401

Re: Формы, механизмы, энергия наномира - 83

Формы, механизмы, энергия наномира. Сообщение 83 401

Готовится 580-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

580 Самоповерка пикотехнологии
Эволюция фрактального самопрограммирования
Сходство и различие генетического кода с языком
Степень экзотики - мера волшебства
Грибной снегопад. Эволюционный факультет.
Уровни механизма старения
https://img-fotki.yandex.ru/get/195771/158289418.3a9/0_16e45e_5079e0c_M.png https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_M.png
http://nanoworld88.narod.ru/data/025_files/1.gif
https://img-fotki.yandex.ru/get/173476/158289418.3a9/0_16e47b_387b69ea_orig.jpg
https://img-fotki.yandex.ru/get/4800/158289418.21f/0_12eaf0_e27b038f_XL.jpg
https://img-fotki.yandex.ru/get/16102/158289418.21f/0_12eaef_1da5f0a8_XL.jpghttps://img-fotki.yandex.ru/get/16102/158289418.21f/0_12eaef_1da5f0a8_XL.jpghttps://img-fotki.yandex.ru/get/16102/158289418.21f/0_12eaef_1da5f0a8_XL.jpghttps://img-fotki.yandex.ru/get/16102/158289418.21f/0_12eaef_1da5f0a8_XL.jpg
https://img-fotki.yandex.ru/get/6700/158289418.25d/0_1424a4_87e72078_XL.jpg
https://img-fotki.yandex.ru/get/25232/158289418.2ab/0_14fa2e_5d6062fd_M.jpg https://img-fotki.yandex.ru/get/25232/158289418.2ab/0_14fa2e_5d6062fd_M.jpg

402

Re: Формы, механизмы, энергия наномира - 83

Эволюция фрактального самопрограммирования

В процессе эволюции добелкового мира возник белковый мир, основой которого стал генетический код. В процессе эволюции появился композиционный генетический код, управляющий рибосомой эукариот.

Структуры белков чем-то напоминают ячейки Бенара, т.е. однотипные элементы.

В процессе эволюции фрактального самопрограммирования возникают маловероятные, но функциональные структуры.

https://img-fotki.yandex.ru/get/195771/158289418.3a9/0_16e45e_5079e0c_orig.png
Протяженные прямые 310-спирали (показаны красной полосой),

https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_orig.png
Протяжённые альфа-спирали (показаны широкой красной полосой),

http://nanoworld88.narod.ru/data/288_files/0_85d09_8d7f6a3d_orig.gif
менее протяженные пи-спирали (показаны синим),

http://img-fotki.yandex.ru/get/6301/126580004.53/0_bcc39_20b9a5c1_orig.gif
и бета-спирали (показаны зеленым).

https://img-fotki.yandex.ru/get/3505/158289418.3a9/0_16e46d_b82fdb29_orig.png

http://nanoworld88.narod.ru/data/210_files/0_480da_7089f224_orig.gif
А так же их периодические комбинации.

Фрактальная архитектура белков имеет ярко выраженную аналогию с фрактальной архитектурой мегалитов.

http://nanoworld88.narod.ru/data/236_files/0_5123a_2284861d_orig.png
Подробнее: http://nanoworld88.narod.ru/data/236.htm

В структуре крупных белков прослеживается тот же фрактальный принцип.

https://img-fotki.yandex.ru/get/197102/158289418.3a8/0_16e35d_1aff86e7_XL.gif
Оригинал: https://img-fotki.yandex.ru/get/197102/ … 7_orig.gif
В середине структуры мы видим крупные спиральные блоки, а к обоим концам всё более мелкие.

http://nanoworld88.narod.ru/data/210_files/0_480e8_46d28a30_orig.gif http://nanoworld88.narod.ru/data/210_files/0_480df_c1431c83_orig.gif
Подробнее: http://nanoworld88.narod.ru/data/210.htm
Отдельной темой идут архитектурные и музыкальные перевертыши.

http://nanoworld88.narod.ru/data/025_files/1.gif
Шедеврами фрактальной белковой архитектуры являются многофункциональные квазиперевертыши, которые оптимально выполняют архитектурные, музыкальные и другие функции.

Именно невероятные комбинации кодов позволяют получить рекордные параметры. Вероятность случайного повторения 22 кодов прямой альфа-спирали не превышает 5.8*10^-14
Ничтожно мала вероятность случайного замыкания фрагмента лизоцима, состоящего из 22 аминокислотных остатков. Ничтожна вероятность образования 310-спирали, кодируемой 17-ю одинаковыми кодами. Ничтожна вероятность возникновения периодической структуры с циклическим повторением комбинации композиционных кодов.

403

Re: Формы, механизмы, энергия наномира - 83

http://www.rcsb.org/pdb/explore/explore … ureId=4PV1

http://www.uniprot.org/uniprot/P83792

https://img-fotki.yandex.ru/get/198613/158289418.3a9/0_16e477_b57dbc48_XL.png
Кушелев: По данным РСА это альфа-спиральный белок, т.е. там должны быть протяжённые альфа-спирали.

http://www.ebi.ac.uk/ena/data/view/AAR26243

http://www.ebi.ac.uk/ena/data/view/AAR2 … play=fasta

>ENA|AAR26243|AAR26243.1 Mastigocladus laminosus cytochrome b6f complex subunit IV
ATGGCAACACTTAAAAAACCAGACCTCAGCGATCCGAAGTTAAGAGCCAAACTGGCAAAG
GGCATGGGTCATAATTACTATGGTGAACCTGCATGGCCGAATGACTTGCTATACGTCTTT
CCCGTGGTAATTATGGGAACTTTTGCCTGTATAGTGGCTCTTTCCGTACTCGATCCGGCT
ATGGTGGGAGAACCAGCCGATCCGTTTGCCACACCTTTAGAAATTTTGCCAGAGTGGTAC
CTATATCCTGTCTTCCAAATTTTGCGTTCAGTTCCCAACAAGCTTTTGGGGGTTTTGTTA
ATGGCGTCCGTACCCCTAGGGCTAATTTTGGTTCCCTTCATTGAAAACGTTAATAAGTTC
CAAAATCCCTTCCGCCGCCCTGTAGCTACAACCATATTTTTATTTGGTACCCTAGTTACG
ATTTGGCTGGGTATTGGAGCTACTTTCCCCTTGGACAAAACACTTACCCTTGGCCTCTTC
TAA

https://img-fotki.yandex.ru/get/108697/158289418.3a9/0_16e476_9d4adb73_orig.gif

Как видим, данные РСА ошибочны. Это другой тип белка.

404

Re: Формы, механизмы, энергия наномира - 83

http://www.rcsb.org/pdb/explore/explore … ureId=4OGQ

http://www.uniprot.org/uniprot/P0A384

http://www.ebi.ac.uk/ena/data/view/CAC3 … play=fasta

>ENA|CAC39602|CAC39602.1 Nostoc sp. PCC 7120 cytochrome b6
ATGGCCAACGTTTACGACTGGTTTGAGGAACGCTTGGAAATCCAAGCAATTGCTGAAGAT
GTCACAAGCAAATACGTCCCTCCCCACGTCAACATCTTCTACTGCTTGGGTGGTATTACC
CTAGTTTGCTTTCTAATCCAGTTTGCCACTGGATTCGCTATGACGTTCTATTACAAGCCA
ACAGTTGCTGAAGCTTACTCCTCCGTTCAATACATTATGAACGAGGTAAACTTCGGTTGG
CTAATTCGCTCCATCCATCGCTGGTCTGCCAGCATGATGGTGTTGATGATGATTCTCCAC
GTCTTCCGCGTCTACCTAACTGGTGGTTTCAAAAAGCCCCGTGAATTAACCTGGGTAAGT
GGTGTGATCCTCGCTGTAATTACCGTTTCTTTCGGTGTTACAGGGTATTCTCTACCTTGG
GATCAAGTAGGTTACTGGGCTGTGAAAATCGTTAGTGGTGTACCAGAAGCGATTCCTGTA
GTCGGTGTACTCATCTCCGACCTACTGCGTGGTGGTTCCAGTGTTGGTCAAGCAACCCTG
ACCCGCTACTACAGCGCCCACACATTTGTACTACCTTGGTTGATTGCAGTATTTATGCTG
TTCCACTTCTTGATGATCCGCAAGCAAGGTATTTCCGGGCCTTTGTAA

https://img-fotki.yandex.ru/get/110545/158289418.3a9/0_16e479_a54b0a44_XL.png
Здесь мы снова видим протяжённые альфа-спирали по данным РСА

https://img-fotki.yandex.ru/get/145691/158289418.3a9/0_16e478_3abad27c_orig.gif
Альфа-спирали действительно есть, хотя длина их раза в два меньше заявленной специалистами по РСА.

405

Re: Формы, механизмы, энергия наномира - 83

Сходство и различие генетического кода с языком

В генетическом коде любая комбинация букв ACGT является осмысленной и соответствует конкретной структуре белковой молекулы. Те же последовательности могут использоваться для кодирования сигналов и других семантических объектов.

В языке осмысленные комбинации букв (слова) представляют малое подмножество всех комбинаций.

Например, случайное следование трёх одинаковых букв в слове "длинношеее" казалось бы имеет малую вероятность. (1/32)^3=0,00003 - три стотысячных. Это соизмеримо с величиной, обратной количеству осмысленных слов языка (0.00001). Однако есть слова, например, "обороноспособность", состоящие из 18 букв. Случайная комбинация имеет вероятность 8*10^-28. Таким образом множество осмысленных слов (10^5) меньше множества всех комбинаций 18-буквенных слов (10^28) на 28-5=23 порядка. Напомню, что число Авогадро = 6*10^23, т.е. величина того же порядка. Другими словами, размер множества осмысленных слов языка подобен атому в моле (множестве случайных комбинаций букв).

Я подвожу читателей к осмыслению того факта, что в процессе эволюции на каждом следующем её уровне достигаются всё менее вероятные комбинации элементов для достижения всё более экзотических параметров системы.

Степень экзотики - мера волшебства (С) А.Кушелев

https://img-fotki.yandex.ru/get/173476/158289418.3a9/0_16e47b_387b69ea_orig.jpg

406

Re: Формы, механизмы, энергия наномира - 83

Skype, 2016-12-25:

[11:15:31] Cириус (nsoc.ru): ЭТО ДЛЯ ВАС ПОДСКАЗКА , ТАК КАК снежэль В БУДУЩЕМ КУРАТОР ВАШЕГ ОПРОЕКТА , ТАК КАК ТВОРИЧНЕ КОНТУРЫ НООСФЕРЫ БУДУТ ОТКЛЮЧЕНЫ И ВСЕ МАНИПУЛИРУЮЩИЕ ЦИВИЛИЗАЦИИ ОТКЛЮЧЕНЫ .. ВАШ ПРОЕКТ СЕЙЧАС КОРРЕКТИРУЮТСЯ ПОД ВЕД-РУССОВ .
[11:16:53] Cириус (nsoc.ru): мОЖЕТЕ РАБОТАТ ЬС МОДУЛЕМ НА УРОВЕН СВОБОДНОГО ТВОРЧЕСКОГО ЭКСПЕРИМЕНТИРОВАНИЕ -МАТЕРИАЛ В ВИДЕ ДЕРЕВА ОБЕЗАТЕЛЕН , А ВОД СВЕТОВЙ КОД ,КОТОЫРЙ ВЫ ВИДИТЕ В ВИДЕ ГОЛОГРАММЫ ОБЕЗАТЕЛЕН , ДЛЯ ЗАКРЕПЛЕНИЕ НА ДЕРЕВЕ. ТАК КАК КОД СОЕДИНЯЕТ СО ВСЕМИ МАЯКАМИ зЕМЛИ И ДЕРЕВЬЯМИ зЕМЛИ. (ПРОЕКТ СИРИУСА)
[11:18:02] Cириус (nsoc.ru): КОД ПРОСТО ГОЛОГРАЧЯИЧЕСКАЯ ПРОЕКЦИЯ РЕАЛЬНОГО МОДУЛЯ АСТЕРОВ , КОТОРЫЕ ПОДКЛЮЧАЕТ ВАС НА МОДУЛЬНУЮ зЕМЛЮ АСТЕРОВ И ИНУЮ РЕШЕТКУ СО-ЗАННИЯ .
[11:18:16] Cириус (nsoc.ru): ПОЛЬЗУЙТЕСЬ КЛЮЧАМИ... КОТОРЫЕ МЫ ВАМ ДАЕМ.
[11:19:15] Кушелев Александр Юрьевич: Жду Вас на форуме: http://nanoworld.org.ru/post/80952/#p80952
[11:21:05] Cириус (nsoc.ru): А ВО ТСАМ КРЕСТ С КРИСТАЛЛОМ , ОН ЗАПУСТИТЬ ЛЮБУЮ ПРАВИЛЬНО С МОДЕЛИРОВАННУЮ ПОД НЕГО КОНСТРУКЦИЮ ... сЕЙЧАС МЫ ВСЕ ЦЕРКВИ ПЕРЕПОДКЛЮЧИЛИ В КАЧЕСТВЕ ЭКСПЕРИМЕНТА ПОД ЭТОТ МОДУЛЬНЫЙ РОДОВОЙ КРЕСТ астеров. сООТВЕТВЕННО ОН И ПОДПИТЫВАЕТ ВСЕ ВАШИ КОНСТРУКЦИИ . ЧАСТЬ КОТОРЫЕ КОРРЕКТНЫЕ .ЧАСТЬ ОШИБОЧНЫЕ.
[11:21:31] Cириус (nsoc.ru): https://vk.com/doc2000056786_440083370? … 7eb1fe11ee
[11:23:14] Кушелев Александр Юрьевич: Давно жду на форуме
[11:26:26] Cириус (nsoc.ru): МОДУЛЬ ВТОРОЙ ПСОЛЕ СИНХРОНИЗАЦИИ С ПЕРВЫМ ,
[11:26:40] Cириус (nsoc.ru): УЖЕ ДЯЛ СВЯЗИ С КРИСТАЛЛОМ
[11:27:13] Cириус (nsoc.ru):

https://img-fotki.yandex.ru/get/114207/158289418.3a9/0_16e47c_4807c3a2_XL.jpg
[11:28:41] Cириус (nsoc.ru): ВОКРУГ 8 КРИСТАЛЛООВ -НИТЕВИДНЫХ , СТАБИЛИЗАТОРОВ , ОНИ БЛОКИРУЮТ ИССКУСТВЕННЕО ЭЛЕКТРИЧЕСКОЕ ПОЛЕ И ФИЛЬТРУЮТ ЭНЕРГИЮ ПРЕОБРАЗОВЫВАЯ В ЖИДКО -КРИТСАЛИЧЕСКИЙ СВЕТ ИЛИ ЖИДКИЙ СВЕТ ..
[11:29:37] Cириус (nsoc.ru): ЭТ ОУЖЕ КРИСТАЛЛЫ БУДУЩЕГО , ПОКА ОНИ ВЫПОЛНЯЮТ ФУНКЦИИ ДИ-ЭЛЕТКРИКОВ.
[11:31:24] Cириус (nsoc.ru): Т ОЧТ ОВ ЗЕЛЕНОМ ТОРЕ - Это РУНА АЛУ . КОТОРАЯ СЫЗЫВАЕТ ВАС С ПРИРОДНЫМИ МОДУЛЯМИ. кОТОЫРЕ ЯВЛЯЕТСЯ ВСЯ СЕТЬ ДЕРЕВЬЕВ. пОЭТОМУ И ВАЖНО МОДУЛЬ СО-ЗДАВАТЬ -ИНИДИВИДУАЛЬНЫЙ , ЧЕРЕЗ МАТЕРИАЛ  ДЕРЕВО
[11:32:42] Cириус (nsoc.ru):

https://img-fotki.yandex.ru/get/196070/158289418.3a9/0_16e47d_14600581_XL.jpg
[11:33:06] Cириус (nsoc.ru): ДЕРЕВО ЯВЯЛЕТСЯ САМЫМ МОЩНЫМ БИО-МОДУЛЯТОРОМ
[11:38:46] Cириус (nsoc.ru): ЕСЛИ НАЧНЕТЕ РАБОТАТЬ , ВСЕ ДОСТИЖЕНИЯ , ЯВЛЯЮТСЯ ЧАСТЬ ВЕД-РУССКИХ ШКОЛ (ФОРМИРУЮЩИЕ КАЧЕСТВА РОДОВОГО ЕДИНСТВАА)   И СНЕжэль , КАК НОВЫЙ КУРАТОР ПРОЕКТА , ПО БИО-МОДУЛЯТОРАМ. поКА ВАМ ДАЮТСЯ ВОЗМОЖНОСТЬ ДЛЯ ЭКСПЕРИМЕНТИРОВАНИЯ ..
[11:41:34] Cириус (nsoc.ru): С САПФИРОВЫМИ КРИСТАЛЛАМИ РАБОТА -ДЛЯ ВАС БОЛЕЕ ПРЕДПОЧТИТЕЛЬНА, ХОТЯ МОЖЕТЕ ИСПОЛЬЗОВАТЬ И СВОЙ РУБИНОВЫЕ ЗАГОТОВКИ.
[11:47:45] Кушелев Александр Юрьевич: http://nanoworld.org.ru/post/80946/#p80946

407

Re: Формы, механизмы, энергия наномира - 83

http://www.rcsb.org/pdb/explore/explore … ureId=4KT0

http://www.uniprot.org/uniprot/P29254

https://img-fotki.yandex.ru/get/106972/158289418.3a9/0_16e484_89a857a8_XL.png

http://www.ebi.ac.uk/ena/data/view/CAA41629

http://www.ebi.ac.uk/ena/data/view/CAA4 … play=fasta

>ENA|CAA41629|CAA41629.1 Synechocystis sp. PCC 6803 P700 apoprotein subunit Ia  (PSA-A)
ATGACAATTAGTCCACCCGAAAGAGAGGCTAAGGCCAAAGTCTCGGTTGATAACAACCCG
GTACCAACTTCCTTCGAGAAGTGGGGCAAGCCGGGTCACTTCGACCGGACTTTAGCTAGA
GGTCCCAAAACCACCACTTGGATTTGGAATCTCCATGCCAATGCCCATGATTTTGATAGT
CAGACCAGCGATTTAGAAGATGTTTCGCGCAAAATCTTCAGTGCTCACTTTGGGCACCTC
GCTGTGGTCTTTGTTTGGTTAAGTGGAATGTACTTCCACGGCGCGAAATTTTCCAATTAC
GAAGGTTGGTTAGCCGACCCTACCCACATTAAACCCAGTGCCCAAGTGGTTTGGCCCATT
GTCGGTCAAGGCATCTTGAACGGGGATGTGGGCGGTGGCTTCCACGGTATTCAGATTACG
TCTGGCCTGTTTTATCTCTGGCGGGCCTCCGGTTTCACCGACAGCTATCAGCTCTACTGC
ACCGCCATTGGCGGTTTGGTTATGGCTGCCCTGATGCTGTTCGCTGGCTGGTTCCACTAC
CACGTCAAAGCTCCCAAATTGGAATGGTTCCAAAATGTGGAGTCGATGATGAACCATCAT
TTGGCTGGTTTGTTGGGCTTAGGCTCCTTGGGATGGGCGGGTCACCAGATCCACGTCTCC
ATGCCCATTAATAAACTTTTGGATGCTGGGGTTGCTCCTAAGGACATTCCCCTTCCCCAC
GAGTTTATTTTGGAACCGAGCAAGATGGCGGAACTCTACCCCAGCTTTGCCCAAGGTTTG
ACACCGTTCTTTACCCTCAACTGGGGAGTCTACTCAGACTTCCTCACCTTTAAAGGGGGA
TTGAATCCAGTCACCGGCGGCCTCTGGTTGTCTGATACCGCTCACCACCATTTGGCGATC
GCCGTCCTGTTCATCATTGCCGGTCATATGTACCGCACGAACTGGGGCATCGGCCATAGC
ATGAAAGAGATCCTCGAAGCCCACAAGGGCCCCTTCACTGGGGAAGGTCACAAAGGACTT
TATGAAATCCTGACTACTTCTTGGCACGCTCAATTAGCCATTAACCTCGCCCTGTTAGGT
TCTTTGACGATCATCGTTGCACAACACATGTATGCGATGCCGCCCTATCCCTACCAGGCG
ATCGATTACGCTACGCAGTTATCCCTGTTCACCCACCACATGTGGATTGGCGGCTTCCTC
ATCGTAGGGGCCGGTGCCCATGGCGCCATCTTCATGGTGCGTGATTATGATCCCGCCAAG
AACGTTAATAACTTGCTGGATCGGATGCTGCGCCACCGTGACGCCATCATTTCCCATCTC
AACTGGGTATGTATTTTCCTCGGCTTCCATAGCTTCGGTCTCTACATCCACAACGACACC
ATGCGGGCTTTAGGCCGTCCCCAGGACATGTTCTCCGACACGGCCATCCAACTGCAACCG
ATCTTTGCCCAATGGGTACAGCACCTGCACACCTTGGCCCCCGGAGCCACCGCTCCCAAT
GCCTTGGCCACTGCCAGCTATGCCTTTGGCGGAGAAACCATTGCCGTTGCCGGTAAAGTC
GCCATGATGCCCATCACCCTGGGTACTGCCGACTTCATGGTTCACCACATCCACGCTTTT
ACCATCCACGTAACGGCCCTGATCCTCCTCAAAGGGGTTCTATATGCCCGTAGCTCTCGC
CTTGTCCCTGATAAAGCGAATCTCGGTTTCCGTTTCCCCTGTGATGGCCCCGGCCGCGGC
GGCACCTGCCAAGTATCTGGTTGGGACCACGTTTTCCTCGGTCTGTTCTGGATGTACAAC
TCCCTTTCCATCGTCATCTTCCACTTCAGTTGGAAAATGCAATCCGATGTTTGGGGTACC
GTTTCTCCCGATGGCAGTGTCACCCATGTGACCCTAGGTAACTTTGCCCAGAGTGCCATC
ACCATCAATGGCTGGTTGCGGGACTTCCTCTGGGCCCAAGCCGCCAACGTCATCAACTCC
TACGGTTCCGCCCTGTCGGCCTATGGCATCATGTTCCTCGCCGGACACTTTGTCTTTGCC
TTCAGCCTCATGTTCCTGTTCAGTGGACGGGGATATTGGCAAGAGTTGATCGAGTCCATT
GTCTGGGCTCACAACAAACTGAATGTGGCTCCGGCCATTCAACCCCGCGCTTTGAGCATC
ATTCAAGGTCGTGCGGTCGGTGTAGCGCACTATCTCCTCGGAGGTATTGTTACCACCTGG
GCGTTCTTCCTCGCCCGCAGTCTTTCCATTGGCTAG

https://img-fotki.yandex.ru/get/172931/158289418.3a9/0_16e483_56610941_XL.gif
Оригинал: https://img-fotki.yandex.ru/get/172931/ … 1_orig.gif

408

Re: Формы, механизмы, энергия наномира - 83

http://www.rcsb.org/pdb/explore/explore … ureId=4ENZ

>ENA|AAA51976|AAA51976.1 Homo sapiens (human) hypothetical protein
ATGAAGATTTTGATACTTGGTATTTTTCTGTTTTTATGTAGTACCCCAGCCTGGGCGAAA
GAAAAGCATTATTACATTGGAATTATTGAAACGACTTGGGATTATGCCTCTGACCATGGG
GAAAAGAAACTTATTTCTGTTGACACGGAACATTCCAATATCTATCTTCAAAATGGCCCA
GATAGAATTGGGAGACTATATAAGAAGGCCCTTTATCTTCAGTACACAGATGAAACCTTT
AGGACAACTATAGAAAAACCGGTCTGGCTTGGGTTTTTAGGCCCTATTATCAAAGCTGAA
ACTGGAGATAAAGTTTATGTACACTTAAAAAACCTTGCCTCTAGGCCCTACACCTTTCAT
TCACATGGAATAACTTACTATAAGGAACATGAGGGGGCCATCTACCCTGATAACACCACA
GATTTTCAAAGAGCAGATGACAAAGTATATCCAGGAGAGCAGTATACATACATGTTGCTT
GCCACTGAAGAACAAAGTCCTGGGGAAGGAGATGGCAATTGTGTGACTAGGATTTACCAT
TCCCACATTGATGCTCCAAAAGATATTGCCTCAGGACTCATCGGACCTTTAATAATCTGT
AAAAAAGATTCTCTAGATAAAGAAAAAGAAAAACATATTGACCGAGAATTTGTGGTGATG
TTTTCTGTGGTGGATGAAAATTTCAGCTGGTACCTAGAAGACAACATTAAAACCTACTGC
TCAGAACCAGAGAAAGTTGACAAAGACAACGAAGACTTCCAGGAGAGTAACAGAATGTAT
TCTGTGAATGGATACACTTTTGGAAGTCTCCCAGGACTCTCCATGTGTGCTGAAGACAGA
GTAAAATGGTACCTTTTTGGTATGGGTAATGAAGTTGATGTGCACGCAGCTTTCTTTCAC
GGGCAAGCACTGACTAACAAGAACTACCGTATTGACACAATCAACCTCTTTCCTGCTACC
CTGTTTGATGCTTATATGGTGGCCCAGAACCCTGGAGAATGGATGCTCAGCTGTCAGAAT
CTAAACCATCTGAAAGCCGGTTTGCAAGCCTTTTTCCAGGTCCAGGAGTGTAACAAGTCT
TCATCAAAGGATAATATCCGTGGGAAGCATGTTAGACACTACTACATTGCCGCTGAGGAA
ATCATCTGGAACTATGCTCCCTCTGGTATAGACATCTTCACTAAAGAAAACTTAACAGCA
CCTGGAAGTGACTCAGCGGTGTTTTTTGAACAAGGTACCACAAGAATTGGAGGCTCTTAT
AAAAAGCTGGTTTATCGTGAGTACACAGATGCCTCCTTCACAAATCGAAAGGAGAGAGGC
CCTGAAGAAGAGCATCTTGGCATCCTGGGTCCTGTCATTTGGGCAGAGGTGGGAGACACC
ATCAGAGTAACCTTCCATAACAAAGGAGCATATCCCCTCAGTATTGAGCCGATTGGGGTG
AGATTCAATAAGAACAACGAGGGCACATACTATTCCCCAAATTACAACCCCCAGAGCAGA
AGTGTGCCTCCTTCAGCCTCCCATGTGGCACCCACAGAAACATTCACCTATGAATGGACT
GTCCCCAAAGAAGTAGGACCCACTAATGCAGATCCTGTGTGTCTAGCTAAGATGTATTAT
TCTGCTGTGGATCCCACTAAAGATATATTCACTGGGCTTATTGGGCCAATGAAAATATGC
AAGAAAGGAAGTTTACATGCAAATGGGAGACAGAAAGATGTAGACAAGGAATTCTATTTG
TTTCCTACAGTATTTGATGAGAATGAGAGTTTACTCCTGGAAGATAATATTAGAATGTTT
ACAACTGCACCTGATCAGGTGGATAAGGAAGATGAAGACTTTCAGGAATCTAATAAAATG
CACTCCATGAATGGATTCATGTATGGGAATCAGCCGGGTCTCACTATGTGCAAAGGAGAT
TCGGTCGTGTGGTACTTATTCAGCGCCGGAAATGAGGCCGATGTACATGGAATATACTTT
TCAGGAAACACATATCTGTGGAGAGGAGAACGGAGAGACACAGCAAACCTCTTCCCTCAA
ACAAGTCTTACGCTCCACATGTGGCCTGACACAGAGGGGACTTTTAATGTTGAATGCCTT
ACAACTGATCATTACACAGGCGGCATGAAGCAAAAATATACTGTGAACCAATGCAGGCGG
CAGTCTGAGGATTCCACCTTCTACCTGGGAGAGAGGACATACTATATCGCAGCAGTGGAG
GTGGAATGGGATTATTCCCCACAAAGGGAGTGGGAAAAGGAGCTGCATCATTTACAAGAG
CAGAATGTTTCAAATGCATTTTTAGATAAGGGAGAGTTTTACATAGGCTCAAAGTACAAG
AAAGTTGTGTATCGGCAGTATACTGATAGCACATTCCGTGTTCCAGTGGAGAGAAAAGCT
GAAGAAGAACATCTGGGAATTCTAGGTCCACAACTTCATGCAGATGTTGGAGACAAAGTC
AAAATTATCTTTAAAAACATGGCCACAAGGCCCTACTCAATACATGCCCATGGGGTACAA
ACAGAGAGTTCTACAGTTACTCCAACATTACCAGGTGAAACTCTCACTTACGTATGGAAA
ATCCCAGAAAGATCTGGAGCTGGAACAGAGGATTCTGCTTGTATTCCATGGGCTTATTAT
TCAACTGTGGATCAAGTTAAGGACCTCTACAGTGGATTAATTGGCCCCCTGATTGTTTGT
CGAAGACCTTACTTGAAAGTATTCAATCCCAGAAGGAAGCTGGAATTTGCCCTTCTGTTT
CTAGTTTTTGATGAGAATGAATCTTGGTACTTAGATGACAACATCAAAACATACTCTGAT
CACCCCGAGAAAGTAAACAAAGATGATGAGGAATTCATAGAAAGCAATAAAATGCATGCT
ATTAATGGAAGAATGTTTGGAAACCTACAAGGCCTCACAATGCACGTGGGAGATGAAGTC
AACTGGTATCTGATGGGAATGGGCAATGAAATAGACTTACACACTGTACATTTTCACGGC
CATAGCTTCCAATACAAGCACAGGGGAGTTTATAGTTCTGATGTCTTTGACATTTTCCCT
GGAACATACCAAACCCTAGAAATGTTTCCAAGAACACCTGGAATTTGGTTACTCCACTGC
CATGTGACCGACCACATTCATGCTGGAATGGAAACCACTTACACCGTTCTACAAAATGAA
GACACCAAATCTGGCTGA

https://img-fotki.yandex.ru/get/198017/ … a_orig.gif

https://img-fotki.yandex.ru/get/195125/158289418.3a9/0_16e486_704d1c9a_orig.png
Интересная спираль...

409

Re: Формы, механизмы, энергия наномира - 83

http://www.rcsb.org/pdb/explore/explore … ureId=4DP0

https://img-fotki.yandex.ru/get/168237/158289418.3a9/0_16e487_dda6633_XL.png

http://www.uniprot.org/uniprot/P11970

http://www.ebi.ac.uk/ena/data/view/CAA90565

>ENA|CAA90565|CAA90565.1 Populus nigra plastocyanin b precursor
ATGGCCGCTGTCACCTCTGCTGCTGTTTCTATCCCATCTTTCACCGGTCTTAAGGCAGCC
AGTGCCTCCAATGCCAAAGTCAGTGCCAGTGCCAAGGTTTCAGCCTCTCCACTTCCAAGG
CTCAGCATCAAGGCTTCATTGAAAGAAGTCGGTGCTGCTGTTGTCGCCACCGCTGCTAGC
GCAATGATTGCTAGCAATGCTATGGCCGTTGACGTCTTGCTTGGAGCTGATGATGGATCA
TTGGCTTTTGTTCCCAGCGAATTCTCTGTACCCGCTGGTGAAAAGATTGTCTTCAAGAAC
AATGCCGGGTTCCCACATAACGTTCTCTTCGACGAGGACGCTGTTCCAAGTGGGGTTGAT
GTGTCAAAAATCTCCATGAGCGAGGAGGATCTCCTCAACGCCAAAGGAGAGACTTTCGAA
GTTGCCTTGAGCGACAAAGGTGAATACACTTTCTACTGTTCTCCTCACCAGGGAGCTGGC
ATGGTGGGAAAAGTGATCGTTAATTAA

https://img-fotki.yandex.ru/get/49312/158289418.3a9/0_16e488_a7458bdf_orig.gif

Из 6 альфа-спиралей РСА "увидел" лишь две smile

410

Re: Формы, механизмы, энергия наномира - 83

http://www.rcsb.org/pdb/results/results … d=2CE1097B

http://www.rcsb.org/pdb/explore/explore … ureId=3AZC

https://img-fotki.yandex.ru/get/168237/158289418.3a9/0_16e489_c498b50a_XL.png

http://www.uniprot.org/uniprot/P0C8N8

http://www.ebi.ac.uk/ena/data/view/BAC08511

>ENA|BAC08511|BAC08511.2 Thermosynechococcus elongatus BP-1 cytochrome b6-f complex iron-sulfur subunit
ATGGCTCAAGTTTCTGGAATGTCTGATGTGCCCGATATGGGGCGGCGACAGTTTATGAAT
CTGCTGACGTTTGGTACCATCACTGGTACAGCGTTGGGTGCCCTCTATCCTGTCGTCAAG
TATTTTATTCCACCCGCCAGTGGCGGCACGGGGGGTGGTGCGGTTGCCAAGGATGCTTTG
GGCAACGATATTAAGGTTTCCGAGTATCTCGCAAAGCATTTGCCGGGCGATCGCTCCCTC
GCCCAAGGGATTAAAGGAGATCCCACCTACGTGATTGTTACTGAAGATCACCAAATTGCC
AATTACGGCTTGAATGCCGTCTGCACTCACCTGGGTTGTGTCGTACCTTGGAATGTGAGT
GAAAACAAATTCATTTGTCCTTGCCACGGCTCCCAATACGATAGCACCGGTAAAGTAGTG
CGTGGTCCTGCTCCCCTGTCCTTGGCACTGGTGAAGGCCACGGTTACAGAAGATGACAAA
CTGGTGTTTACCCCCTGGACGGAAATTGATTTCCGCACAGGCAAAGAACCTTGGTGGACG
TAA

https://img-fotki.yandex.ru/get/55231/158289418.3a9/0_16e48a_b333b936_orig.gif

Из 11 участков 310-спиралей РСА "увидел" только одну и то показал промежуток между спиралями...