811

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 738

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_02:

https://www.ncbi.nlm.nih.gov/nuccore/1183860967

>DAA82270
atgaaaaatagcagaaaacgtagtaaacgaattgttgcatcagcattaacagctctattt
attgcgcaacaatcaatgctattatccgttgttgcaagtgacatcacaggcgtaactggg
aacaatggagtatataatattaacccaagtacagcaaaaggtgatattggtttcaggcac
tatgaaaactttaacctatcaaaaggtgacattgcaaacttgatttataaatatggtgca
acagacatcgaaacctttgtaaatatggtagataaccaaattaatatcaatggtttggtt
aatacaatgagaaataataatttctacaatgggaaagcagtctttatttctccaaacgga
atggttgtcggagcttctggtgttcttaacgttggctccttaggagtttatacaccaaac
agcactgattataataattttaataaagaagacccaacaattgcagggcttaataattta
accaagagtgatgctaatggtgcagcacctgtaactatcaatggtaaagtcatttcttct
ggcgatgtcgaaatcattggaggaaaagtcgatattggcaaaaatgcaggaattattggt
ggcgtaaacaaaagtcaaatgaaagcaattacaagtgatgatcaagcaacagccttgttc
aataatcttgttaatacaaataatcttacaaatggaagccaatttattagtgatgaagct
ggacaaatccgaattacatctcaaggcggagtaaatgtagctggaaatattattaactac
gctactggtggagattacacaaatccaaataattcaaattatagcggaatcaaaatttta
agtcacaactcatcaacaccaaatggagatataatttcttctggaattaacgtttctgga
acaattgcaaatgcaaaaggacttgttcaacttgataacaatggcggagatatagatatt
tctgggaatattaagaataatggaacaacaaatatttataatacaccatacgcactatat
tctgacagtaccaagaatgaaaaaattgcccaaaattctggattaaaaatttctggaaat
attgatactaaaggcgatttaaatattgaaaacagaggcggaaaaggtcttaatatctct
ggaaatatcaatcatgatggggatgcaaatatctcaaatggttatactgataatgatatt
tttggctacgatggtaacaattcaaaagttaacacaggagctttagatatttctggggat
gttaatatctctggaaactctaacattataaactaccaacacggtgttgatggtttaaat
gttacaggcacagttaaaactggaggagatgcaacatatacaaaccacggtaaagctgga
ttaaatattaaagataacggaagcatttcttcaaataatcttgcaatgttgaacactggt
gctggaggtttaaatatttctggttccgcaaagaataataaaactgcaacagttacaaat
aaagctggagatttaacaattggaggaacatttgttaacggaggagatgctacgtttaca
aatgacggaaaccaattcaacatttctggaacagtaacaaataaattaaccgatgcagaa
aaagaattcggcaccattaacatggttaataatggtgaaggcggatttgttattgaaaac
agtggcaacgtaaatgcagaaagctctaatttatcaattacaaacaacgctggaaatctt
gacattaatggttctgttaaaaacgatggaggcaaaaaccttacaaacaagaccgaaatt
ttaaatgatggcaagacattaaacattggcaaaactggtaaagttaatacatctggaagc
ctagcaattacaaataacggcgaaggcggaatgaacattgatggttccgtaaataatgac
aactctgcaacgactgctaatgataaaatcgcattcaaggatgctaacaatacaaccatt
acaaatacagcaggaacattgaaagttgacggaaatgtttcttctaatacatcagaatta
acaatgacaaatgagggaaaaacatttgaaatcaacggaaatatttctggtacaaacaac
aatgtaaaccttattaacaaaaatggagcattagacctaaacagttctggaagagttaaa
tcaacagatgatattaatattacaaactctggtaaaggcggagttaatgttaaaggtcta
gcaaatgcaaagaaaaatgttaacatcgacaacaaagacagtaatgttgtaattggtgat
aaaacagaaaataacaactatgtaacagctggcgaaaatatcaatatcgcaattaacaat
ggaagcttactaaactatggagttgtaaaaacattactaaatgctggtggcgacctaaat
atgaacgttacagatggcacaatcggtcttgatgttcaacaaaaagcttgccaaggctct
ggatgtactggtattgggccaaaagctgatggttcaagagatttcacaaaatcaattaac
gcaaatatcaagggtaaagttaatgccacaaccaacaaggcaaacaaaccagatgattta
gttatcaattacgcagcaattgattccgatatgaacatcgataaaatcaaagcagacgga
aaagttatcttaactgttgacgatttagatcatatcacaacgggtaaagctagcggcaca
agatataatatgattaacgctagcactcaagaaaacggaacaaatatcattggtaaaggt
atttcattaatctctaatggcagcattggaacaaaagataatatggtaacattcatccaa
acagatgctgataaccataaaatggatggacttgcaaataaaaacatttacttaaaagaa
aatagcttcaatgaatatggcagagatggtgaagttattaaaaatgcgatatgtacaatg
attgcaagagaaggggatttataccttgaacttgcaggaaatactacaattgacaatatc
acagctgaaggtgatatgacagttatcactagaggtaaaaacctaacaatcaccaactta
ggtcatattgaagatccagcaatcatcaatggagaagattactttggacctcaccatgat
ggatatgaatttgataaaggttacgacaaggatgactacaaatcagaaattcttccaaac
aatgtaactcttaaagctcttgacattaaccacgttatcagaccaacagaagaacttgtt
gacggagcacatgaagcctgggcagattcaacagttagagtaacaaatgcggttcttgat
aatgggaaaatggatattaccgcagataatatctatgcgaatggcgtatatgttcacttt
ggtaaaaatggatacagcaaaaaaccagatgactcaacaaacaaaatgattggtgttgac
ggagatccaatgggacactcagttagaccagatgatgttgaaggaattggaagaactgaa
actgaaagaaactactatgatgaagatgatactccactagttccagatacagataccgac
ccagatactgatactgacactgatactgacactgatacagatactgacactgatactgac
actgatacagatactgacactgatactgacactgatacagatactgatactgatacagat
actgatacagacactgatacagacactgatacagatactgatactgatactgatactgat
acagacacagatacagatacagatactgatactgatacagatactgatacagatactgac
acagatactgatacagatacagacactgatacagatacagatacagatacagacactgat
actgatactgatactgatactgatactgatactgatactgatactgatactgatactgat
actgatactgacactgacactgatactgatactgacactgatactgatacagatactgat
gatgaaccaaatatcgattctgatgcagatggaagacaagcatttattcaaagaaaaatc
ttagatgataatgttgattctatcgataaacgtcaatatatgagatacagtgtttctgat
aacaaaaatccagttggattagaaccaggacacggaattgaaggattacttgatgtatct
agaggcggtattgcagtagtccacaataatgatttaaaagttggagatgttgttcctgta
cacatttcatacggaggtttagacatcaaagcagatgtaaaagttatctcttcaaccgac
catagagcaggtgcaatgtttgttaacttagaccaatcaactgcaaaccaattgttatac
ttaaatatgattttagacgatgtaaatcacatctctctaaatccgtaa

Результат:

https://img-fotki.yandex.ru/get/765007/158289418.4c9/0_18cfd7_48042da6_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/476282/158289418.4c9/0_18cfd8_1efb19_XL.png
Оригинал: https://img-fotki.yandex.ru/get/476282/ … 9_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/509885/158289418.4c9/0_18cfd9_464e8e3_orig.png

812

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 741

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_03:

А теперь посмотрим весь геном:

https://www.ncbi.nlm.nih.gov/nuccore/1183860967

https://img-fotki.yandex.ru/get/760582/158289418.4c9/0_18cffb_18dab18e_orig.png

Все белки пи-спиральные ...

Типичный представитель:

https://img-fotki.yandex.ru/get/478076/158289418.4c9/0_18cffc_5ee57199_orig.png

https://img-fotki.yandex.ru/get/877959/158289418.4c9/0_18cf8b_3d717cd5_orig.png

813

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 750

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_04:

https://www.ncbi.nlm.nih.gov/protein/CC … F62A3UZ015

https://img-fotki.yandex.ru/get/369434/158289418.4c9/0_18d021_b5cb7255_orig.png

Белки, закодированные в этом геноме, разного типа.

https://img-fotki.yandex.ru/get/769006/158289418.4c9/0_18d022_f96fee9d_orig.png
Самая интересная структура у этого белка.
Обратите внимание, что последовательность n*(DT) образует очень непростую вторичную структуру...

814

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_05:

https://www.ncbi.nlm.nih.gov/protein/OL … F62A3UZ015

https://img-fotki.yandex.ru/get/510105/158289418.4c9/0_18d025_a7831692_orig.png

И снова мы видим "голубой геном", т.е. все структуры пи-спиральные.

https://img-fotki.yandex.ru/get/509885/158289418.4c9/0_18d026_812d91c2_orig.png

А это самый интересный белок с последовательностью n(TD)

815

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-07_06:

https://www.ncbi.nlm.nih.gov/protein/OX … F62A3UZ015

https://img-fotki.yandex.ru/get/373867/158289418.4c9/0_18d027_d7d27c83_orig.png

Почти "красный геном"

https://img-fotki.yandex.ru/get/749077/158289418.4c9/0_18d028_b6eb5cd1_orig.png
БОльшая часть белков альфа-спирального типа

https://img-fotki.yandex.ru/get/476282/158289418.4c9/0_18d029_ba8318a9_orig.png
Однако белок с аминокислотной последовательностью n(TD) больше "голубой", чем "красный". Но в нём нет пи-спиралей. Точнее всего одна. Много одиночных пи-кодов, т.е. неполных витков пи-спиралей. Тем не менее вторичная структура кажется светло-голубой из-за обилия одиночных пи-кодов.

816

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 773

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-08_01:

https://www.ncbi.nlm.nih.gov/genome/?term=salamander

https://www.ncbi.nlm.nih.gov/nuccore/PGSH00000000.1

Результат:

https://img-fotki.yandex.ru/get/368796/158289418.4c9/0_18d072_81e247e7_orig.png

https://img-fotki.yandex.ru/get/766539/158289418.4c9/0_18d077_6c732734_orig.png
Белок "по имени Серл" smile

https://img-fotki.yandex.ru/get/509885/158289418.4c9/0_18d093_cc577a11_orig.png
А здесь мы видим программную 74447527-спираль, образованную аминокислотной последовательностью n(APVVRAS), которая строится под музыку в семидольном ритме.

Видна и другая программная 741112555755-спираль, образованная аминокислотной последовательностью n(PVKKSSPVKRKS), которая строится под музыку в 12-дольном ритме.

https://img-fotki.yandex.ru/get/1027630/158289418.4c9/0_18d0b9_3c50a64c_orig.png
А это белок по имени PWR smile

https://img-fotki.yandex.ru/get/1029133/158289418.4c9/0_18d0ba_a11b164b_orig.png
Большинство белков в геноме этого вируса "красные", т.е. преимущественно альфа-спиральные.

https://img-fotki.yandex.ru/get/478621/158289418.4c9/0_18d0bb_2449aa03_orig.png
Но есть и "слегка красноватые" smile

https://img-fotki.yandex.ru/get/373752/158289418.4c9/0_18d0bc_2e4fbb2_orig.png
И голубоватые с единственной пи-спиралью

817

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 96 374

Slype, 2018-03-01:

Главный: Можешь определить структуру белка соматотропина человека?

Кушелев: Заказ 2018-03-01:

Структура белка соматотропина / Human growth hormone gene (HGH-N)

https://www.ncbi.nlm.nih.gov/nuccore/M1 … rt=genbank

Human growth hormone gene (HGH-N)

>M13438
atggctacaggctcccggacgtccctgctcctggcttttggcctgctctgcctgccctgg
cttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatg
ctccgcgcccatcgtctgcaccagctggcctttgacacctaccaggagtttgaagaagcc
tatatcccaaaggaacagaagtattcattcctgcagaacccccagacctccctctgtttc
tcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagag
ctgctccgcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcagg
agtgtcttcgccaacagcctggtgtacggcgcctctgacagcaacgtctatgacctccta
aaggacctagaggaaggcatccaaacgctgatggggaggctggaagatggcagcccccgg
actgggcagatcttcaagcagacctacagcaagttcgacacaaactcacacaacgatgac
gcactactcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgag
acattcctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttctag


https://img-fotki.yandex.ru/get/909751/158289418.4d1/0_18e707_e01b0128_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/1003890/158289418.4d1/0_18e708_ed9c19ca_orig.png

https://img-fotki.yandex.ru/get/769132/158289418.4d1/0_18e70a_863897f4_XL.png

https://img-fotki.yandex.ru/get/907951/158289418.4d1/0_18e70b_ca88f6fa_XL.png

https://img-fotki.yandex.ru/get/479032/158289418.4d1/0_18e70c_215edf06_XL.png

https://img-fotki.yandex.ru/get/907951/158289418.4d1/0_18e709_cf37f341_XL.png

Музыка сборки: https://yadi.sk/d/VHbxwhfK3SwPNU

818

Re: Online service PROTEIN PICOTECHNOLOGY

Музыка сборки белка в профессиональной аранжировке

Этой мелодии больше 3 000 000 000 лет!

Слушать в профессиональной аранжировке:

https://cloud.mail.ru/public/DkYq/RbevtzUVd

https://yadi.sk/d/2A9mnmZb3SqgHL

Подробности: http://nanoworld.org.ru/topic/1930/

https://img-fotki.yandex.ru/get/900241/158289418.4bc/0_18a59c_2fc79d96_orig.png

**************************************************************

Формы, механизмы, энергия наномира. Сообщение 96 293

Музыка сборки белка в профессиональной аранжировке

С ДНЁМ РОЖДЕНИЯ УВАЖАЕМЫЙ АЛЕКСАНДР !!!
2018-02-27 23:28

МУЗЫКАЛЬНЫЙ БЕЛОК КУШЕЛЕВУ В ДЕНЬ РОЖДЕНИЯ.mp3

Не успел ко дню рождения закончить, но лучше позже - чем никогда )) С ДНЁМ РОЖДЕНИЯ  АЛЕКСАНДР ! ЗДРАВИЯ И ДОБРЫХ ЛЮДЕЙ ВО КРУГ ! с уважением А из  Н

Кушелев: Супер! А можно увидеть исходные ноты и ноты всего произведения? Вы в MIDI пишите?
С уважением,

819

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 97 715

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:

Как выполнить 2D визуализацию взаимодействия лиганд-белок?

Кушелев: 2D - это таблица типа такой:

https://img-fotki.yandex.ru/get/765007/158289418.4c9/0_18cfd7_48042da6_orig.png
По ней иногда можно догадаться, какие участки одной молекулы будут связываться с участками другой молекулы. Но визуализацию можно сделать на уровне 3D (в пространстве). Если будет заказ, попробую сделать. Но наша "фишка" - надёжные 2D-структуры, которые не может показать рентген. А мы можем, причём быстро, в автоматическом режиме и целыми геномами. На это и нужно делать акцент при беседе с потенциальными клиентами. Они будут говорить, что 2D-структура их не интересует, им нужна четвертичная или хотя бы 3D, но им нужно предложить для начала взглянуть на 2D структуру тех белков, с которыми они работают, пользуясь результатами РСА. Некоторые из потенциальных клиентов прозреют, увидев, что РСА не может надёжно определить даже 2D-структуру. Более того, РСА не отличает пи-спиараль от альфа-спирали. Прозревшие молекулярные биологи и есть наши будущие клиенты. А упёртые пусть не напрягаются. Не нужно на них тратить время и выворачиваться наизнанку, выполняя ручную сборку 3D и 4D-моделей. Для раскрутки нам хватит заказчиков надёжных 2D-моделей.

820

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 98 005

For our overseas friends.

Online service PROTEIN PICOTECHNOLOGY

Skype, 2018-04-23:

[13:19:10] Татьяна Рясина: Написала Dear Mr. !
Tank you wery much for your interest and benevolent evaluation.
We have to  inform you that today we are not laying out our Picotechnology programs openly. But we are ready to make the necessary molecular structures for you according to the nucleotide sequence or EMBL code. Please could you send us ten nucleotide sequences of protein molecules of interest to you, and we will send you their structures.
The first ten 2D structures we will do for you for free as an approbation.

We would like to coordinate further interests with you after this. How many protein structures are needed for your research or for your research program? If this does not make it difficult for you, could you write to the author of the Proteine Pirotechnology Alexander Kushelev  kushelev20120@yandex.ru  to agree on your order, a brief description of the issues you are interested in and how it would be convenient for you to coordinate in the long run?

Sincerely,

[13:19:54] Татьяна Рясина: Дорогой мистер! Мы должны Вас проинформировать, что сегодня мы не выкладываем в открытый доступ наши программы по Пикотехнологии.  Но мы сделаем необходимые для Вас структуры молекул по нуклеотидной последовательности или коду EMBL. Пожалуйста пришлите нам десять нуклеотидных последовательностей интересующих Вас белковых молекул, и мы вышлем Вам их структуры. Первые десять 2D структур мы сделаем для Вас бесплатно в качестве апробации.

Дальнейшие интересы мы хотели бы согласовать с Вами после этого. Какое количество белковых структур необходимо для Вашего исследования или для Вашей программы исследований? Если это Вас не затруднит, не могли бы Вы написать автору пикотехнологии белков Александру Кушелеву для согласования Вашего заказа, небольшого описания интересующих Вас вопросов и того, как Вам было бы удобно координироваться в дальнешйем?

[13:29:39] Кушелев Александр Юрьевич: Нормально