151

Re: Формы, механизмы, энергия наномира - 100

ИЩУ ИНВЕСТОРА

Главный инвестор D: Перевел Вам ***** рублей
Кушелев: Благодарю!

152

Re: Формы, механизмы, энергия наномира - 100

X-ray diffraction analysis does not help determine the structure of these proteins, even for a trillion dollars

Формы, механизмы, энергия наномира. Сообщение 88 042

Пикотехнология белков, ДНК, РНК - 3

Online service PROTEIN PICOTECHNOLOGY

Human Genome Protein Structure

You can get the structure of any protein here and now.
The first 100 orders for the account of Nanoworld Laboratory.
For example, in this form:

Order.

https://www.ncbi.nlm.nih.gov/nuccore/749158428

Закажите структуру белка сейчас! Первые 1000 заказов за счёт лаборатории Наномир.

Для заказа достаточно опубликовать в этой теме ссылку на кодирующую нуклеотидную последовательность интересующего Вас белка. Например, в таком виде:

Заказ.

https://www.ncbi.nlm.nih.gov/nuccore/749158428

или так:

https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

Можно просто задать саму последовательность:

atgcccggaatgatggccattaactcagggactggtggacccatgtctggtggtcccatg
tctggtggtcccatgtccggtggccccatgtccggtggtcccatgtccggtggccccatg
tccggtagtcccatgcctggtggtcccatgtccggtggtcccatgtccggtggtcccatg
cctggtggtcccatgtctggtggacccatgccgtacaaccaacaaggaatgatgggccca
ggaatgttcatgaatcccgcccaggtaccgccaggggtcatgcatccaggagcgatgcat
ggaatgccgccgggcatgatgcagatggccgggatgtcatctcagggcgggccgttgggt
ccaatgagcataggctccggcggccacctcggaggcatgggccagccgggcggaggaggc
tccaatacaatgggcatgatgcaagccatggggcaaggtccgggatcgaaccacggacct
atggctaaccgcatgcccccaggccagatgccgggaccgggccaaatgccccctggaccg
ggtcaaatgccccctggaccaggtcaaatgccacctggaccgggtcaaatgcctcctggg
cccagtcctggccagctgcctcctggatccggtgcaggacagcagcagtcgtcgggcggc
caacagcccacttcaggccagcccaatggttcgcagcaggggggaacggcgagtccttct
ggaatggtgacgccgaacatgaacggagggaaccccactccgcccgctcaggacggtcag
cgatttcctttctcagtggaggcacggcggttcgcagtggagtcctttacaggtactggt
cggtgcaactttaacaaggccgcgctcaaaaagggatcggaatgcttcttcatggatcga
cgagtacgcaaactatgtccggttttaacgcacgctccggttgaacgcacactgatgaat
accctacacaaataa

Результат, т.е. вторичная структура белка будет опубликована в этой же теме в таком виде:

https://img-fotki.yandex.ru/get/218038/158289418.408/0_1789ea_a6723a52_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/117896/ … 6_orig.png

Если интерес заказчика возрастёт, и он захочет увидеть третичную структуру, то буду пробовать определить и её, хотя 3D-версия Пикотех пока до конца не настроена. Тем не менее, для большого класса белков она показывает адекватные модели.

Сервис постоянно совершенствуется, поэтому результаты будут улучшаться.

"Нет предела совершенству" smile

http://img-fotki.yandex.ru/get/5506/126580004.42/0_b37ab_6493b0b7_S.gif http://img-fotki.yandex.ru/get/9116/158289418.af/0_ae267_2d0606e3_orig.gif

Цены по старой технологии: http://nanoworld.org.ru/topic/1702/

***
For our overseas friends.

Что такое программа "Пикотехнология белков", и как её грамотно использовать

kushelev20120@yandex.ru
2D and 3D protein structures up to the picometer
The Picotech program can not completely replace  X-ray structural analysis. However, it greatly strengthens the weakest points of the X-ray diffraction, namely, it shows reliably the secondary structure and the short-range order of the arrangement of the atoms of the tertiary structure at the time of assembly of the protein molecule by the ribosome.
The sensitivity of X-ray structural analysis is such that it does not notice not only individual atoms, but also individual amino acid residues. Moreover, the "tails" of protein molecules that do not crystallize, the PCA generally "does not see", and these "tails" can consist of up to 50 amino acid residues.
A special class is formed by 97% of protein molecules that do not crystallize. About them, the PCA simply does not know anything, and the Picotech program also reliably shows their secondary structure and short-range order of the arrangement of atoms in the tertiary structure.
Your application must contain only the code of the protein of interest to you from the PDB database, or mRNA for it
We will model your protein complex with ligands of any nature
The lead time for the order is 1-7 days, depending on the complexity of the project.
Digest https://picosoft.nethouse.ru/
Online service PROTEIN PICOTECHNOLOGY  http://nanoworld.org.ru/topic/1699/

***
Human Genome Protein Structure

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

153

Re: Формы, механизмы, энергия наномира - 100

[12:01:42] *****: а вот на сколько % встреча завершится положительно для нас - открытая тема
[12:03:35] Кушелев Александр Юрьевич: Ты вроде бы говорил, что вопрос уже решенный, а оказывается решен только вопрос встречи? smile
[12:05:25] Кушелев Александр Юрьевич: Ты объясни потенциальному инвестору, что двигатель, аналогичный тому, что Кушелев показывал по центральному ТВ в 1992-ом году, китайцы в 2017-ом испытали на околоземной орбите. Поэтому проект включения источника энергии к этому двигателю предлагается от создателя Emdrive.
[12:06:11] Кушелев Александр Юрьевич: Источник энергии - вторая половина Emdrive, который подтвержден в независымих лабораториях разных стран.
[12:07:05] Кушелев Александр Юрьевич: А пикотехнология вообще уже создана. Здесь нужно продвижение готовой технологии на международный рынок.
[12:08:52] Кушелев Александр Юрьевич: Ну и не забудь про самый интересный проект, возвращение молодости, что уже экспериментально подтверждено на лабораторных животных, но для обычных животных и людей требует прочтение кода микро-РНК.

154

Re: Формы, механизмы, энергия наномира - 100

[12:12:59] Кушелев Александр Юрьевич: Здесь можно убедиться, что цена определения структуры белка по старой технологии в среднем 10 000 евро: http://nanoworld.org.ru/topic/1702/

https://img-fotki.yandex.ru/get/3214/158289418.424/0_17ad16_4f161f18_orig.jpg

155

Re: Формы, механизмы, энергия наномира - 100

Skype, 2018-07-11:

[30.06.2018 17:18:06] Потенциальный инвестор: Я не понял до конца, какая сумма нужна. Вроде вы говорили о 500.
[30.06.2018 17:19:17] Кушелев Александр Юрьевич: 500 долл стоит только материал для изготовления резонатора, который я буду пытаться включить ударом.
[30.06.2018 17:24:00] Кушелев Александр Юрьевич: Но для того, чтобы его обработать, мне нужно, чтобы функционировала моя лаборатория. А для этого мне нужно оплатить аренду помещения за июнь и июль первого числа и погасить долг за электричество. Кроме этого нужны лекарства и еда. Главный инвестор, который платил мне зарплату последние 5 лет, не может заплатить ни за июнь, ни за июль. У него финансовые затруднения. Поэтому я в настоящее время готовлю договора с тремя потенциальными инвесторами. Кто из них первый подтвердит серьезность своих намерений, с тем и заключу первый, наиболее выгодный для инвестора договор.
[30.06.2018 17:37:11] Кушелев Александр Юрьевич: Сумму, подтверждающую серьезность намерений устанавливает совет инвесторов. Первого июля, т.е. завтра эта сумма увеличится в три раза. С 1000 до 3000 евро.
[06.07.2018 15:42:00] Потенциальный инвестор: Добрый день! Скажите, что с другими инвесторвами?
[06.07.2018 15:42:01] *** Пользователь Потенциальный инвестор хочет внести вас в свой список контактов Skype ***
[06.07.2018 15:42:13] Потенциальный инвестор: Также я бы хотел приехать к вам в лабораторию.
[06.07.2018 19:02:36] Кушелев Александр Юрьевич:  C 1 июля благтворительный взнос, подтверждающий серьёзность намерений потенциального  инвестора увеличился с 1000 евро до 3000 евро.
[06.07.2018 19:03:32] Кушелев Александр Юрьевич: "30.06.2018: Сумму, подтверждающую серьезность намерений устанавливает совет инвесторов. Первого июля, т.е. завтра эта сумма увеличится в три раза. С 1000 до 3000 евро."
[18:16:37] Потенциальный инвестор: Я бы хотел к вам в лабораторию приехать.
[18:16:37] *** Пользователь Потенциальный инвестор хочет внести вас в свой список контактов Skype ***
[18:24:18] Кушелев Александр Юрьевич: C 1 июля благтворительный взнос, подтверждающий серьёзность намерений потенциального  инвестора увеличился с 1000 евро до 3000 евро.
"30.06.2018: Сумму, подтверждающую серьезность намерений устанавливает совет инвесторов. Первого июля, т.е. завтра эта сумма увеличится в три раза. С 1000 до 3000 евро."

156

Re: Формы, механизмы, энергия наномира - 100

Kushelev пишет:

Кто из них первый подтвердит серьезность своих намерений, с тем и заключу первый, наиболее выгодный для инвестора договор.

Вы же ранее говорили, что "для всех инвесторов условия одинаковы". А тут на тебе: самый выгодный договор. Ай яй яй.

157

Re: Формы, механизмы, энергия наномира - 100

aest пишет:
Kushelev пишет:

Кто из них первый подтвердит серьезность своих намерений, с тем и заключу первый, наиболее выгодный для инвестора договор.

Вы же ранее говорили, что "для всех инвесторов условия одинаковы". А тут на тебе: самый выгодный договор. Ай яй яй.

Кушелев: Мои условия для всех инвесторов одинаковы, но речь идёт о времени, а оно для всех инвесторов разное. И чем раньше инвестор начинает финансировать проект, тем ему выгоднее. Естественно, если он не бросит финансирование.

158

Re: Формы, механизмы, энергия наномира - 100

Kushelev пишет:
aest пишет:
Kushelev пишет:

Кто из них первый подтвердит серьезность своих намерений, с тем и заключу первый, наиболее выгодный для инвестора договор.

Вы же ранее говорили, что "для всех инвесторов условия одинаковы". А тут на тебе: самый выгодный договор. Ай яй яй.

Кушелев: Мои условия для всех инвесторов одинаковы, но речь идёт о времени, а оно для всех инвесторов разное. И чем раньше инвестор начинает финансировать проект, тем ему выгоднее. Естественно, если он не бросит финансирование.

Все равно непонятно. Что значит первый, самый выгодный договор ? По вашим словам вам договор вообще не нужен, достаточно слова. Есть инвесторы, которые финансируют вас давно, получается с ними как бы уже давно есть договор, пусть на словах. А тут первый договор вдруг становится самым выгодным (к чему вы вообще так пишите ?). Мухлюете вы что-то.

159

Re: Формы, механизмы, энергия наномира - 100

Футурсы Кушелева

Кушелев: Что такое фьючерсы, можно прочесть в википедии.

Футурсы Кушелева отличаются от фьючерсов новой формой оформления договора. Вместо обычной процедуры, которая реализована на бирже, новый способ оформления договора реализован прямо на форуме.

Каждый покупатель футурсов Кушелева может лично зарегистрировать приобретение футурса на форуме лаборатории Наномир. Гарантией подлинности является публичность, т.е. каждый читатель может сохранить резервную копию данной темы и убедиться в будущем, что оригинал темы не изменен.

Как юридически оформить приобретение футурсов Кушелева, решат юристы. А мы пока обсудим цены...

Единицы футурсов - ватты, киловатты, мегаватты...

1 Вт - 1 рубль
1 кВт - 100 рублей
1 МВт - 10 000 рублей
1 ГВт - 1 000 000 рублей
1 ТВт - 100 000 000 рублей

При необходимости таблицу цен можно продолжить.

Цены фиксированы по курсу рубля на 2018-07-12.

Первый футурс Кушелева можно будет приобрести сразу после решения юридических вопросов.

Все инвесторы, меценаты и спонсоры могут перевести свои вклады в форму футурсов Кушелева.

160

Re: Формы, механизмы, энергия наномира - 100

aest пишет:

Есть инвесторы, которые финансируют вас давно, получается с ними как бы уже давно есть договор, пусть на словах. А тут первый договор вдруг становится самым выгодным (к чему вы вообще так пишите ?).

Кушелев: Первый - имеется в виду относительно следующего. По абсолютной нумерации он конечно же не первый. Что касается "самый выгодный", то речь идёт о том, что максимальное число прав у активного инвестора, который сделал максимальный вклад. Следующий инвестор может сделать вклад ещё больше, но ... он не сможет сделать его раньше предыдущего инвестора. Поэтому его коэффициент индексации будет меньше коэффициента индексации инвесторов, которые начали финансирование раньше. А пассивные инвесторы, хотя они и раньше начали финансирование, имеют меньше прав, чем активные.

Отсюда следует, что самый выгодный контракт у первого АКТИВНОГО инвестора.

Мои-то условия одинаковы, но условия финансирования инвесторов разные. И я придумал, как это учесть с помощью коэффициента финансовой активности.

Инвесторы не будут финансировать автора, который бросил свою работу. Верно?
Я, как автор комплексного проекта Наномир мог бы тоже сразу прекращать выполнять обязательства перед инвесторами, которые бросили финансирование проекта. Но я придумал, как смягчить условия для инвесторов, т.е. дать им дополнительный шанс восстановить финансирование в течение года. Правда, этот срок, вероятно, придется сократить, т.к. слишком мягкие условия для инвесторов их расслабляют, и лаборатория Наномир может прекратить своё существование из-за отсутствия финансирования даже на уровне порога существования лаборатории. Так что с первого августа, если одобрит совет инвесторов, интервал уменьшения коэффициента финансовой активности будет сокращен с  12 до 2 месяцев. Это примерно такой же срок, сколько человек может прожить без еды до точки невозврата, т.е. летального исхода.

Не успел поесть за 2 месяца, значит ... не судьба smile

http://frs24.ru/img/zt/01_2.jpg
Поголодал больше 60 дней, получи летальный исход.