51

Re: Формы, механизмы, энергия наномира - 103

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_003: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>LGKD01598758.1:c428-1 Octopus bimaculoides isolate UCB-OBI-ISO-001 Scaffold202981_contig_1, whole genome shotgun sequence
AGTAGATGGATTTCAAATAGATGGATTGCAAGTTGATGGGTCACAAGTTGGTGAGTCTCAAGTTGGTGGG
TCGCAAGTTGGTGGGTCGCAAGTTGATGGGTCACAAGTTGGTGAGTTGCAAATTGATGGATCGCAAGTTG
ATGGATTGCAAGTTTATGGATCACAAATTGATGAGTCACAAGTTGAAGGATCACAAGTTGAAGGATCACA
AGTTGAAGGACCACAAGTAGATGAATCACAAGTTGATGGGTCTCAAATAGATAGATTGCAAGTTGATGGG
TCACAAGTTGGTGGGTCACAAGCTGGCGGGTCACAAGTTGAAGGATCACAAGCTGAAGGATCACAAGTTG
ATGAAAGACAAGTTGATGAAACACAAGTAGGTAGGTCACAGGTAGATGGATCACATAAAGATGAGCCACA
AGTGGATA

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/M-tvlmRDC157yA

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/fdhyF8zRbmMJxQ

Слушать(MIDI): https://yadi.sk/d/-S2Ef2NWIx6-Xg

Программная 222727-спираль, 6-дольный музыкальный размер, ритм коллагена.

52

Re: Формы, механизмы, энергия наномира - 103

FaceBook:

Александр Кушелев: Юрий Немцов, Разговор о зарплате не имеет принципиального значения. Главное - сойтись в цене на разработку. Сколько Вы готовы вложить в разработку новой механической части 3D принтера? По Вашей сумме мы узнаем, какой это процент от международной стандартной величины на подобные разработки. И дальше можно будет определить Ваш процент долевого участия. Если Вы будете согласны на получившееся долевое участие, то работаем. Свою долю я могу распределить между собой и тем соинвестором, который обеспечит необходимые статьи расходов.

Юрий Немцов: Александр Кушелев, сначала с продажникам надо изучить рынок, что бы оценить: А) возможную маржу и Б) возможные риски. После этого можно уже решать вкладываться в этот проект и какими суммами. Если моих свободных средств не хватит, то у меня есть друзья у которых всегда есть свободные средства для инвестиций. Правда они мелкими проектами не занимаются. У них минимальная программа вложений от 500.000$

Александр Кушелев: И никого из них не интересует создание новой энергетики и транспорта, внедрения уже созданной пикотехнологии белков и возвращение молодости. Я правильно Вас понимаю?
Что касается изучения рынка, то безусловно Вам решать, но будет странно, если 3D принтер новой конструкции, который делает распечатки того же качества, но стоит раза в 2 дешевле будут покупать хуже, чем того же качества, но вдвое дороже. Я таких исторических примеров не знаю. А Вы?

53

Re: Формы, механизмы, энергия наномира - 103

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_004: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>XM_001612896.1 Plasmodium vivax Phist protein (Pf-fam-b) (PVX_003535), partial mRNA
atggatggcaacttatgtggtcgtggatgctcccatggtggttcgggaaggagcagttcc
tccttagtagcgaataagagcaattttaaaaatcgttgcactcgttcattagagcagggg
agtaaaatcattacaggtagaatctgtacaaaggttgcaaggtctagaatatttattttg
ttttttctaacccttttgaatctctttttacaaaatacgtactacacaaatgaagagggg
aaatcattttccaaattagaattaagcatcggtggatgttccaggaaattagcattagct
gaaataagacaactgagggaaagtgccactttagctagactggctcttaaaaaagaagat
agtgatcatttgaggaagtacaaagaagatttttacaagagaatggaagaaaggttgaaa
caagtaggcccagacccgttacccaattgtttgaaaaagggggataaaattactacagta
aaaaaaaaaatgcagtttgtagagccggaagagataatccagaaagggaaaacttcgaac
aggacaatgctgaaagtgaaatttgaggagcaaaatgagatggagaaaaatgagatggag
aaaaatgaaatggggaaaaatgagaaggggaaaaatgagatggggaaaaatgagaagggg
aaaaatgagatggggaaaaatgagatggggaaaaatgggaaggggaaaaatgagatgggg
aaaaatgagatggggaaaaatgggaaggggaaaaaagggaaagaaaaagatgagaaagag
aaagaagaagctcccgtggacccaatgaagcatttgaggaatgaaaaaaataaaataatg
actacagcggagttgaaaaaaaaatatgatgacattttgtacaaacatataagcaaagaa
gaaatgaaggaaattatggattccattgaagccagtgattatgataatataaggcgaagt
aagaatgtcgtttataacgaggatgataatgaccaattgccatatgattgtacgatgaga
gagattagtgagaagattacagaagattttttaagtgagatgactgcagaactacggaag
gttgtaagcccaaaggacatgtttataatctggcattatgttcaggcttttggaagagat
aaatatttaaggatgaatggggatttgtggagattgtgtggacatgtgcagaaggaatat
aacataccagatgacattaaaaaaagagaatggcaagaaatcgctggctacatgtcaagt
gagttactggataaggaacacaaagattatttagattttaaagaattagctaataaggga
tcctgcaaaaaatccaagttttacgaatttatagattctaaaaggagttcgtggaaattc
ttaacggctataatgatggattcgtggaaggaggcattaattgagagactaaaaagttac
agcatagaagaggagtaa

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/E8ZoHvGwhaDMyQ
Развернуть: https://yadi.sk/i/z5UTNWTr7K7a2g
Слушать(MIDI): https://yadi.sk/d/ICq7Hn9NjR5Lsg

Программная 44477-спираль ...

54

Re: Формы, механизмы, энергия наномира - 103

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_004: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>XM_001612896.1 Plasmodium vivax Phist protein (Pf-fam-b) (PVX_003535), partial mRNA
atggatggcaacttatgtggtcgtggatgctcccatggtggttcgggaaggagcagttcc
tccttagtagcgaataagagcaattttaaaaatcgttgcactcgttcattagagcagggg
agtaaaatcattacaggtagaatctgtacaaaggttgcaaggtctagaatatttattttg
ttttttctaacccttttgaatctctttttacaaaatacgtactacacaaatgaagagggg
aaatcattttccaaattagaattaagcatcggtggatgttccaggaaattagcattagct
gaaataagacaactgagggaaagtgccactttagctagactggctcttaaaaaagaagat
agtgatcatttgaggaagtacaaagaagatttttacaagagaatggaagaaaggttgaaa
caagtaggcccagacccgttacccaattgtttgaaaaagggggataaaattactacagta
aaaaaaaaaatgcagtttgtagagccggaagagataatccagaaagggaaaacttcgaac
aggacaatgctgaaagtgaaatttgaggagcaaaatgagatggagaaaaatgagatggag
aaaaatgaaatggggaaaaatgagaaggggaaaaatgagatggggaaaaatgagaagggg
aaaaatgagatggggaaaaatgagatggggaaaaatgggaaggggaaaaatgagatgggg
aaaaatgagatggggaaaaatgggaaggggaaaaaagggaaagaaaaagatgagaaagag
aaagaagaagctcccgtggacccaatgaagcatttgaggaatgaaaaaaataaaataatg
actacagcggagttgaaaaaaaaatatgatgacattttgtacaaacatataagcaaagaa
gaaatgaaggaaattatggattccattgaagccagtgattatgataatataaggcgaagt
aagaatgtcgtttataacgaggatgataatgaccaattgccatatgattgtacgatgaga
gagattagtgagaagattacagaagattttttaagtgagatgactgcagaactacggaag
gttgtaagcccaaaggacatgtttataatctggcattatgttcaggcttttggaagagat
aaatatttaaggatgaatggggatttgtggagattgtgtggacatgtgcagaaggaatat
aacataccagatgacattaaaaaaagagaatggcaagaaatcgctggctacatgtcaagt
gagttactggataaggaacacaaagattatttagattttaaagaattagctaataaggga
tcctgcaaaaaatccaagttttacgaatttatagattctaaaaggagttcgtggaaattc
ttaacggctataatgatggattcgtggaaggaggcattaattgagagactaaaaagttac
agcatagaagaggagtaa

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/E8ZoHvGwhaDMyQ
Развернуть: https://yadi.sk/i/z5UTNWTr7K7a2g
Слушать(MIDI): https://yadi.sk/d/ICq7Hn9NjR5Lsg

Программная 44477-спираль ...

55

Re: Формы, механизмы, энергия наномира - 103

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_005: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>KI635767.1:c593972-592932 Plasmodium yoelii 17X unplaced genomic scaffold supercont2.52, whole genome shotgun sequence
ATGCAAGATCATTTTTTTAATGGAAAATTTAACATTTTTAATGGAACTCTTTTTGGCAATCTGTGCAAAA
TAAATGCGAATCAATATAAAGGAAAAGATTCAGAATCTGTAGAATTAAAAGATGATATCCATCTTAGAAG
TAGAAATGATAAAAACAAAAGTACACAAAACTTGGCACTGGAAGAAACTGACTCAAATATATTAAGTTAT
GGTAATGCAGAAAAAATAAAAAAAAATTTAAATTCGCAACTCATTTATTCGTATTACAACAATTTTGCAA
CAAACAAATATATCGAATATGGCCCAGATCAAAAGGGTGTAAAAAATATGCACACGTATAGACACAATGA
TAGTGAATATGGCAAGAGTGAATATGGCAAGAGTGAATATGGCAAGAGTGAATATGGCAAGAGTGAATAT
GGCAAGAGTGGATATGGAAAGAATGGCTACGGCACGAATGAATGTGGCAAGAATACACATTTAAGGAACG
TAGACAGAATTAACAACTATAATCTAAATTTAAATAATAAAGCAATAAATAAGCAATCGAATTATGAACA
TATAAAAAATAATAATAAAAATGAATCATTATTTTTTAAAGAAGATAATACAATTTATAATGAATTTAAA
AATCTAAAAAATGATATATTAGAATTACAAATTATGAATGTAAATTTACAGAAACAATTTTTAACTAGCC
ATATTTTAAATAATTCAAATGCAATACCACAACATATAATAATAAATAATAAAACTGAAGTAGCTTCAAA
TTCTCTTACTCAACTTGAAAATAACAATAATAATAATAATAATAATAACAAAAAAAAAAAAGGTCTTATT
TATTTTTTATTAAAAAAAATACTAAGCAGTAAAATAAATCAAATGCTTATTGTATCATCTTTTTTTATTT
CAATTTATATTGCTCACAAACATTGGCAACGTGCACTAAAAATAGCGGAAATCCAATCTAAAGTAAATTC
TAATTTTATTTTAAAAACTGTCAAAACGATAGAGGAGATGGTAGGAATTCGAAATCGGTAG

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/E9-rI2DEtr3fbw
Развернуть: https://yadi.sk/i/QNPrmdtZfawt2w
Слушать(MIDI): https://yadi.sk/d/4B_XU7vVjhEcTg

Программная 55777-спираль ...

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_006: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>XM_018268919.1 PREDICTED: Xenopus laevis spermidine/spermine N(1)-acetyltransferase-like protein 1 (LOC108719761), mRNA
atgcgtagtaaacagacgagtctgtactccagccccatctatgtgtataggaagccaagt
aggaaacagccaagtaggaaacagccaagtaggaaacagccaagtaggaaacagccaagt
aggaaacagccaagtaggaaacagccaagtaggaaacagccaagtaggaaacagccaagt
aggaccagccaagtaggaaacagccaagtaggaaacagccaagtagaaaacagccaagga
ggaaacagccaaggaggaaacagccaaggaggaaacagccaaggaggaaacagccaagta
ggaaacagccaagtaggaaacagaaaacagccaagtaggaaacagccaaggaggaaacag
ccaaggaggaaacagccaaggaggaaacagccaagagggaaacagccaagagggaaacag
ctaagagggaaacagctaagagggaaacagccaaggaggaaacagccaagtaggaaacag
ccaagtaggaaacagccaagtaggaaacagccaagtaggaaacagctaagtaggaaacag
ccaagaaggaaacagccgagtaggaaacagccaagtaggaaacagccaagaaggaaacag
ccgagtaggaaacagctaagaaggaaacagccaagtgggaaacagctcagtaggaaatag

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/KMYvn2IbLSJzHw
Развернуть: https://yadi.sk/i/6zcvCXLYof5vuQ
Слушать(MIDI): https://yadi.sk/d/usejUVBsUd7ZGw

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_007: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>KOB71615.1
atggcattggacaagcaaatgatgttgagtgaactgggcagcgtgatgaataaactgcagagtgctgatt
ggctcggcaagcgtccacaagcgcaagcacgcagacgcgcgaattccgaagaatgcgcgcgtctttttat
aatctcagaagtaattggttgcatggaaaagctattctccaaccaaggtcactcaaacccaggagcccaa
ggcggtgcagtaacgggaagtcagctaccaacttgtggcggatgtcgccgcggatgttgccacggccatg
ggtatggcagccagagttatggatgtagcgctccatgcgctggtgagccctactccgcgaacagcccatg
catgggcaatatgggcatgcagtgcaaccctcccaaactgtacgcagacacttataattacttaagctca
aatcttatgaagccggttgttcaagaagtttacgaagatctgaaatccatcaaccctggcaatgcagttg
tgaacaatcccattgctagtcagatgggactgcaacagcaaggtggaggagctgctatgcaaggaaacat
gcccattactcaaaatcaaatgccaggaagtaacatgggtgatcaacaaatgggttatcaacaaatgggt
tatcagcaaataggtaatcaacaaatggtaaatccacaaatgggtactcaacagatgggtactcaacaaa
tgggtaatcaacaaatgggtaaacagcaaatgggttatcaacatatggataatcaacaaattggtactca
acaaatgggtaatcaacaaatgggtgatcaacaaatgggttatgaacaaatgggttatgaacaaatgggt
tatgaacaaatgggtaatcaacaaatgggttatcaacaaatggataatcaacaaattggtaagcaacaaa
cgggtaaacaacaaatgggaaatcaacaaatggcgcagatgatggatggcatggggccaaatatcgtgaa
catgatgctgaactattcaaaccctgctgctcaacaaatggcatcaaacaatggtcaaaaatacggccaa
cataccccaggattaacaaagttcaacgaaatgttcccaggcgtaatgggtggcatggatggaggcctcg
actttgatccaatggctatagctttgcaaatgaatccagccaatcagcaacaagctgctatgaatcaaat
gcaaaagataatgaatgggaatcgaacaacacagcctccaacgataggtactaatgctgctcaagctgcg
attaatcagccacctgttaatcaacagcatattcctccgtccaaccagcaaccgatgccagtccagcccg
tagcaacacaacaaaacctacaacaaggttatacaaatgtagcgaatcaaccttatcaatcacctgagca
agtttacgggcaagttccgcaacagcaaaaccagacaccccaacaatatcagcagcagcagaatgtggat
ccaaatgctcagcaatatcaacagcaacaacataatgtagatccaaatgcgcaagcgatggtggatccca
atctcccaactccttacggaggaatgagtacaggtcctaacacggaacattaccagatgccgccacagag
ctacagtgcacctccaccaggacaacaaatgaccaaagagccaatattgcctgcggacctttccaagaac
caacctcctcctcacatgaaatatcggaggaattacgaatacaatacgctcggacagccggtcgagatgc
atccagctagactgtaccgtccagagcccgatactcatactcaacaaacattatctccacaacctgtgac
gaaacttaggaatgaccacgctagattcggtgtgaaaaataccgtcagcaagacttcactgatgggaagt
aggcctgttgggagaactcctagcagaggtcaactgcagcaaatatacaaccaatacaaaggctcccaat
cttatactgagcaaaatatcagacctgctcaaggtgctactttctcggaaggaaagatcaacgtcgcttt
ggcgaacgcaaaccagcgccgccacgtgccggtagagagagttgcaggcgattctttagcgaataaccag
atggccaacagtcaagttccagtcaaaggtcaacctatggggcataccggtgacgtggctgtggataacc
agccacatggagatattccggagccagtgctcaaaaagtgccgtaatggacttcaagacatcgtgttcac
gtcgtatccatcttcagcggcgtggtcttttcatggtaataacaaccagccacggtttttacgtgctcga
tga

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/MeIkvs0fmhDqow
Развернуть: https://yadi.sk/i/NkCLavtxHc-U8A
Слушать(MIDI): https://yadi.sk/d/gUjR8_z7tjh6uQ

57777-спираль

56

Re: Формы, механизмы, энергия наномира - 103

Формы, механизмы, энергия наномира. Сообщение 103 056

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_008: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>AYPS01005575.1 Helicosporidium sp. ATCC 50920 contig-5575, whole genome shotgun sequence
gcaaggatgaggttggcaaggatgaggctggcaaggatgaggttggcaaggatgaggctg
gcaaggatgaggttggcaaggatgaggctggcaaggttttgccagcctcatcttga

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/frTM7kuagf7UHA

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/OAhGRtAv3KAytw
Слушать(MIDI): https://yadi.sk/d/FyKoVWYuDSg3Vw

1611216142-спираль

57

Re: Формы, механизмы, энергия наномира - 103

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_009: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>XM_020698601.1 PREDICTED: Sesamum indicum kinesin-like protein KIN-14P (LOC105176049), mRNA
atggatcgagaaggaaaagattgtgctagattcaataactcgagcttttccagcaatagt
gatatatttgaacccccttcaagtaacaatgctaagcagcgggcaactttgatagaatgg
ttaaatagcactcttgatctaagtttgccaataaatgcttcagatgaagaattgcgagca
ttcttggttgatggatctatcttgtgtcaaatactaaacaaactaaaacccggttcggta
actgagtgtggtggatcagttcatactccaaaatcacggttgggaaatgtccaaagattt
ttgtcagcaatggatgaaatggggttgccaaggtttcaggcagcagacctggaaaagggg
tctatgaaaattgtcttggactgccttttaacactacaaacacagttcatgaatattggg
aggtctaggagtgatcccagttcaagatggaaattattaggtgagcgcccagtaactggg
gatactcttccaagggaagaatcccctcgatttctctcttccccaccatttggagaagac
aagaagaagttagtaatagactcaaagtttcagcgtgcattgcgtagtcgcacaatgaca
gattcatcagctgcccttataaatcatgtgggtcataagtttcatgaggtcttccaactt
aaacaaggatcttatacggatcttcctgctgcaaagatttcagaaatgatgaaatcaaac
agcttagataatgctccgactcagtcactattaagtgttgtcaatggtattttagatgaa
agcattgagcggaagagtggagcaatacctcatcgtgttgcttgcctattgagaaaagtt
gtgcaggagattgagagacggatatgtactcaagcagaacatttgcgaacgcaaaataat
ctttttaaggcacgtgaggaaaagtaccaatcaagaattagagtgcttgaagcccttgca
acagggactagcgaagagacacagattgttatgaaccaactccaacagcttaagagtgag
aagaacaaaatagaagaaagaaagagagtggaggaacaagatgtgttaagactaataaaa
gagaaagatgacctcaatcaagagatagcaaatttgatgcaagagctggaaatagctagg
agttcgtatgaacaagaatcctcgaaaatgaaacatgaaactggaggagttgaagctaca
ggagctgaagttggaggaactaaagttgaaggagctgaagctggaagagctgaagctgga
ggagctgaagttggaagagctgaagctggaggagctgaagttggaagagcagaagctgga
ggagctgaagttggaaaagcagaagctggaggagctgaagttggaagagcagaagctgga
ggagctgaagttggaagagcagaagctggaggagctgaagttggaagagcagaagcaaga
gcagaagctggaggagctgaagttggaggagctgaagttagaagagctgaagctggagga
gctaaagttggaagagcagaagctggaggagctgaagttggaagagctgaagctggagga
gctgaaattggaagagctgaaggaagaatagctgaagtcggaatagctgaagctggagga
gctgaagatggaagagctgaagctggaagagctgaatttagaactgctgaagctggaaga
gctgaacaagaacttgagaataggttgaaggaagttgaaggctcgctaatggagtcaaga
aatagagtgaatgaagttgaaggattgctaatggagtcaagaaatagagtaaaggaagtt
gaaagtgcgctaatggagtcaagaaatagagtaaaggaagttgaaagtgcgttaatggag
tcaagaaatagagtgaatgaatttgaaagcgcgctaacggagtcaagaaatagagtcaag
gaagttgaaagtgcgctaatggagtcaagaaatggagtgaatgaatttgaaagtgcgcta
acggagtcaagaaatagagtgaaggaatttgaaagctcactaatggaatcaagaaataga
gtgaacgaagttgaaagcgctctatcggagtcaagaaataaagtgaaggaagttgaaagc
ttgctaatggagtcaagaaacagagagaaggagcttgaggcaatctcagaatcaaaatct
gaaagctggagcaagaaagaaaacatttaccacatattcacagattttcagcttggcgca
ttacgtgaactaaggttcgcatctcagtctatccagcaagaaattgtgaggacaaagaaa
agctattcagaaggcttcagtactttagggtcaagaatcaaggtcctagacgatgcagcc
aaaaactattattcactccttgctgaaaatcgaaagttacataatgaactacaagagtta
aaaggaaatattagggtctattgtcggatacggccatttcttccaggccaaaaagggaaa
caatcaattgttgaatacattggtgaaaatggagagctaatagttgtgaatccggccaaa
caagggaaagaaggacgtcgttcgtttaagttcgataaagtgtatggtccaacagcaaca
caagctgaagtattttcagatacacaaccattaatacaatcagttttggatgggtataat
gtgtgtatatttgcctacggtcagactggttcaggcaaaacctatacaatgactggccct
gacggagcaactgaagaggactggggggtcaactacagagctttaaacaatcttttccgc
atttcacaaagtcgacagagcagttttacatatgaagtttccgtccagatggtcgaaata
tataatgaacaagttcgtgatttgctgtcaagtgatggtacacagaaaaaaacacttggg
atttctaccgcgaaacccaatggcttggcagtcccagatgcttccgttcaagcagttaac
tcaacctcagatgtcttggaactaatggatattggactaaagaatagagctaaaagctct
actgccttaaatgaaagaagtagtagatcacacagtgttgtctccattcatgcccgtggt
gtggatctaaagagtggttcttcattgcgagggagtcttcatttagtagatcttgcagga
agtgaaagagtagaccgttcagaggtaacaggagacagacttaaagaggcacaacatata
aataaatcattatctgcacttggagatgttatatttgctttatcacaaaagaatgctcat
gttccgtaccggaacagcaagttgactcaagtcctccagagctcgttaggtggtcaggca
aagacacttatgtttgtgcagcttaatcctgatgttagttcctatagtgaaaccttaagt
actttaaaatttgctgaaagggtctccggagttgagttgggtgcagcaaaaagcagcaag
gacggtagggacgtaagggagttgatggagcaggttgcgtctctgaaagaggctatagcg
aagaaagacgacgagatagagacgctgcagctgcataaagatcccaaaactgcggtataa

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/ul3MNKlLxLS2Cg
Развернуть: https://yadi.sk/i/2FCEQ9u0vuqYxA
Слушать(MIDI): https://yadi.sk/d/QA8L6AJ45PB5AA

Спираль 22777 с вариациями (эволюционирующая)

58

Re: Формы, механизмы, энергия наномира - 103

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_010: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>NC_027707.1:c173910-173662 Salmon gill poxvirus, complete genome
ATGACACCCGTTACAAATAGTAAAAGTAGTAGCATTGACATGTTGTCACTTTTTTTTACAATATGTAAAG
GAATGTGTCCGATACCTGTCAGGTATTTTTATTTCATTTCTGGTAAAAGTCAATCTGGTAAAAGTCAATC
TGGTAAAAGTCAATCTGGTAAAAGTCAATCTGGTAAAAGTCAATCTGGTAAAAAGGTTCATGTGGGAAAC
TTACACTTGGGAAACTTACACTGTAATAAAAAAATATAG

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/TETWLGlPO_4wcQ

Развернуто:

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/UKCF1NgnIZFkrw
Слушать(MIDI): https://yadi.sk/d/jsmQtVv8Ov77SA

59

Re: Формы, механизмы, энергия наномира - 103

Ответ из института белка

FaceBook:

Александр Кушелев: Если с помощью этого конструктора удастся оперативно создать точную трехмерную модель интересующего специалистов белка, то они начнут брать дополнительные коммерческие заказы, которые смогут выполнить с помощью лаборатории Наномир. И тогда "всё завертится по полной программе" smile

леонид дегтярев: Почти год прошел когда вы писали в институт им. Курчатова !!! И что они решили ??? То что я вам говорил ранее в диалоге с вами.

Александр Кушелев: Курчатовский занимается чисто рентгеном. Поэтому их технология определения структуры белка не заинтересовала. Точнее не их, а конкретного специалиста. Видимо её устраивает её работа и менять ничего не хочется. Так работает большинство... В Институте белка один специалист прямо мне сказал, что его структуры белков вообще не интересуют. А профессор заинтересовался. Вот мы и работаем сейчас с ним. Если его проблему удастся оперативно решить, то он начнет брать дополнительные коммерческие заказы, и всё завертится по полной программе.

60

Re: Формы, механизмы, энергия наномира - 103

Формы, механизмы, энергия наномира. Сообщение 103 060

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-11-14_011: GKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQIGKSQI

>PGOL01007770.1:c3269-1 Punica granatum strain AG2017 PG007770, whole genome shotgun sequence
atccaaggatgggactcggcctggggaagatctaacgatgggattcggcccaacgaaaga
tcaaaggttgggactcggcccagggggagatctaacgatgggactcagccctacggaaga
tcaaaggttgggactcgtccctgggggagatctaacgatgcgactcggccctacgaaagt
tcaaaggatgggactcggccctgggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactccgccctgtgggagatctaacgatgggactcgaccctacggaaga
tcaaaggttgggactcagcccagggggagatctaacgatgggactcggccctacggaaga
tcaaaggttgggactcggccctgtgggagatctaacgatgcgactcggccctacggaaga
tcaaaggttgggactccgcccagggggagatctaacggtgggactcggccctacggaaga
tcaaaggttgggactcggctctgggggagatctaacgatgagactcggccctacgaaaga
tcaaaggatgggactcggcccagggggagatctaa

DNE файл: https://yadi.sk/d/hTZpqPhd_l78XQ

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/nDFBwgyC-6zzOA
Развернуть: https://yadi.sk/i/K9jwT9lakQ0zAA
Слушать(MIDI): https://yadi.sk/d/UIhJRsRH669gyw

Программная спираль строится в 40-дольном музыкальном размере.

Структуры белков такого типа могут наглядно продемонстрировать триумф пикотехнологии белков.

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/X2zaTRlKbAPevw

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/AqNvNU1_DMpjKg

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/02o8pb1oj0DUCg

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/YWhzsoqRaw5E3w

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/5cDhg4KlmVkmRQ

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/RbV-Te2qx0hyPw
Полновесная анимация (avi, 63Mb): https://yadi.sk/i/cdixlJKwoI9Eyw

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/tRyTwNarkCi-CA
Полновесная анимация (avi, 27Mb): https://yadi.sk/i/g9qzgoDeH12mMA

PDB: https://yadi.sk/d/rFWdCW65J-5ODQ

Обратите внимание на пары радикалов лизина (Lys):

https://getfile.dokpub.com/yandex/get/https://yadi.sk/i/5HfOhuQjG2jr7Q

Напомню, как выглядит пикотехнологическая модель ДНК:

http://nanoworld88.narod.ru/data/237_files/0_4e1a8_e8302c5f_M.gif