1

Тема: Предложение для Курчатовского института.

Уважаемые коллеги!
Для дополнительной проверки новой технологии определения структуры белка нам нужно определить структуры этих 24 белков, точнее участков, состоящих преимущественно из поливалина n*Val:

https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png

ETC64880: https://www.ncbi.nlm.nih.gov/nuccore/564568708
OXS06857: https://www.ncbi.nlm.nih.gov/nuccore/1226034760
KOF67455: https://www.ncbi.nlm.nih.gov/nuccore/918287724
OUM69688: https://www.ncbi.nlm.nih.gov/nuccore/1198313040
PIS11988: https://www.ncbi.nlm.nih.gov/nuccore/1277217132
KOF75295: https://www.ncbi.nlm.nih.gov/nuccore/918302080
OLP77457: https://www.ncbi.nlm.nih.gov/nuccore/1129165616
KYM86846: https://www.ncbi.nlm.nih.gov/nuccore/10 … mask=65536
OTF86159: https://www.ncbi.nlm.nih.gov/nuccore/CM … temID=1362
KKF17324: https://www.ncbi.nlm.nih.gov/nuccore/80 … mask=65536
XP_002382247: https://www.ncbi.nlm.nih.gov/nuccore/238502026
OLP98873: https://www.ncbi.nlm.nih.gov/nuccore/1129194414
CDW76368: https://www.ncbi.nlm.nih.gov/nuccore/678335661
AHB99005: https://www.ncbi.nlm.nih.gov/nuccore/56 … mask=65536
OAQ27448: https://www.ncbi.nlm.nih.gov/nuccore/1032646064
OUM69730: https://www.ncbi.nlm.nih.gov/nuccore/1198313040
OGL53990: https://www.ncbi.nlm.nih.gov/nuccore/1084158629
EIE92391: https://www.ncbi.nlm.nih.gov/nuccore/76151980
XP_001590524: https://www.ncbi.nlm.nih.gov/nuccore/156049114
OTG33229: https://www.ncbi.nlm.nih.gov/nuccore/CM … =307832447
OLQ06943: https://www.ncbi.nlm.nih.gov/nuccore/1129204435
XP_001895277: https://www.ncbi.nlm.nih.gov/nuccore/170580473
XP_001584576: https://www.ncbi.nlm.nih.gov/nuccore/156030497
KOF84884: https://www.ncbi.nlm.nih.gov/nuccore/918315370

Учитывая, что новая технология примерно в миллиард раз быстрее РСА, её проверка и внедрение может принести человечеству фантастический эффект.

Онлайн-сервис может показать структуру любого интересующего Вас белка: http://nanoworld.org.ru/topic/1699/
Так что проверку новой технологии Вы можете осуществить на удобных для Вас белковых структурах.

С уважением,
Руководитель лаборатории Наномир,
Александр Кушелев
8-926-5101703
8-903-2003424
8-916-8265031

2

Re: Предложение для Курчатовского института.

https://img-fotki.yandex.ru/get/879536/158289418.4a9/0_186fc0_a6332fad_orig.png

Подробнее: http://nanoworld.org.ru/topic/1859/

3

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира. Сообщение 93 581

Предложение для Курчатовского института.

Уважаемый президент России, Владимир Владимирович!
В лаборатории Наномир создана высокая технология двойного назначения "Пикотехнология белков", которая может многократно увеличить бюджет России. Она создана на базе научного открытия. Открыт композиционный генетический код, по которому не только выбираются аминокислоты при сборке белков, но и задаются их углы поворотов. Эта технология работает примерно в миллиард раз  быстрее рентгеноструктурного анализа, за который заказчики ежедневно платят примерно миллион евро. Новая технология проверена тремя независимыми методами:
1. Корреляция с рентгеноструктурным анализом.
2. Замыкание дисульфидных мостиков, определенных химическими методами
3. Обнаружение сверхдлинных спиралей белковых молекул.
Окончательную проверку новой технологии может сделать Курчатовский институт, в котором есть специализированная лаборатория рентгеноструктурного анализа.
Предложение для Курчатовского ин-та: http://nanoworld.org.ru/topic/1872/
Примите к сведению!
С уважением,
Александр Кушелев,
Руководитель лаборатории Наномир.

4

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира. Сообщение 93 881

Определим структуры всех белков человека к Новому, 2018-ому году?

Число разновидностей белков человека около 5 000 000.

За всю историю развития науки и техники определено около 100 000 белковых структур (половина неправильно). На это истрачено более миллиарда USD.

https://img-fotki.yandex.ru/get/198860/158289418.3e0/0_176329_6d9df850_L.gif
Пример пикотехнологической 3D-модели белка.

Кушелев: На данный момент база белковых структур "Human Genome Protein", расположенная по этим адресам:

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

содержит структуры белков, закодированных

5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23(X), 24(Y)-хромосомами человека:
https://img-fotki.yandex.ru/get/894414/158289418.4b5/0_189a97_82a0444c_orig.png

Примеры вторичных структур белка в компактном и развёрнутом виде:

https://img-fotki.yandex.ru/get/897810/158289418.4b6/0_189e73_8f3b4a12_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/893753/158289418.4b7/0_18a055_f5f116d2_XL.png

***

https://img-fotki.yandex.ru/get/516365/158289418.4b7/0_189ecf_13af3e92_orig.png

https://img-fotki.yandex.ru/get/879536/158289418.4b7/0_189f2f_d2a84234_XL.png

https://img-fotki.yandex.ru/get/877700/158289418.4b7/0_18a065_70b30230_orig.png

https://img-fotki.yandex.ru/get/914553/158289418.4b7/0_18a069_6ec5aef6_orig.png






https://img-fotki.yandex.ru/get/876984/158289418.4b7/0_18a06c_288cc96f_orig.png

https://img-fotki.yandex.ru/get/874316/158289418.4b8/0_18a070_5b715cbf_orig.png

https://img-fotki.yandex.ru/get/875526/158289418.4b8/0_18a072_8eef4d58_orig.png

Укрупнение:

https://img-fotki.yandex.ru/get/874316/158289418.4b8/0_18a073_e57bd51_orig.png

https://img-fotki.yandex.ru/get/897810/158289418.4b8/0_18a0ba_e3f74559_orig.png

https://img-fotki.yandex.ru/get/896349/158289418.4b9/0_18a0fd_f166188_orig.png

5

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира. Сообщение 94 081

3D модель "монстра" первой хромосомы (5207 АО)

https://img-fotki.yandex.ru/get/476282/158289418.4bc/0_18a56a_5930b399_orig.gif

Скрипт Кушелева, с помощью которого был построен фрагмент "монстра" первой хромосомы человека.

-- Monster of the first human chromosome (5207 amino acids)
-- Nanoworld Lab. Alexander Kushelev
-- http://nanoworld.org.ru
p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,3,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,
1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,
4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,
1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,
3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,
1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,
3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,
3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,
1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,
3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,
4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,
3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,
1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,
1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,
3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,
3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,
3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,
1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,
1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,
2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,
3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,
3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,
3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,
3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,
1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,
3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,
3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,
3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,
2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,
3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,
3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,
1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,
4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,
3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,
1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,
1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,
3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,
2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,
1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,
3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,
2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,
1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,
1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,
1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,
3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,
1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,
3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,
1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,
3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,
1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,
2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,
3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,
3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,
1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,
1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,
1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,
1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,
1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,
3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,
2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,
1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,
1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,
1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,
3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,
3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,
3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,
1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,
3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,
3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,
1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,
1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,
3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,
3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,
3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,
2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,
3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,
3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,
2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,
1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,
3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,
3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,
1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,
3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,
4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,
4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,
1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,
3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,
1,3,3,4,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,
1,1,1,3,3,3,1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,
3,1,1,1,1,2,4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,1,1,4,2,3,3,3,1,
1,4,1,4,1,3,3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,4,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,2,3,3,3,3,4,3,1,2,1,1,1,1,3,3,1,3,1,2,1,1,3,1,3,3,1,1,3,3,1,1,3,3,3,3,1,1,3,3,4,3,3,
1,3,1,2,2,1,1,1,1,1,1,1,4,4,3,1,3,1,3,3,1,1,1,1,2,4,3,3,3,3,4,3,3,2,3,3,3,3,4,3,1,3,1,1,1,1,1,3,3,3,
1,2,1,1,3,1,1,3,1,1,3,3,1,4,1,3,3,3,1,1,3,3,1,3,3,1,3,1,2,2,1,1,1,1,1,1,1,4,4,1,2,2,1,3,3,1,1,1,1,2,
4,3,3,3,3,2,3,3,1,3,3,3,3,1,3,1,1,1,1,1,3,2,3,1,3,3,2,1,1,3,3,3,3,1,3,3,3,1,4,2,3,3,3,1,1,4,1,4,1,3,
3,1,2,3,3,2,1,1,3,3,3,1,2,3,3,3,4,3,3,3,3,1,2,2,1,1,1,1,1,1,4,4,1,3,4,3,1,3,3,1,3,1,1,2,4,3,2,3,3,3,
3,4,2,1,1,3,3,2,3,1,2,1,1,1,1,3,3,4,3,1,2,3,1,3,1,1,1,1,1,1,3,1,4,1,3,1,3,3,3,1,4,4,2,3,1,1,4,4,1,1,
1,2,1,2,1,2,3,0)
peptide = box length:1 width:1 height:1  position:[0,0,-.5] wirecolor:[250,250,250]; Converttomesh peptide
for k = 1 to 4500 do(
element = box length:1 width:1 height:1 pos:[0,0,0]; Converttomesh element
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])

https://img-fotki.yandex.ru/get/373339/158289418.4bb/0_18a3fa_79817ce3_XL.png
Оригинал: https://img-fotki.yandex.ru/get/373339/ … 3_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/370744/158289418.4bc/0_18a569_fd9446b9_XL.png
0.25 от оригинала: https://img-fotki.yandex.ru/get/370744/ … 9_orig.png
Оригинал: https://cloud.mail.ru/public/8gC2/mkhM3wWW4

https://img-fotki.yandex.ru/get/9494/158289418.4bc/0_18a589_4694862e_orig.gif

Настройки одного из 5 композиционных углов по одной из трёх составляющих заняла около двух часов:

https://img-fotki.yandex.ru/get/371487/158289418.4bc/0_18a588_ce47e849_orig.gif
Настройка 5 композиционных углов по 3 составляющим может занять около 30 часов. Однако это не имеет смысла, т.к. в реальном белке композиционные и транспозиционные (это ещё столько столько же степеней свободы) на разных участках белка разные. А третий угол Pro - ещё одна степень свободы, которая без учета физико-химических взаимодействий тоже представляет собой неопределенность.

6

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира. Сообщение 94 522

Предложение для Курчатовского института.

Уважаемая Виктория!

Вы не могли бы помочь разобраться, есть ли какие-нибудь данные о структуре этих белков или им подобных, т.е. с протяженными участками поливалина или других аминокислотных остатков?

Kushelev пишет:

Уважаемые коллеги!
Для дополнительной проверки новой технологии определения структуры белка нам нужно определить структуры этих 24 белков, точнее участков, состоящих преимущественно из поливалина n*Val:

https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png

ETC64880: https://www.ncbi.nlm.nih.gov/nuccore/564568708
OXS06857: https://www.ncbi.nlm.nih.gov/nuccore/1226034760
KOF67455: https://www.ncbi.nlm.nih.gov/nuccore/918287724
OUM69688: https://www.ncbi.nlm.nih.gov/nuccore/1198313040
PIS11988: https://www.ncbi.nlm.nih.gov/nuccore/1277217132
KOF75295: https://www.ncbi.nlm.nih.gov/nuccore/918302080
OLP77457: https://www.ncbi.nlm.nih.gov/nuccore/1129165616
KYM86846: https://www.ncbi.nlm.nih.gov/nuccore/10 … mask=65536
OTF86159: https://www.ncbi.nlm.nih.gov/nuccore/CM … temID=1362
KKF17324: https://www.ncbi.nlm.nih.gov/nuccore/80 … mask=65536
XP_002382247: https://www.ncbi.nlm.nih.gov/nuccore/238502026
OLP98873: https://www.ncbi.nlm.nih.gov/nuccore/1129194414
CDW76368: https://www.ncbi.nlm.nih.gov/nuccore/678335661
AHB99005: https://www.ncbi.nlm.nih.gov/nuccore/56 … mask=65536
OAQ27448: https://www.ncbi.nlm.nih.gov/nuccore/1032646064
OUM69730: https://www.ncbi.nlm.nih.gov/nuccore/1198313040
OGL53990: https://www.ncbi.nlm.nih.gov/nuccore/1084158629
EIE92391: https://www.ncbi.nlm.nih.gov/nuccore/76151980
XP_001590524: https://www.ncbi.nlm.nih.gov/nuccore/156049114
OTG33229: https://www.ncbi.nlm.nih.gov/nuccore/CM … =307832447
OLQ06943: https://www.ncbi.nlm.nih.gov/nuccore/1129204435
XP_001895277: https://www.ncbi.nlm.nih.gov/nuccore/170580473
XP_001584576: https://www.ncbi.nlm.nih.gov/nuccore/156030497
KOF84884: https://www.ncbi.nlm.nih.gov/nuccore/918315370

Учитывая, что новая технология примерно в миллиард раз быстрее РСА, её проверка и внедрение может принести человечеству фантастический эффект.

Онлайн-сервис может показать структуру любого интересующего Вас белка: http://nanoworld.org.ru/topic/1699/
Так что проверку новой технологии Вы можете осуществить на удобных для Вас белковых структурах.

С уважением,
Руководитель лаборатории Наномир,
Александр Кушелев
8-926-5101703
8-903-2003424
8-916-8265031

7

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира. Сообщение 94 735

Предложение для Курчатовского института.

Кушелев: Письмо было отправлено 14 декабря. Сегодня у нас 18-е января.
Секретарь. Я понимаю...
Кушелев: Дело-то серьёзное. Можно увеличить бюджет России в несколько раз за счёт новой технологии.
Секретарь: Я сделаю всё, что смогу...

Формы, механизмы, энергия наномира. Сообщение 93 581

Предложение для Курчатовского института.

2017-12-14

Кушелев: Уважаемый президент России, Владимир Владимирович!
В лаборатории Наномир создана высокая технология двойного назначения "Пикотехнология белков", которая может многократно увеличить бюджет России. Она создана на базе научного открытия. Открыт композиционный генетический код, по которому не только выбираются аминокислоты при сборке белков, но и задаются их углы поворотов. Эта технология работает примерно в миллиард раз  быстрее рентгеноструктурного анализа, за который заказчики ежедневно платят примерно миллион евро. Новая технология проверена тремя независимыми методами:
1. Корреляция с рентгеноструктурным анализом.
2. Замыкание дисульфидных мостиков, определенных химическими методами
3. Обнаружение сверхдлинных спиралей белковых молекул.
Окончательную проверку новой технологии может сделать Курчатовский институт, в котором есть специализированная лаборатория рентгеноструктурного анализа.
Предложение для Курчатовского ин-та: http://nanoworld.org.ru/topic/1872/
Примите к сведению!
С уважением,
Александр Кушелев,
Руководитель лаборатории Наномир.

8

Re: Предложение для Курчатовского института.

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:

Александр Юрьевич,
напишите пожалуйста по возможности для приведённых примеров
резюме диаграмм PDB    и      резюме диаграмм Пикотех -

Я имею в виду  посты 791-795.

Что показывает PDB  и что показывает Пикотех.

Где РСА ошибся, почему и как это видно.

Как ошибку РСА можно идентифицировать на диаграммах PDB  и Пикотех и почему -
прямо по порядковым номерам аминокислотных остатков в белковой молекуле.

Самое наглядное будет в том случае, если в лаборатории Курчатовского вырастят два кристалла полилизина. Один по коду n*(AAA), а второй по коду n*(AAG). Там и без рентгена будет видно, что структуры разные, т.к. у них будет разная плотность и другие параметры. Поэтому я и пытаюсь связаться с лабораторией из Курчатовского. Но пока удалось пообщаться только с секретарями.

9

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира. Сообщение 95 663

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-05_01:

https://www.ncbi.nlm.nih.gov/nuccore/568179845

>CRL29754
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgcctttccccccctcacacttctttcaaaacattcttctactgcctttgcctattctt
tatccctcctatttcatttatcattctctcactttcttaccttacatcgaaaatgggaag
agactgggtccgtcaaccggaggaaaaatcgacatgggaacagtctcaacttggatggtc
ttccacttttccatccacaattactgggacaatgtcaagcaagaagcacgtctcacccta
tcttatgtccgcttgacggacgaagggattttctactgcatctgtaccatgacacctcac
cagcggacctcgcggttccaggccgacttcgaccaacatggagacatccggacctcacgt
attctattggaccccccaatgattgtttgggctaatggcctaccgtggttccctgtttac
aaagctttttccgtcctctgtggaagttggaatgcggtatcctatctagtcggtcgcaaa
tatcggtcaagtatctccgagttctaccttggtgcagccttagccccgcccgaagcagtg
caggcgagccaagaagattccctcacctcttcatactttcttccttgcatccctttttga

Результат:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda0_db7bf68b_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda1_ef3a7b7c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/482931/ … c_orig.png

10

Re: Предложение для Курчатовского института.

Формы, механизмы, энергия наномира - 98 029

Putin's Ruby Emdrive / Рубиновый Сармат / Satan-Ruby

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

Предложение для Курчатовского института.

Проверка таблицы композиционного генетического кода

Skype, 2018-04-24:

[23.04.2018 17:55:57] Кушелев Александр Юрьевич: Привет! Когда едем в Курчатовский?
[23.04.2018 18:06:58] Менеджер D: я сказал, что ты позвонишь завтра и проговоришь какие последовательности нужны. Набери её скажи, что вы договаривались с Менеджером D вернуться к этому разговору через неделю, поэтому я звоню
[23.04.2018 20:00:23] Кушелев Александр Юрьевич: ОК
[9:57:16] Кушелев Александр Юрьевич: Только что звонил в Курчатовский. Она сказала, что сейчас находится в командировке. Приедет на следующей неделе и займётся кодами.
[10:09:35] Менеджер D: Вот же, а ты уточнил дату?
[10:11:57] Кушелев Александр Юрьевич: Следующая неделя начинается с Пн. Вот я и позвоню в Пн. Если рано, она уточнит дату smile
[10:12:06] Менеджер D: хорошо
[10:12:06] Кушелев Александр Юрьевич: Зачем человека перенапрягать?
[10:12:28] Кушелев Александр Юрьевич: Я так понял, что они там все замотанные какие-то
[10:12:55] Менеджер D: Так там же Путин был
[10:15:40] Кушелев Александр Юрьевич: А...
[10:17:29] Кушелев Александр Юрьевич: Надо будет их спросить, не спрашивал ли Владимир Владимирович, как продвигается проверка Пикотехнологии? Ведь в декабре 2017 года я им послал письмо, где темой письма было: "Копия письма президенту РФ".

А вот и копия этого письма от 14 декабря 2017 года, зарегистрированного под номером ПГ 463:

Формы, механизмы, энергия наномира. Сообщение 93 581

Предложение для Курчатовского института.

Уважаемый президент России, Владимир Владимирович!
В лаборатории Наномир создана высокая технология двойного назначения "Пикотехнология белков", которая может многократно увеличить бюджет России. Она создана на базе научного открытия. Открыт композиционный генетический код, по которому не только выбираются аминокислоты при сборке белков, но и задаются их углы поворотов. Эта технология работает примерно в миллиард раз  быстрее рентгеноструктурного анализа, за который заказчики ежедневно платят примерно миллион евро. Новая технология проверена тремя независимыми методами:
1. Корреляция с рентгеноструктурным анализом.
2. Замыкание дисульфидных мостиков, определенных химическими методами
3. Обнаружение сверхдлинных спиралей белковых молекул.
Окончательную проверку новой технологии может сделать Курчатовский институт, в котором есть специализированная лаборатория рентгеноструктурного анализа.
Предложение для Курчатовского ин-та: http://nanoworld.org.ru/topic/1872/
Примите к сведению!
С уважением,
Александр Кушелев,
Руководитель лаборатории Наномир.