani от Кушелева

Создаём программу Complement MIDI converter

Программа создана!

Знакомьтесь, комплементарный Бах:

Оригинал: https://cloud.mail.ru/public/2TLB/kZ45e67on
Комплемент: https://cloud.mail.ru/public/JEKG/M6xWMxJu7

59

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Dear Didier!

We make Complement MIDI Converter.

Original: https://cloud.mail.ru/public/2TLB/kZ45e67on

Complement: https://cloud.mail.ru/public/JEKG/M6xWMxJu7

Details: http://nanoworld.org.ru/post/86521/#p86521

Double see attach

Warm wishes,
Your AK

https://img-fotki.yandex.ru/get/194989/158289418.3f8/0_177ee5_61232de_L.jpg

60

Re: Письмо Дидье Маруани / Didier Marouani от Кушелева

Создаём программу Complement MIDI converter

Знакомьтесь, комплементарный Моцарт:

Оригинал: https://cloud.mail.ru/public/BDE4/JFpXGkLS1
Комплемент: https://cloud.mail.ru/public/5jLa/MjUqCriRX

https://img-fotki.yandex.ru/get/225029/158289418.3f9/0_177f3d_bfcf059b_L.jpg