1

Тема: Дидье Маруани и Алан Парсон...

Формы, механизмы, энергия наномира. Сообщение 86 245

Пикотехнология белков, ДНК, РНК - 2

Письмо Дидье Маруани от Кушелева

Дидье Маруани и Алан Парсон...

Кушелев. Одна из самых известных песен, визитка Space начинается с нот:

H1-C2-E1-A1-

https://img-fotki.yandex.ru/get/174352/158289418.3de/0_175e74_9565f8b7_XL.jpg

Space - Running In The City 1977 HQ: https://www.youtube.com/watch?v=bytEsP5TJ2g

Любопытно, что одна из известных песен Алана Парсона начинается с других нот:

H1-C2-E2-A1-

https://img-fotki.yandex.ru/get/40687/158289418.3de/0_175e75_727e9f08_XL.jpg

Alan Parsons Project - Eye In The Sky: https://www.youtube.com/watch?v=5-41tg_CS7s

Однако аминокислота, которая соответствует ноте ми (E) имеет разветвленный радикал, поэтому может соответствовать сразу двум нотам ми, т.е E1 и E2. При этом разные композиторы могли "услышать" разные ноты аминокислоты Thr.
нота аминокислота
A1    His H
H1    Asn N, Leu L, Asp D,
C2    Ile I
E2    Thr T, Cys C

Ну что же, давайте найдём белок, в состав которого входит аминокислотная последовательность типа:

Asp-Ile-Thr-His или в однобуквенном обозначении D-I-T-H-

Вместо D в последовательности может находиться N или L

Вместо T может быть C

Так что подходят следующие последовательности:

D-I-T-H-
N-I-T-H-
L-I-T-H-
D-I-C-H-
N-I-C-H-
L-I-C-H-

При этом эта последовательность нот у Дидье повторяется. Интересно посмотреть, есть ли белки, в которых такая последовательность аминокислотных остатков тоже повторяется.

Да! Есть такой белок в базе данных: https://www.ncbi.nlm.nih.gov/protein/50 … G6804RZ016

https://img-fotki.yandex.ru/get/48627/158289418.3de/0_175d5f_9949174f_orig.png

Здесь жёлтым цветом отмечены 8 нот из мелодии Дидье Маруани. При этом 4 последних аминокислоты - ноты из мелодии Алана Парсона. Но ... обратите внимание, что 9-я и 10-я аминокислоты L и E совпадают с 5-ой и 6-ой нотами из музыки Алана Парсона.

Другими словами непрерывная последовательность из 10 аминокислотных остатков совпадает с 8 (даже 9!) нотами из музыки Дидье Маруани и с 6 другими(!) нотами из музыки Алана Парсона. Каждое из этих совпадений имеет ничтожную вероятность, а двойное совпадение практически исключено, т.к. невероятно.

Любопытно, что ген принадлежит микроорганизмам, которые обычно живут в симбиозе с человеком. Может ли это означать, что у человека есть возможность "озвучивать" не только собственные гены, но и гены симбионтов?

Нуклеотидная кодирующая последовательность: https://www.ncbi.nlm.nih.gov/nuccore/50292924

https://www.ncbi.nlm.nih.gov/nuccore/50 … port=fasta

>XM_448895.1 Candida glabrata CBS 138 hypothetical protein partial mRNA
ATGTTGCACTCTAAGGATGAGGCTTTTGAAGATCTGCTGAAGCCGGTGTACAAGGGCAAGAAGCTGACCG
ATGAGGTGAACACTGCTGATGACAAGTGGAACTTGCTTCCTGCGTTTTTGAAAGTGAAGGGTCTTGTGAA
GCAGCACCTGGACTCCTTCAATTACTTTGTGGACGTTGACCTGAAGAAGATTATAAAGGCGAACCAGCTG
ATTTTGAGTGATGTCGATCCAGAGTTTTACCTCAAGTACGTGGACATCAGGGTCGGACAACGGTCCGGTA
GTCCCCACAAGGACCAGCTGGTGCCGCCTCATGAGTGTCGGCTGAGAGACATGACATACTCCGCGCCTAT
CTATGTTGATATCGAATACACGAGGGGACGCAACATTATCATGCACAAGAACGTCGAGATAGGTAGAATG
CCTATCATGTTGAGGTCTAACAAGTGTATCCTACATGGAGCTGATGAAAAGATGATGGCTAGGCTGAGCG
AGTGTCCCTTGGATCCAGGTGGCTATTTCATCGTGAACGGTACAGAAAAAGTTATTCTTGTCCAGGAACA
ACTTTCAAAGAATAGAATTATTGTCGAAGCTGATGAAAAGAAAGATATTGTACAAGCATCGGTGACCTCC
TCAACACACGAAAGAAAGTCCAAGACCTATGTTGTCACTAAGAATGGTAAAATCTATCTGAAACATAACT
CTATTGCTGAGGAAGTGCCCATCGTTATTGTATTGAAAGCCGCAGGTATCATTTCCGACTTGGAAATTAT
GCAGTTGGTTTGTGGTAATGATAGTAGTTATCAAGATATATTTTCTGTTAACCTAGAAGAAGCTGCCAAA
TTGAACATATGCACTCAGCAGCAAGCATTAGAATACATCGGTGCTAAGGTAAAGACAATGAGAAGACAGA
AACTGACTATTCTACAAGAAGGTATTGAAGCCATTGCAACCACAATCATTGCTCATTTAACTGTTGAAGC
CCTTGACTTTAGAGAAAAAGCTTTGTACATTGCTACAATGACTAGAAGAGTTGTGATGGCCATGCATAAT
CCAAAAATGGTCGATGATAGAGACTACGTTGGTAACAAGAGATTGGAATTAGCAGGGCAATTAATCTCCC
TTTTGTTTGAAGATTTGTTTAAAAAATTTAACAACGATTTCAAGCTAAGTATCGATAAAGTCTTGAAAAA
GCCTAATAGAGCCATGGAGTACGATGCATTATTGTCCATCAATGTCCATTCAAACAATATCACAAGCGGT
TTAAATAGAGCTATTTCTACTGGTAACTGGTCCTTGAAGAGATTTAAGATGGAAAGGGCTGGTGTCACAC
ATGTTTTATCGAGACTGTCCTATATTTCTGCTTTAGGTATGATGACCAGAATTTCTTCCCAGTTTGAAAA
GTCAAGAAAGGTTTCTGGTCCAAGAGCTTTGCAGCCTTCTCAATTTGGTATGCTATGTACTGCTGATACT
CCAGAAGGTGAAGCGTGTGGTCTAGTTAAGAACTTGGCACTTATGACACATATTACCACTGATGATGAAG
AAGAACCGATTAGAAAATTATGTTACGTTTTAGGTGTTGAACCGATAAGTTTATTGGACAGTGCCTCTCT
TCATTTAAATTACGGTGTGTACCTAAATGGTACACTGATTGGTACTACCAAATTTCCCTCAAATTTTGTT
TCTAGATTTCGTTTCTTAAGAAGAACAGGTAAGGTTTCTGAGTTTATTTCTATATATACAAATGATCATC
ACAATGCCGTCCATATTGCAACTGATGGTGGTAGAATTTGTAGACCATTGATTATTGTTAAGGATGGAAA
ATCGATGGTTGAAGCAGAACACTTAAAGAGATTACTTTCCGGTGAACTTGTTTTTGATGATTTCTTGAAA
TTGGGTTTGGTTGAATACCTTGATGTTAATGAAGAGAATGATTCTTATATTGCACTTTATGAAAAGGATA
TTACGCATGACATTACACATTTGGAAATTGAACCATTTACAGTTTTAGGTGCGGTTGCAGGTTTAATTCC
ATATCCTCATCATAACCAATCTCCAAGAAATACATACCAATGTGCGATGGGTAAGCAAGCCATTGGTGCT
ATTGCATACAATCAATTTAAAAGAATTGATACATTATTGTACTTGATGATATATCCTCAACAGCCTATGG
TGAAGACTAAAACTATTGAGTTAATCGATTATGATAAATTGCCCGCTGGACAAAATGCAACTGTTGCTGT
CATGTCTTATTCCGGTTACGATATTGAAGATGCCTTGGTTTTGAACAAATCATCGATAGATAGAGGTTTT
GGTCGTTGTGAAACGAGGCGTAAAACAACAACTGTGCTAAAGAAATATCCAAACCATACTAAAGATGCAT
TGTGCGGTATGAGAGTTGACGAAAATGGAGAAGCAATTTGGCAACATGAATCTTTAGGTCCTGATGGTCT
AGGTGAAGTCGGATTGAAAATACGAAGTGGTCAAATTTACATTAACAAGTCTGTTCCAGTACAATCCTCT
GATGCCATGGCTGTGAATCAAGCTCAGTATCGTGAGACACCTGTTATATACCGTGCTCCGGAACTATCTA
TTATAGACCAAGTAATGATGTCAACTTCTGATAATGACCAAGACTTGATCAAGGTTTTATTAAGACAAAA
CAGAAGACCGGAGTTGGGTGATAAATTCTCATCTCGTCATGGTCAGAAAGGTGTTTGTGGTATTATTGTA
CAACAAGAAGATATGCCATTCAATGATCAAGGTATTTGTCCAGATATTATTATGAATCCACACGGTTTTC
CTTCTCGTATGACTGTTGGTAAAATGATTGAATTAATTTCTGGTAAAGCAGGTGTTTTGAATGGATCCTT
AGAATACGGTACATGTTTCGGTGGGTCCAAGCTGGAAGATATGTCTAAAATATTAGTAGATCAAGGTTTC
AATTATTCTGGTAAAGACATGTTATATTCTGGTATTACCGGTGAATGTTTGCAAGCTTATATTTTCTTTG
GTCCGATTTACTATCAAAAATTGAAACATATGGTGCTGGATAAAATGCACGCGAGAGCAAGAGGTCCAAG
AGCAGTGCTAACTCGTCAACCAACTGAAGGTAGATCTCGTGATGGTGGTCTAAGATTGGGTGAAATGGAA
AGAGACTGTGTTATTGCATATGGTGCTTCACAGCTTCTTTTGGAGAGATTGATGATTAGTTCAGATGCTT
TTGAGGTTGATGTTTGTAGTAATTGTGGTTTGATGGGTTACAGTGGCTGGTGCTCAACATGTAAGAGTGC
AGAACATATTATCAAGATGACTATTCCATATGCAGCTAAGCTACTATTCCAAGAATTACTTGCCATGAAC
ATTGCACCCAGACTGAGACTGGAAGACATTTTCCAAGAGTGA

https://img-fotki.yandex.ru/get/172272/158289418.3de/0_175d60_24aeea79_XL.png

https://img-fotki.yandex.ru/get/196486/158289418.3de/0_175d61_82f00503_XL.png

https://img-fotki.yandex.ru/get/198786/158289418.3de/0_175d62_c9705111_XL.png

https://img-fotki.yandex.ru/get/47284/158289418.3de/0_175e05_31e825c6_XL.png

https://img-fotki.yandex.ru/get/223280/158289418.3de/0_175e06_65c27445_XL.png

Красным цветом показана последовательность из 9 нот музыки Дидье Маруани. Зелёным цветом показана 6-я нота музыки Алана Парсона. 5 предыдущих нот из этих двух мелодий условно совпадают.

Кстати, предшествующие три ноты (до красных) вполне вписываются в музыку Дидье Маруани и Алана Парсона! Интересно было бы создать композицию, в которую вошли бы все тринадцать нот удивительной гармонии музыки сборки белка Candida glabrata CBS 138