1

Тема: Human Genome Protein Structure

Human Genome Protein Structure: https://subscribe.ru/archive/science.ne … 1148.html/

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

***

Формы, механизмы, энергия наномира. Сообщение 93 950

Human Genome Protein Structure

За всю историю развития науки и техники определено около 100 000 белковых структур (половина неправильно). На это истрачено более миллиарда USD.

https://img-fotki.yandex.ru/get/107080/158289418.3c1/0_1705b1_dc9f55fd_M.gif https://img-fotki.yandex.ru/get/169883/158289418.3b3/0_16f622_63ae0418_M.gif
Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.

Ещё 4 белковых фрагмента из разных организмов: http://nanoworld88.narod.ru/data/586.htm

https://img-fotki.yandex.ru/get/967052/158289418.4ba/0_18a39b_9a313e96_orig.png

***

База белковых структур "Human Genome Protein", расположенная по этим адресам:

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

содержит структуры всех белков человека, для которых известна нуклеотидная последовательность:

https://img-fotki.yandex.ru/get/894414/158289418.4b5/0_189a97_82a0444c_orig.png

Примеры вторичных структур белка:

https://img-fotki.yandex.ru/get/516365/158289418.4bb/0_18a4d0_ab03a1c9_orig.png
В компактном виде.

Эта же структура в развернутом виде:

https://img-fotki.yandex.ru/get/893753/158289418.4b7/0_18a055_f5f116d2_orig.png

Обозначения:

https://img-fotki.yandex.ru/get/893194/158289418.4bb/0_18a4d1_dd90eb8a_orig.jpg

В геноме человека встретились гигантские белки с невероятной структурой. Белки-"монстры":

https://img-fotki.yandex.ru/get/373339/158289418.4bb/0_18a3fa_79817ce3_XL.pnghttps://img-fotki.yandex.ru/get/362196/158289418.4ba/0_18a32c_892dc87b_XL.png

https://img-fotki.yandex.ru/get/768433/158289418.4bb/0_18a407_6515a742_L.pnghttps://img-fotki.yandex.ru/get/362196/158289418.4bb/0_18a473_a8dfa65d_L.png

Структуры гигантских белков в компактном виде.

***

https://img-fotki.yandex.ru/get/516365/158289418.4b7/0_189ecf_13af3e92_S.png https://img-fotki.yandex.ru/get/879536/158289418.4b7/0_189f2f_d2a84234_S.png https://img-fotki.yandex.ru/get/877700/158289418.4b7/0_18a065_70b30230_S.png https://img-fotki.yandex.ru/get/914553/158289418.4b7/0_18a069_6ec5aef6_S.png
https://img-fotki.yandex.ru/get/876984/158289418.4b7/0_18a06c_288cc96f_S.png https://img-fotki.yandex.ru/get/874316/158289418.4b8/0_18a070_5b715cbf_S.png https://img-fotki.yandex.ru/get/874316/158289418.4b8/0_18a073_e57bd51_S.png https://img-fotki.yandex.ru/get/896349/158289418.4b9/0_18a0fd_f166188_S.png

https://img-fotki.yandex.ru/get/897810/158289418.4b8/0_18a0ba_e3f74559_orig.png

https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_XL.jpg

2

Re: Human Genome Protein Structure

https://www.facebook.com/permalink.php? … 4556101331

https://img-fotki.yandex.ru/get/880375/158289418.4bc/0_18a4d8_fe8ec8ea_orig.jpg

https://subscribe.ru/archive/science.ne … 1148.html/

3

Re: Human Genome Protein Structure

Формы, механизмы, энергия наномира. Сообщение 94 022

Фрактальные структурные/архитектурные перевертыши

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-01_01:

Монстр третьей хромосомы

Monster of the third chromosome

>NP_060876.5 fragment
atg
acccctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccat
cccttccgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggt
caggccacctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtca
ctagcacttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccac
aggtcacgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcct
gtcactagcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtat
ccacaggtcacaccacccctcttcatgtcactgatgcttcctcagcatccacaggtcaggccacccctct
tcctgtcaccagcctttcctcagtatccacaggtgacaccacgcctcttcctgtcactagcccttcctca
gcatccacaggtcacgccacccctcttcttgtcaccgacacttcctcagcatccacaggacacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacagatcacgccacctctcttcctgtaaccatcccttc
cgcagcatccacaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtcaggcc
acctctcttcttgtcaccgacacttcctcagtatccacaggtgacaccacgcctcttcctgtcactagca
cttcctcagcatccacaggtcacgtcactcctcttcatgtcaccagcccttcctcagcatccacaggtca
cgccacccctcttcctgtcaccagcctttcctcagcatccacaggtgacaccatgcctcttcctgtcact
agcccttcctcagcatccacaggtgacaccacccctcttcctgtcaccgacgcttcctcagtatccacag
gtcacaccacccctcttcctgtcaccagcccttcctcagcatctacaggtcacaccacccctcttcctgt
caccgacacttcctcagcatccaaaggtgacaccacccctcttcctgtcaccagcccttcctcagcatct
acaggtcacaccacccctcttcctgtcaccgacacttcctcagcatccacaggtgacaccacccctcttc
ctgtcaccaatgcttcctcattatccacaggtcacgccacccctcttcatgtcaccagcccttcctcagc
atccacaggtcacgccacccctcttcctgtcaccagcacttcctcagcatccaccggtcacgccacccct
cttcctgtcaccggcctttcctcagctaccacagatgacaccacccgtcttcctgtcaccgacgtttcct
cggcatccacaggtcaggccacccctcttcctgtcaccagcctttcctcagtatccacaggtgacaccac
gcctcttcctgtcactagcccttcctcagcatccacaggtcacgccagccctcttcttgtcactgacgct
tcctcagcatccacaggtcaggccacccctcttcctgtcaccgacacttcctcagtatccacagctcacg
ccaccccacttcctgtcaccggcctttcttcagcttccacagatgacaccacccgtcttcctgtcaccga
cgtttcctcggcatccacaggtcaggccatccctcttcctgtcaccagcccttcctcagcatccacaggt
gacaccacccctcttcctgtcaccgacgcttcctcagcatccacaggtgacaccacctctcttcctgtca
ccatcccttcctcagcatcttcaggtcacaccacctctcttcctgtcaccgacgcttcctcagtgtccac
aggtcacgccacctctcttcttgtcaccgacgcttcctcagtatccacaggtgacaccacccctcttcct
gtcaccgacactaactcagcatccacaggtgacaccacccctcttcatgtcaccgacgcttcctcagtat
ccacaggtcacgccacctctcttcctgtcaccagcctttcctcagcatccacaggtgacaccacgcctct
tcctgtcactagcccttcctcagcatcctcaggtcacaccacccctcttcctgtcaccgacgcttcctca
gtacccacaggtcacgccacctctcttcctgtcaccgacgcttcctcagtgtccacaggtcacgccaccc
ctcttcctgtcaccgacgcttcctcagtgtccacaggtcatgccacccctcttccggtcaccgacacttc
ctcagtatctacaggacaggccacccctcttcctgtcaccagcctttcctcagcatccactggtgacacc
acgccgcttcctgtcaccgatacttcctcagcatccacaggtcaggacacccctcttcctgtcaccagcc
tttcctcagtatccacaggtgacaccacgcctcttcctgtcactaacccttcctcagcatccacaggtca
cgccacccctcttcttgtcaccgacgcttcctcaatatccacaggtcacgccacctctcttcttgtcacc
gacgcttcctcagtatccacaggtcacgccaccgctcttcatgacaccgatgcttcctcattatccacag
tga

Результат:

https://img-fotki.yandex.ru/get/508799/158289418.4bc/0_18a503_a013567f_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a504_b4065481_XL.png
Оригинал: https://img-fotki.yandex.ru/get/900241/ … 1_orig.png

3D модель:

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a502_98c45a81_XL.png

Кушелев: Мы видим фрагмент "монстра" третьей хромосомы, который по существу является ... фрактальным структурным (архитектурным) перевертышем! Его структура возвращается не только на фрактальном уровне вторичной структуры, но и на фрактальном уровне программной спирали! Тут уже о случайных совпадениях не может быть и речи, т.к. вероятность случайного образования фрактального перевертыша такого размера порядка 4^-900 = 10^-540, т.е. ноль целых и 540 нулей после запятой smile

4

Re: Human Genome Protein Structure

Формы, механизмы, энергия наномира. Сообщение 94 030

Программирование многоуровневых фракталов в Геноме человека

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 аминокислотных остатков).

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

5

Re: Human Genome Protein Structure

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 АО)

Скрипт Кушелева, с помощью которого был построен фрагмент "монстра" первой хромосомы человека.

-- Monster of the first human chromosome (fragment. 4500 amino acids)
-- Nanoworld Lab. Alexander Kushelev
-- http://nanoworld.org.ru
p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,3,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,
1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,
4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,
1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,
3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,
1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,
3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,
3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,
1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,
3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,
4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,
3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,
1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,
1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,
3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,
3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,
3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,
1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,
2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,
3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,
3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,
3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,
1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,
3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,
3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,
3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,
2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,
3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,
3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,
1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,
4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,
3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,
1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,
1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,
3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,
2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,
1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,
3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,
2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,
1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,
1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,
1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,
3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,
1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,
3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,
1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,
3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,
1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,
2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,
3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,
3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,
1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,
1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,
1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,
1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,
2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,
1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,
1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,
3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,
3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,
3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,
1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,
3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,
3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,
1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,
1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,
3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,
3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,
3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,
2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,
3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,
3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,
2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,
1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,
3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,
3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,
1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,
3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,
4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,
4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,
1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,
3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,
1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,
1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,
1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,
1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,
3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,4,4,1,3,4,3,1,3,3,1,3,1,1,2,4,3,2,3,3,3,
3,4,2,1,1,3,3,2,3,1,2,1,1,1,1,3,3,4,3,1,2,3,1,3,1,1,1,1,1,1,3,1,4,1,3,1,3,3,3,1,4,4,2,3,1,1,4,4,1,1,
1,2,1,2,1,2,3,0)
peptide = box length:1 width:1 height:1  position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 4500 do(
element = box length:1 width:1 height:1 pos:[0,0,0]; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

6

Re: Human Genome Protein Structure

Программирование многоуровневых фракталов в Геноме человека

Что такое программа "Пикотехнология белков", и как её грамотно использовать?

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 033

3D модель "монстра" первой хромосомы (фрагмент, первые 4500 АО)

https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

Кушелев: 3D модель "монстра" первой хромосомы хороша тем, что её можно проверить, рассматривая молекулу белка в подходящий микроскоп. Дело в том, что "Монстр" первой хромосомы такой крупный, что его просто видно в микроскоп в отличие от мелких белков. В частности, диаметр начальной фрактальной петли (правая часть) примерно 100 нанометров,  т.е. 0.1 микрона. Такие объекты можно увидеть даже в флуоресцентный микроскоп.

7

Re: Human Genome Protein Structure

Формы, механизмы, энергия наномира. Сообщение 94 081

3D модель "монстра" первой хромосомы (5207 АО)

https://img-fotki.yandex.ru/get/476282/158289418.4bc/0_18a56a_5930b399_orig.gif

Скрипт Кушелева, с помощью которого был построен фрагмент "монстра" первой хромосомы человека.

-- Monster of the first human chromosome (5207 amino acids)
-- Nanoworld Lab. Alexander Kushelev
-- http://nanoworld.org.ru
p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,3,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,
1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,
4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,
1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,
3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,
1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,
3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,
3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,
1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,
3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,
4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,
3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,
1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,
1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,
3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,
3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,
3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,
1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,
2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,
3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,
3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,
3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,
1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,
3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,
3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,
3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,
2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,
3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,
3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,
1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,
4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,
3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,
1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,
1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,
3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,
2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,
1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,
3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,
2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,
1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,
1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,
1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,
3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,
1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,
3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,
1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,
3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,
1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,
2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,
3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,
3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,
1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,
1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,
1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,
1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,
2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,
1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,
1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,
3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,
3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,
3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,
1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,
3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,
3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,
1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,
1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,
3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,
3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,
3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,
2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,
3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,
3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,
2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,
1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,
3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,
3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,
1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,
3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,
4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,
4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,
1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,
3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,
1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,
1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,
1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,
1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,
3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,4,4,1,3,4,3,1,3,3,1,3,1,1,2,4,3,2,3,3,3,
3,4,2,1,1,3,3,2,3,1,2,1,1,1,1,3,3,4,3,1,2,3,1,3,1,1,1,1,1,1,3,1,4,1,3,1,3,3,3,1,4,4,2,3,1,1,4,4,1,1,
1,2,1,2,1,2,3,0)
peptide = box length:1 width:1 height:1  position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 4500 do(
element = box length:1 width:1 height:1 pos:[0,0,0]; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

https://img-fotki.yandex.ru/get/373339/158289418.4bb/0_18a3fa_79817ce3_XL.png
Оригинал: https://img-fotki.yandex.ru/get/373339/ … 3_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/370744/158289418.4bc/0_18a569_fd9446b9_XL.png
0.25 от оригинала: https://img-fotki.yandex.ru/get/370744/ … 9_orig.png
Оригинал: https://cloud.mail.ru/public/8gC2/mkhM3wWW4

https://img-fotki.yandex.ru/get/9494/158289418.4bc/0_18a589_4694862e_orig.gif

Настройки одного из 5 композиционных углов по одной из трёх составляющих заняла около двух часов:

https://img-fotki.yandex.ru/get/371487/158289418.4bc/0_18a588_ce47e849_orig.gif
Настройка 5 композиционных углов по 3 составляющим может занять около 30 часов. Однако это не имеет смысла, т.к. в реальном белке композиционные и транспозиционные (это ещё столько столько же степеней свободы) на разных участках белка разные. А третий угол Pro - ещё одна степень свободы, которая без учета физико-химических взаимодействий тоже представляет собой неопределенность.

8

Re: Human Genome Protein Structure

Формы, механизмы, энергия наномира. Сообщение 94 143

Human Genome Protein Structure

Кушелев: Попробуем построить 3D модели "троицы" первой хромосомы человека:

https://img-fotki.yandex.ru/get/1025946/158289418.4bb/0_18a474_648e2282_orig.png

https://img-fotki.yandex.ru/get/876523/158289418.4bc/0_18a962_a44c8df6_XL.png

https://img-fotki.yandex.ru/get/4106/158289418.4bc/0_18a963_ac8cd3b8_orig.gif

https://img-fotki.yandex.ru/get/509739/158289418.4bc/0_18a964_d2fb51d6_XL.png

И "троицы" шестой хромосомы человека:

https://img-fotki.yandex.ru/get/762837/158289418.4bb/0_18a4b2_7f171d5c_orig.png

https://img-fotki.yandex.ru/get/877959/158289418.4bc/0_18a965_869faa9e_XL.png

https://img-fotki.yandex.ru/get/478681/158289418.4bc/0_18a966_ce846726_XL.png

https://img-fotki.yandex.ru/get/877959/158289418.4bc/0_18a967_9c467267_orig.gif

9

Re: Human Genome Protein Structure

Формы, механизмы, энергия наномира - 98 029

Putin's Ruby Emdrive / Рубиновый Сармат / Satan-Ruby

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

Предложение для Курчатовского института.

Проверка таблицы композиционного генетического кода

Skype, 2018-04-24:

[23.04.2018 17:55:57] Кушелев Александр Юрьевич: Привет! Когда едем в Курчатовский?
[23.04.2018 18:06:58] Менеджер D: я сказал, что ты позвонишь завтра и проговоришь какие последовательности нужны. Набери её скажи, что вы договаривались с Менеджером D вернуться к этому разговору через неделю, поэтому я звоню
[23.04.2018 20:00:23] Кушелев Александр Юрьевич: ОК
[9:57:16] Кушелев Александр Юрьевич: Только что звонил в Курчатовский. Она сказала, что сейчас находится в командировке. Приедет на следующей неделе и займётся кодами.
[10:09:35] Менеджер D: Вот же, а ты уточнил дату?
[10:11:57] Кушелев Александр Юрьевич: Следующая неделя начинается с Пн. Вот я и позвоню в Пн. Если рано, она уточнит дату smile
[10:12:06] Менеджер D: хорошо
[10:12:06] Кушелев Александр Юрьевич: Зачем человека перенапрягать?
[10:12:28] Кушелев Александр Юрьевич: Я так понял, что они там все замотанные какие-то
[10:12:55] Менеджер D: Так там же Путин был
[10:15:40] Кушелев Александр Юрьевич: А...
[10:17:29] Кушелев Александр Юрьевич: Надо будет их спросить, не спрашивал ли Владимир Владимирович, как продвигается проверка Пикотехнологии? Ведь в декабре 2017 года я им послал письмо, где темой письма было: "Копия письма президенту РФ".

А вот и копия этого письма от 14 декабря 2017 года, зарегистрированного под номером ПГ 463:

Формы, механизмы, энергия наномира. Сообщение 93 581

Предложение для Курчатовского института.

Уважаемый президент России, Владимир Владимирович!
В лаборатории Наномир создана высокая технология двойного назначения "Пикотехнология белков", которая может многократно увеличить бюджет России. Она создана на базе научного открытия. Открыт композиционный генетический код, по которому не только выбираются аминокислоты при сборке белков, но и задаются их углы поворотов. Эта технология работает примерно в миллиард раз  быстрее рентгеноструктурного анализа, за который заказчики ежедневно платят примерно миллион евро. Новая технология проверена тремя независимыми методами:
1. Корреляция с рентгеноструктурным анализом.
2. Замыкание дисульфидных мостиков, определенных химическими методами
3. Обнаружение сверхдлинных спиралей белковых молекул.
Окончательную проверку новой технологии может сделать Курчатовский институт, в котором есть специализированная лаборатория рентгеноструктурного анализа.
Предложение для Курчатовского ин-та: http://nanoworld.org.ru/topic/1872/
Примите к сведению!
С уважением,
Александр Кушелев,
Руководитель лаборатории Наномир.