481

Re: Формы, механизмы, энергия наномира - 84

Пикотехнология белков, ДНК, РНК - 2

http://www.myshared.ru/slide/643151/

Цитата: 15  МЕТИОНИН - незаменимая АМК. Необходима для синтеза белков, участвует в реакциях дезаминирования, является источником серы для синтеза цистеина. Метионил-тРНК участвует в инициации трансляции. Метильная группа метионина - мобильный одноуглеродный фрагмент, используемый для синтеза ряда соединений в реакциях переноса этой группы на соответствующий акцептор (реакция транс- метилирования) Метильная группа в молекуле метионина прочно связана с атомом S, поэтому непосредственным донором этого одноуглеродного фрагмента служит активная форма метионина - S-аденозилметионин (SAM)
16  S-аденозилметионин (SAM) - сульфониевая форма метионина, образующаяся при его присоединении к молекуле аденозина (продукта гидролиза АТФ) Реакция активации метионина Присутствует во всех типах клеток Структура (S + -CH 3 ) в SAM - нестабильная группировка, определяющая высокую активность метильной группы (отсюда термин «активный метионин»). Это уникальная реакция, единственная, в результате которой освобождаются все три фосфатных остатка АТФ. Отщепление метильной группы от SAM и перенос ее на соединение -акцептор катализируют метилтрансферазы в реакциях транс- метилирования. SAM в ходе реакции превращается в S-аденозилгомоцистеин (SAГ).
Конец цитаты.

Кушелев: Понятно. Связь Met-Cys косвенно подтверждается, т.к. Cys образуется из Met, а значит, что в мышином лизоциме тоже возможно превращение Met в Cys в процессе дозревания белка.

https://img-fotki.yandex.ru/get/196070/158289418.3c3/0_17074a_a85f2577_XL.gif

482

Re: Формы, механизмы, энергия наномира - 84

Формы, механизмы, энергия наномира. Сообщение 84 482

Пикотехнология белков, ДНК, РНК - 2

См. Формы, механизмы, энергия наномира. Сообщение 84 458

В общей сложности построены модели 5 замкнутых через дисульфидные мостики участков.

1. Cys 95 - Cys 113 в человеческом лизоциме.
2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
3. Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
4.  Cys 94 - Cys 98  в лизоциме куриного яйца
5.  Met 1 - Cys 13  в мышином лизоциме

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными ничтожна. Для каждого участка отдельно она не превышает:

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4
5. 4^-12

Вероятность угадать все 5 участков не превышает 4^-(18+21+4+4+12)=4^-59 Примерно такая же вероятность случайно нащупать иголку в стоге сена размером с Солнечную систему, не вынимая руки из кармана.

В процессе моделирования фрагментов лизоцима и др. обнаружилась необходимость учёта 6 вариантов композиции, т.е. настройки 6 вариантов композиционных углов.

1. Код альфа-спирали
2. Код бета-спирали
3. Код пи-спирали
4. Код 310-спирали
5. Одиночный код альфа или 310.
6. Код метионина в составе спирали.
Но это только геометрический алгоритм. В будущем нужно учесть физико-химические взаимодействия. Модификация белка после рибосомальной сборки - отдельная "песня".

483

Re: Формы, механизмы, энергия наномира - 84

Kushelev пишет:

Но это только геометрический алгоритм. В будущем нужно учесть физико-химические взаимодействия. Модификация белка после рибосомальной сборки - отдельная "песня".

Да ладно smile. Чудеса да и только: наконец то и до Вас дошло, что одной геометрией не обойтись.

484

Re: Формы, механизмы, энергия наномира - 84

Victoriy, вы совсем недавно выпустили книгу под названием "Геометрия живого наномира. Пикотехнология белков". В числе соавторов значится Александр Кушелев. Там могут быть ошибочные утверждения с подачи этого фантазёра? Судя по моделям молекул органических соединений, так и есть. Может в интересах науки стоит переиздать книгу, удалив фрагменты, которые он сочинил?

485

Re: Формы, механизмы, энергия наномира - 84

Денис пишет:

Victoriy, вы совсем недавно выпустили книгу под названием "Геометрия живого наномира. Пикотехнология белков". В числе соавторов значится Александр Кушелев. Там могут быть ошибочные утверждения с подачи этого фантазёра? Судя по моделям молекул органических соединений, так и есть. Может в интересах науки стоит переиздать книгу, удалив фрагменты, которые он сочинил?

Уважаемый Денис, книгу я писала самостоятельно, поэтому включила в содержание не все подряд, а только свои разработки и те наработки Александра Юрьевича, которые не являются фантазиями, в частности его гипотезу о способе кодирования пространственной структуры белков. Кушелев рукопись читал (по крайней мере в этом меня заверил) и всё одобрил. Вы познакомьтесь с текстом и сами убедитесь в его научности. Для фантазий есть форум наномир, в котором А.Ю. волен самовыражаться на своё усмотрение smile.

486

Re: Формы, механизмы, энергия наномира - 84

Victoriy пишет:
Kushelev пишет:

Но это только геометрический алгоритм. В будущем нужно учесть физико-химические взаимодействия. Модификация белка после рибосомальной сборки - отдельная "песня".

Да ладно smile. Чудеса да и только: наконец то и до Вас дошло, что одной геометрией не обойтись.

Кушелев: Конечно не обойтись. Но для многих белков достаточно геометрического алгоритма.

487

Re: Формы, механизмы, энергия наномира - 84

Формы, механизмы, энергия наномира. Сообщение 84 488

Пикотехнология белков, ДНК, РНК - 2

https://img-fotki.yandex.ru/get/222565/158289418.3c3/0_170881_f56f1106_orig.png

Обнаружился 6-ой фрагмент, замкнутый через дисульфидный мостик. На этот раз это Met 1 - Cys 24 куриного яйца.

Рекордная длина фрагмента и рекордно малая вероятность случайного замыкания 4^-23 = 1.4*10^-14.

В этом фрагменте встречаются два одиночных кода 310-спирали ("5") и два кода 310-спирали в составе спиралей ("4"). Поэтому старая версия Пикотех даёт ошибку при любой настройке композиционных углов варианта "4". Минимальная ошибка получается в случае правильных углов в составе спирали. Этот вариант и помог обнаружить ещё один дисульфидный мостик куриного лизоцима.

https://img-fotki.yandex.ru/get/53993/158289418.3c3/0_170898_94d9b5cd_orig.gif

https://img-fotki.yandex.ru/get/228174/158289418.3c3/0_170895_c5cd18ed_XL.png

https://img-fotki.yandex.ru/get/197741/158289418.3c3/0_170894_84ab3deb_XL.png

https://img-fotki.yandex.ru/get/41743/158289418.3c3/0_170896_ce33a59a_XL.png

https://img-fotki.yandex.ru/get/228174/158289418.3c3/0_170897_8a66f3b7_XL.png

В общей сложности построены модели 6 замкнутых через дисульфидные мостики участков.

1. Cys 95 - Cys 113 в человеческом лизоциме.
2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
3. Cys 78 - Cys 82  в альтернативном человеческом лизоциме.
4.  Cys 94 - Cys 98  в лизоциме куриного яйца
5.  Met 1 - Cys 13  в мышином лизоциме
6.  Met 1 - Cys 24  в лизоциме куриного яйца

488

Re: Формы, механизмы, энергия наномира - 84

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Создаём новую версию Пикотехнологии 2D...

Skype, 2017-01-15:

[0:11:06] Кушелев Александр Юрьевич: На первом этапе хотелось бы получить следующую версию композиционного кода. Новые варианты композиции показаны красным цветом в правом столбце:

https://img-fotki.yandex.ru/get/198998/158289418.3c1/0_17066a_325fac7_orig.png
[11:45:58] Кушелев Александр Юрьевич: Конечно, я могу и вручную написать композиционный код 6, но программа сильно сэкономила бы время...
[12:46:46] Va12220(valqwa): не напишешь
[12:46:54] Va12220(valqwa): я вернулся. ты скучал ?
[13:01:39] Кушелев Александр Юрьевич: Ты можешь подправить программу от Prosolver?
[13:10:45] Va12220(valqwa): Это старая версия 2D: http://nanoworld.narod.ru/Pikotech2D_3.6.zip ?
[13:13:06] Кушелев Александр Юрьевич: Возьми новую. Она копирует в буфер обмена данными композиционный код.
[13:13:30] Кушелев Александр Юрьевич: Сможешь сделать, чтобы код был таким, как справа?

https://img-fotki.yandex.ru/get/198998/158289418.3c1/0_17066a_325fac7_orig.png
[13:14:05] Va12220(valqwa): справа - это где красные цифры 5 и 6 ?
[13:14:10] Кушелев Александр Юрьевич: Да
[13:15:08] Кушелев Александр Юрьевич: Цифра 6 связана только с одним кодом Met, т.е. ATG
[13:15:26] Кушелев Александр Юрьевич: А цифра 5 - одиночные коды "1" или "4"
[13:16:26] Кушелев Александр Юрьевич: Если в составе спиралей, то они "1" и "4", а если до витка спирали не дотягивает, то "5"
[13:19:06] Кушелев Александр Юрьевич: На примере лизоцима я обнаружил, что структура белка может быть напряжённой, т.е. по коду 4 атомные группы как бы вдавливаются в соседние. А если был бы код 1, то не вдавливались бы. Но в этом белке нужно получить напряжённое состояние, поэтому код 1 в процессе эволюции заменился на 4.
[13:19:42] Кушелев Александр Юрьевич: Так что без учёта физики некоторые белки мы не сможем правильно построить.
[13:20:01] Кушелев Александр Юрьевич: Только ненапряжённые.
[13:24:57] Va12220(valqwa): пробую разобраться
[13:26:16] Кушелев Александр Юрьевич: Чем быстрее сможем настроить программу, тем быстрее сможем заинтересовать заказчиков. Не настроенная программа отпугивает. Американский заказчик отвалился.
[13:27:14] Кушелев Александр Юрьевич: Там ещё менеджер схалтурил. Я ему говорил, чтобы он предупредил, что программа ещё не отлажена, есть ошибки. А он не передал американцам. И вторичную структуру вообще не показал...
[13:41:55] Va12220(valqwa): ну... ничего про него не скажу.
[13:41:58] Va12220(valqwa): жди немного
[13:55:11] Кушелев Александр Юрьевич: Кстати, если Met не в составе альфа- или 310-спирали, то его код 5.
[14:04:35] Va12220(valqwa): погоди. я запутался. пару шагов обратно:

(я с тобой) мы делали ранее 2 задачи
1 - преобразование .fast (.dne) в композиционный вид (код)
2 - а далее этот комппозитный код "крутили-вертели" и получали .PDB результат. (неплохой кстати), но только остановились на ... структуре.
а ты сейчас предлагаешь старую программу на паскале "исправить"
[15:17:39] Va12220(valqwa): мы работали с такой таблицей
[15:19:33] Va12220(valqwa): согласно этой табилце мы преобразовывали элементы FAST ('aca') в композитный код ('2')
[15:22:23] Va12220(valqwa): получив композитный код (мы это делали на примере кода коллагена), мы строили цепочку (точек, вершин) методом сдвигов и поворотов.
полученную цепочку записывали в файл PDB формата. и далее "смотрели " полученную молекулу в PDB-вьювере.
[17:18:35] Кушелев Александр Юрьевич: Да
[17:21:43] Кушелев Александр Юрьевич: В 3D алгоритме было заложено "альфа-спираль", если коду "1" предшествуют 3 кода  "1" или "4" и "310-спираль", если коду "4" предшествуют 2 кода  "1" или "4". В противном случае это не код "1" или "4", а код "5"
[17:22:18] Кушелев Александр Юрьевич: В программе от Prosolver это нужно реализовать.
[17:22:45] Кушелев Александр Юрьевич: Т.е. чтобы номера кодов выводились в схему и в буфер обмена данными.
[18:21:30] Va12220(valqwa): понятно. не прочел то что я пишу. все о своем пишешь. того что ты пишешь - недостаточно. пропускаешь полезные моменты.

и так.  все преобразования что ты делаешь - они закодированы в первичном варианте таблицей (ту что я тебе скинул).
Таблица сопоставляет тройки (буквенного)кода определенным вариантам преоброзований. До нынешнего момента - это были варианты: 1 2 3 и 4

верно ?
[18:25:02] Кушелев Александр Юрьевич: Да
[18:25:29] Кушелев Александр Юрьевич: Но нам мало таблицы
[18:25:41] Va12220(valqwa): стоп.
[18:26:40] Кушелев Александр Юрьевич: Нам нужно добавить алгоритм. "Если коду "1" предшествуют коды "1" или "4" (не менее 3), то это - код "1". Если менее, то это - код "5"
[18:27:16] Va12220(valqwa): и так - берем фаст код. и получаем (используя таблицу) - кодовую таблицу (вероятных) будущих преобразований.

НО - этого недостаточно.

прежде чем делать будущие преобразования - необходимо полученный кодовый набор обработать.

верно ? что бы учесть варианты спиралей и прочие тонкости структуры
[18:27:31] Кушелев Александр Юрьевич: Да
[18:29:31] Va12220(valqwa): ну слава богу.

значит сл. этап  - взять кодовый (цифровой) набор и с ним пработать. сл. образом:
по очереди давай смотреть:

если встретилась цепочка "1 1 1 1" - то она должна быть преобразована в цепочку "1 1 1 6"
[18:29:34] Va12220(valqwa): верно ?
[18:30:45] Va12220(valqwa): у тебя так по картинке выходит
[18:30:48] Кушелев Александр Юрьевич: Нет. Должна остаться 1111, если там нет Met
[18:31:41] Кушелев Александр Юрьевич: Met в окружении "1" или "4" должен из "1" превратиться в "6"
[18:31:59] Va12220(valqwa): т.е. условие более сложное. надо анализировать так же и буквенную последовательность
[18:32:11] Кушелев Александр Юрьевич: Да. Это только для Met
[18:34:03] Кушелев Александр Юрьевич: А коды:
212 -> 252
313 -> 353
2113 -> 1553
[18:34:41] Кушелев Александр Юрьевич: 21142 -> 24442
[18:35:11] Va12220(valqwa): 213 - 253 ?
[18:35:19] Кушелев Александр Юрьевич: Да
[18:35:28] Кушелев Александр Юрьевич: 243 - 253
[18:35:33] Va12220(valqwa): и много таких комбинаций ?
[18:36:07] Кушелев Александр Юрьевич: Прилично
[18:36:12] Кушелев Александр Юрьевич: Под сотню
[18:36:22] Кушелев Александр Юрьевич: Теоретически можно и таблицей задать
[18:37:25] Кушелев Александр Юрьевич: Но можно и логически
[18:38:39] Кушелев Александр Юрьевич: Если встречается менее 3 подряд символов 1 или 4, то они заменяются на 5
[18:39:46] Va12220(valqwa): так или так но надо описать. включая примеры. что бы я мог логику встроить в программу и проверить потом.
[18:40:25] Va12220(valqwa): а преобразования кодам 5 и 6 ты знаешь какие надо применить ?
[18:40:26] Кушелев Александр Юрьевич: Если встречается менее 4 символов подряд 1 или 4 (последний "1"), то они заменяются на 4
[18:40:44] Кушелев Александр Юрьевич: Да. Углы другие
[18:42:17] Кушелев Александр Юрьевич: Сначала нужно заменить 1 на 4, если 1 или 4 подряд меньше 4. А потом заменить 4 на 5, если подряд меньше 3
[18:42:36] Va12220(valqwa): вот смотри  - ты пишешь:
[18:40] Кушелев Александр Юрьевич:

<<< Если встречается менее 4 символов подряд 1 или 4 (последний "1"), то они заменяются на 4
это обозначаем - 1 2 или 3 символа, последний 1  - я так понимаю - это все же 2 или 3 символа

пиши примеры
[18:44:16] Va12220(valqwa): и ещё вопрос.
в наборе 1-3-4-4-2-1-3 попалась цепочка из 3х символов - например  1-3-4  я её меняю на 1-3-5
далее я начинаю рассматривать сл варианты  из этой последовательности 3-4-4 - её я должен поменять на 3-4-5

НО при этом я уже ранее поменял среднюю 4 на 5
[18:46:12] Кушелев Александр Юрьевич: 111->555
411->555
141->555
441->555
114->444
144->444
414->444
444->444
[18:46:43] Кушелев Александр Юрьевич: 1114->1444
[18:47:21] Кушелев Александр Юрьевич: 1141->4441
[18:47:37] Кушелев Александр Юрьевич: Похоже, что придётся таблицу составлять. Там не всё так просто
[18:48:01] Va12220(valqwa): ну вот слава богу - дошло до тебя. )
[18:49:36] Va12220(valqwa): пока ты будешь выводить правило замены - я закончу то что не доделал почти год тому. программу "савина-неделько"
[18:49:39] Кушелев Александр Юрьевич: Тут придётся повторять логику рибосомы.
[18:50:10] Кушелев Александр Юрьевич: Рибосома ставит аминокислоты по очереди.
[18:50:32] Va12220(valqwa): мне это не знакомо так как тебе. извини. не помогу
[18:50:33] Кушелев Александр Юрьевич: Если она ставит по варианту 2 или 3, то ничего менять не нужно
[18:51:25] Va12220(valqwa): у вас там есть где парковаться у дома ?
[18:51:30] Кушелев Александр Юрьевич: Если она ставит по варианту 4, то нужно проверить предыдущие 2. Если все они 1 или 4, то вариант 4 остаётся. Если нет, то превращается в вариант 5.
[18:51:36] Кушелев Александр Юрьевич: Есть
[18:51:48] Va12220(valqwa): )) и дворники чистят дороги ?
[18:52:11] Кушелев Александр Юрьевич: Но если следующий вариант будет 1 или 4, то предыдущий вариант 5 нужно будет вернуть на место smile
[18:52:17] Кушелев Александр Юрьевич: Вроде чистят
[18:53:01] Кушелев Александр Юрьевич: Короче, с логикой рибосомы придётся ещё разобраться...
[18:53:17] Va12220(valqwa): хооршо. описывай логику. и делай описание в примерах
т.е. так:
[18:53:23] Кушелев Александр Юрьевич: Понял
[18:53:48] Va12220(valqwa): "если она ставит по варанту 2 или 3, то не меять ничего" - например:  "несколько примеров" в коде
[18:54:08] Va12220(valqwa): и т.д.
[20:01:06] Кушелев Александр Юрьевич: Вроде разобрался.
[20:01:09] Кушелев Александр Юрьевич:
1. Если встречается код 2 или 3, ничего не менять.
2. Если встречается код 1 или 4, запомнить их и поменять на 5.
3. Если второй раз подряд встречается код 1 или 4, замомнить и поменять на 5.
4. Если третий раз подряд встречается код 1 или 4, то в случае 1 запомнить и поменять на 5, а в случае 4 поменять два предыдущих кода на коды "4"
5. Если четвёртый раз подряд встречается код 1 или 4, то если последний код 1, три предыдущих поменять на коды "1". Если последний 4, то ничего не менять.
6. Если больше, чем 4 раза подряд встречается код 1 или 4 или их комбинация, то ничего не менять.
После первого прохода идёт второй:
7. Если встречается код Met, то если он 5, то не менять. Если он 1, то поменять на 6.

489

Re: Формы, механизмы, энергия наномира - 84

[20:21:04] Va12220(valqwa): противоречие 7 и 2
[20:21:21] Кушелев Александр Юрьевич: В чём?
[20:21:46] Va12220(valqwa): 1 который ты уже поменял в 2 на 5
поэтому в 7 не видишь 1
[20:22:07] Кушелев Александр Юрьевич: А в 4 они могут обратно поменяться
[20:22:31] Va12220(valqwa): 4 - особый исключительный случай
[20:22:37] Кушелев Александр Юрьевич: Нет
[20:22:56] Кушелев Александр Юрьевич: 4 случай - это начало альфа- или 310-спирали
[20:22:56] Va12220(valqwa): и что значит "запомнить и поменять"
[20:23:13] Кушелев Александр Юрьевич: Запомнить, чтобы можно было обратно поменять
[20:23:55] Кушелев Александр Юрьевич: А если там больше 3 раз подряд 1 или 4 (или смесь), то тут уже менять ничего не нужно. Это уже спираль продолжается
[20:30:58] Кушелев Александр Юрьевич: Не, это кривой алгоритм. Нужно по-другому.
[20:32:06] Кушелев Александр Юрьевич: 1. Если встретился код 2 или 3, ничего не менять.
2. Если встретился 4, то проверить, что впереди и сзади. Если символ N-1 и N-2 1 или 4, а N-3 2 или 3, то поменять символ N, N-1 и N-2 на 4. Если N-3  1 или 4, то ничего не менять. Если  символ N+1 2 или 3, а N-1 или N-2  2 или 3, то символ N поменять на 5.
[20:53:38] Кушелев Александр Юрьевич: 3. Если встретился символ 1, то проверить, что спереди и сзади. Если спереди+сзади меньше  3 символов 1 или 4, символ N поменять на 5.
[20:54:42] Кушелев Александр Юрьевич: Опять как-то криво получается...
[20:56:05] Va12220(valqwa):  угу. кривовато.
[20:56:45] Кушелев Александр Юрьевич: Надо включать счётчик символов типа 1 или 4. Если счётчик сбросился с номера 1 или 2 в 0, то поменять 1-2 символа 1 или 4 на 5
[20:56:45] Va12220(valqwa): давай возьмем какую нибудь "показательную" fast" последовательность и её будем разбирать
[20:56:58] Кушелев Александр Юрьевич: Не, лучше с логикой разобраться
[20:57:13] Кушелев Александр Юрьевич: Включаем счётчик на символе 1 или 4
[20:57:15] Va12220(valqwa): если с логикой - то это тебе делать сейчас надо
[20:57:22] Va12220(valqwa): тернируйся
[20:57:46] Кушелев Александр Юрьевич: Если счётчик дошёл до 3 и последний символ 4, то два предыдущих нужно поменять на 4.
[20:58:08] Кушелев Александр Юрьевич: Если счётчик дошёл до 4, то менять ничего не нужно.
[20:58:58] Кушелев Александр Юрьевич: Если счётчик дошёл до 3, и последний символ 1, после чего счётчик сбросился в 0, то все три символа нужно поменять на 5
[20:59:49] Va12220(valqwa): приведи наглядный пример
[21:00:08] Кушелев Александр Юрьевич: Один момент
[21:02:10] Кушелев Александр Юрьевич: 331334331133443314334133 -> 33533533553355335533
[21:02:39] Кушелев Александр Юрьевич: 31113 -> 35553
[21:02:57] Кушелев Александр Юрьевич: 31143 -> 34443
[21:03:21] Кушелев Александр Юрьевич: 34143 -> 34443
[21:03:38] Кушелев Александр Юрьевич: 31443 -> 34443
[21:04:16] Кушелев Александр Юрьевич: 34443 не менять
[21:04:23] Кушелев Александр Юрьевич: 311113 не менять
[21:04:43] Кушелев Александр Юрьевич: 341413 не менять
[21:05:01] Кушелев Александр Юрьевич: 344413 не менять
[21:06:33] Кушелев Александр Юрьевич: Короче, если счётчик единиц (четвёрок) дошёл до 4, то ничего не менять
[21:06:45] Кушелев Александр Юрьевич: Если дошёл до трёх и последняя была 4, то тоже ничего не менять
[21:06:46] Va12220(valqwa): это вот выглядит как-то "странно"
[21:02] Кушелев Александр Юрьевич:

31143 -> 34443
34143 -> 34443
31443 -> 34443 не получится ли, что последующие геометрические преобразования приведут к неверному виду? оч даже получится.

и я не вижу в втоем примере счетчик
[21:07:24] Кушелев Александр Юрьевич: Счётчик считает 1 и 4
[21:07:37] Va12220(valqwa): и ты брал в качестве рассматриваемых отрезков - отрезки по 5 цифр ПОСЛЕДОВАТЕЛЬНО
а если внутри таких отрезков есть правила что ты ранее говорил ?
[21:07:39] Кушелев Александр Юрьевич: Если досчитал до тёх и последний символ 4, то ничего не менять
[21:08:05] Кушелев Александр Юрьевич: Если достчитал до 4, то ничего не менять.
[21:08:30] Кушелев Александр Юрьевич: Если досчитал до трёх, последняя 1 и счётчик сбросился, то менять на 555
[21:09:02] Кушелев Александр Юрьевич: Если счётчик сбросился после двух, то менять на 55
[21:09:15] Кушелев Александр Юрьевич: Если счётчик сбросился после одного символа, то менять на 5
[21:09:30] Va12220(valqwa): экселем умеешь пльзоваться ?
[21:09:36] Кушелев Александр Юрьевич: Неа
[21:09:58] Кушелев Александр Юрьевич: Зато с логикой алгоритма практически прояснилось
[21:10:15] Кушелев Александр Юрьевич: Нужно завести счётчик символов 1(4)
[21:10:32] Кушелев Александр Юрьевич: И сбрасывать его символом 2(3)
[21:12:13] Va12220(valqwa): не понимаю я того что ты пишешь.
вот последовательность(верх)  и счетчики снизу
1111141411411411344213
1234 - сейчас последняя 1 - что мне менять на 555 ?
[21:12:14] Кушелев Александр Юрьевич: Кстати, этот алгоритм можно и в скрипт Кушелева встроить.
[21:13:08] Кушелев Александр Юрьевич: Если счётчик не сбросился после третьей единицы, то уже ничего не менять.
[21:13:25] Va12220(valqwa): а почему он не сбросился после 3й единицы ?
[21:13:40] Кушелев Александр Юрьевич: А потому что у тебя 4-ый символ не 2 и не 3
[21:16:16] Кушелев Александр Юрьевич: А если он сбросился после третьего символа, и он оказался "1", то все три нужно менять на 555, а если третий был 4, но все менять на 444
[21:16:19] Va12220(valqwa): хорошо
дальше
1111141411411411344213
1234123
1234_сбрасывание счетчика в 1(см выше)
[21:16:29] Va12220(valqwa): дальше как быть?
[21:17:24] Va12220(valqwa): по-твоему я сбрасываю счеткик после 4ки или после встреченного кода 2 или 3
[21:17:26] Кушелев Александр Юрьевич: Дальше начинаем считать с ближайшей 1 или 4
[21:17:54] Кушелев Александр Юрьевич: Сбрасывать надо на 2 или 3
[21:17:56] Va12220(valqwa): 1111141411411411344213
1234
распиши дальше ступеньчато
[21:18:56] Кушелев Александр Юрьевич: 1111141411411411344213
123456789... на тройке будет 0
[21:19:17] Кушелев Александр Юрьевич: После тройки начинаем сначала:
[21:19:45] Кушелев Александр Юрьевич: 344213
012010
[21:20:32] Кушелев Александр Юрьевич: 344213 -> 355253
[21:21:30] Va12220(valqwa): а теперь посмотри на свою картинку

https://img-fotki.yandex.ru/get/198998/158289418.3c1/0_17066a_325fac7_orig.png

последовательность из неё взята
[21:22:01] Кушелев Александр Юрьевич: На втором проходе Met нужно будет с 1 на 6 поменять
[21:22:32] Va12220(valqwa): там 2 мета ! а менять надо в 1м случае ?
[21:22:54] Кушелев Александр Юрьевич: Не понял. Что за 2 мета?
[21:23:13] Va12220(valqwa): там второй и 4й единичке соответствует МЕТ
[21:23:20] Кушелев Александр Юрьевич: Оба
[21:23:22] Va12220(valqwa): а ты меняешь на 6 только вторую на картинке
[21:23:31] Кушелев Александр Юрьевич: Я первый не заметил
[21:23:37] Кушелев Александр Юрьевич: Он и не имеет значения
[21:23:46] Кушелев Александр Юрьевич: Но по алгоритму надо менять оба
[21:23:51] Va12220(valqwa): все имеет значение.
[21:24:23] Кушелев Александр Юрьевич: Менять, менять...
[21:24:53] Кушелев Александр Юрьевич: На самом деле первый символ не имеет смысла
[21:26:05] Va12220(valqwa): второй на твоей картинке
[21:26:11] Va12220(valqwa): второй МЕТ там
[21:26:15] Кушелев Александр Юрьевич: А хотя ... тут не всё так просто...
[21:26:40] Кушелев Александр Юрьевич: Второй точно надо менять
[21:27:16] Кушелев Александр Юрьевич: Начало белка погоды не делает. Поэтому лучше пусть по общему алгоритму будет

490

Re: Формы, механизмы, энергия наномира - 84

[21:46:37] Va12220(valqwa): ну давай попробуем.
фаст последовательность какую взять ?
[21:46:57] Кушелев Александр Юрьевич: момент
[21:47:12] Кушелев Александр Юрьевич: FT CDS 1..492
     ATGGAAGCTA GGAGCCGGGC TCCCAGAAGA CAGCTGTGCC CGCCTGGGAT CACTTGGCTG
     GCCCTGGCCT ATCTGCTCAG CTGCCTGCTT GCCTCCAGCA AGGCCAAGGT CTTCAGTCGC
     TGTGAGCTGG CCAAAGAGAT GCATGACTTC GGTCTGGATG GCTACCGGGG TTATAACCTG
     GCTGACTGGG TCTGCCTTGC TTACTACACA AGTGGCTTCA ACACAAATGC TGTGGATCAT
     GAAGCTGATG GAAGCACCAA CAATGGCATC TTCCAGATCA GCAGCCGGAG GTGGTGCAGA
     ACCCTCGCCT CGAATGGCCC CAATCTTTGC AGGATATACT GCACTGATTT GTTGAACAAT
     GATCTCAAAG ATTCTATCGT CTGTGCCATG AAGATAGTTC AAGAACCCCT GGGTCTGGGC
     TATTGGGAAG CCTGGAGGCA CCACTGCCAG GGCAGGGACC CCAGTGACTG GGTGGATGGC
     TGTGACTTCT AG
//
[21:47:26] Кушелев Александр Юрьевич: Это dne
[21:48:20] Кушелев Александр Юрьевич: А это fasta:
[21:48:21] Кушелев Александр Юрьевич: >ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG
[21:49:04] Va12220(valqwa): оки. хорошо. сейчас минут 10-20 повожусь. настрою
[21:49:27] Кушелев Александр Юрьевич: Эти шутники всё время стандарты расширяют. Появились новые "фасты", которые программа от Prosolver не понимает
[21:52:51] Va12220(valqwa): мне все равно
[21:54:58] Кушелев Александр Юрьевич: Вот такую фасту программа Prosolver не берёт:
[21:54:59] Кушелев Александр Юрьевич: >NM_014656.2 Homo sapiens KIAA0040 (KIAA0040), transcript variant 2, mRNA
TCCCACGACCTTGGCCGGCGCCGGGGCCCTACACGCCAGACCTGGCTCGGGGTGGGAGTGCAGAGGCAAC
CAAAAAGGAACCCACACCTCCCTCCAGGGCCCGGGGCGCTGTCAGACGGGGCAGCAACCAGGAGATTCCC
[21:55:21] Кушелев Александр Юрьевич: Говорит, что ей не хватает ENA<
[21:56:05] Кушелев Александр Юрьевич: Ты можешь подправить программу, чтобы она первую строчку игнорировала, но брала оттуда название файла
[21:56:11] Кушелев Александр Юрьевич: Точнее название белка
[21:56:18] Кушелев Александр Юрьевич: Идентификатор
[21:56:38] Кушелев Александр Юрьевич: Или первые символов 30. Там он точно будет
[21:57:33] Кушелев Александр Юрьевич: Можно даже всю первую строчку загнать в графический файл, но только разбить на короткие строчки, чтобы графический файл шире не стал.
[21:59:13] Va12220(valqwa): сейчас не могу. у меня нет сейчас оболочки паскаля что бы разбираться с паскалем (старым очень к тому же )
[22:01:10] Va12220(valqwa): это нужно же заново потом перекомпилировать и создать исполняемый файл. гемороя хватит не на один час и не на два )
[22:02:06] Va12220(valqwa): если тебе так важно, то мне проще сделать тоже самое
https://img-fotki.yandex.ru/get/198998/ … 7_orig.png
на своем инструменте
[22:03:59] Кушелев Александр Юрьевич: Мне без разницы, на каком. Важно исходный алгоритм зафиксировать, чтобы можно было в скрипт Кушелева встроить. Тогда я смогу на Маше продублировать всё.
[22:04:45] Va12220(valqwa): не понял. что в маше продублировать ?
[22:04:58] Кушелев Александр Юрьевич: Алгоритм превращения 1234 в 123456
[22:05:26] Кушелев Александр Юрьевич: У меня сейчас скрипт строит 3D модель без радикалов по композиционному коду
[22:05:40] Кушелев Александр Юрьевич: Я на нём могу углы настраивать для вариантов 123456
[22:06:03] Кушелев Александр Юрьевич: Но в моём скрипте нет алгоритма перекодировки 1234 в 123456
[22:06:11] Va12220(valqwa): а какой "исходный" ?
[22:06:25] Кушелев Александр Юрьевич: Ты же в своей программе его делаешь?
[22:06:41] Va12220(valqwa): твой алгоритм берет композиционный код ?
[22:06:41] Кушелев Александр Юрьевич: Вот и в скрипт его хорошо бы тоже вставить
[22:06:46] Кушелев Александр Юрьевич: Да
[22:06:56] Кушелев Александр Юрьевич: И строит кольцегранную модель без радикалов
[22:07:09] Va12220(valqwa): и он сейчас берет 1234
а ты хочешь получить комп код 123456
и уже с ним работать ?
[22:07:34] Кушелев Александр Юрьевич: Да, но я хочу и алгоритм в скрипт вставить, чтобы он сам из 1234 делал 123456
[22:07:54] Va12220(valqwa): ну вставь - ты же мне его рассказал только что
[22:08:10] Кушелев Александр Юрьевич: Я его не могу в виде скрипта написать
[22:08:25] Va12220(valqwa): а как собрался тогда вставлять ?
[22:08:49] Кушелев Александр Юрьевич: Глядя на твой исходник может получится его в виде скрипта написать
[22:10:01] Va12220(valqwa): ну ну
[22:10:03] Кушелев Александр Юрьевич: Скрипт хорош тем, что я его могу модифицировать сам
[22:10:38] Кушелев Александр Юрьевич: Не нужно будет ждать твоего очередного возвращения, чтобы исправить 20 градусов на 22 градуса или наоборот
[22:11:35] Кушелев Александр Юрьевич: А после того, как наберётся критическое количество доработок, ты уже новую версию напишешь
[22:12:22] Va12220(valqwa): давай попробуем
[22:12:31] Кушелев Александр Юрьевич: Давай
[22:13:54] Кушелев Александр Юрьевич: Кстати, мне от программы Prosolver нужно в первую очередь код 123456, а не графика
[22:14:02] Кушелев Александр Юрьевич: Графика она такой же останется
[22:14:11] Кушелев Александр Юрьевич: Тольцо цифры в столбцах поменяются
[22:14:27] Кушелев Александр Юрьевич: Для скрипта мне только цифры и нужны
[22:14:47] Кушелев Александр Юрьевич: В виде текстового файла
[22:15:34] Кушелев Александр Юрьевич: Но чтобы две программы не запускать, хотелось бы и цветные столбцы видеть сразу
[22:19:07] Va12220(valqwa): так как на картинке ?
[22:20:51] Кушелев Александр Юрьевич: Да, но два столбца там не нужно. Только новый с новыми цифрами. Хотя для проверки может и старый пригодиться...
[22:21:09] Кушелев Александр Юрьевич: После отладки старый будет не нужен
[22:22:25] Va12220(valqwa): но для 5 и 6 видимо должны быть иные обозначения в цветных столбцаХ?
[22:23:08] Кушелев Александр Юрьевич: Да. Они и были раньше. 5 был розовым, а 6 нужно сделать сиреневым
[22:23:38] Va12220(valqwa): а размер - полный прямоугольник ?
[22:23:53] Кушелев Александр Юрьевич: А размер оставить, как был
[22:24:00] Va12220(valqwa): а я не знаю какой он был
[22:24:11] Кушелев Александр Юрьевич: Так у тебя же картинка есть
[22:24:35] Va12220(valqwa): на картнке 6 - полный а 5 - половинный  ТАК ?
[22:25:25] Кушелев Александр Юрьевич: Розовый пусть будет другой формы вообще. Сейчас нарисую
[22:29:38] Кушелев Александр Юрьевич: Розовый нужно сделать из зелёного. Т.е. такой же формы, как зелёный, только розовый
[22:29:51] Кушелев Александр Юрьевич: Сможешь?
[22:31:11] Кушелев Александр Юрьевич: Розовый на самом деле должен быть красно-розовым
[22:31:25] Кушелев Александр Юрьевич: Яркая часть средняя красная, а окантовочка розовая.
[22:32:04] Кушелев Александр Юрьевич: Из зелёного в Фотошопе перекрасить изменением оттенка
[22:32:25] Кушелев Александр Юрьевич: У меня просто фотошопа нет
[22:32:34] Кушелев Александр Юрьевич: Не тянет этот комп...
[22:34:07] Va12220(valqwa): )) в маше нарисуй wink
[22:35:14] Кушелев Александр Юрьевич: Ддразниться? Замени цифры в Color cо второй позиции(зеленый) на первую (красный), и всех делов
[22:38:08] Va12220(valqwa): ладно. нарисую конечно.
отдыхай пока что ) можно сказать день не зря прожит.
[22:38:31] Кушелев Александр Юрьевич: Да. Алгоритм нарисовался, однако...