1

Тема: Проверка таблицы композиционного генетического кода

Skype, 2018-01-19:

Кушелев: Ответ из Курчатовского:

Уважаемый Александр,

Мы внимательно изучили Ваши материалы, а также материалы, представленные на сайте.  НИЦ «Курчатовский институт» открыт к сотрудничеству, направленному на развитие науки и технологий в России.  Проведение исследований структуры белковых кристаллов методом рентгеноструктурного анализа доступно на станции «Белок» в Курчатовском комплексе синхротронно-нейтронных исследований. Предлагаем Вам заполнить заявку по форме на сайте: http://www.users.kcsni.nrcki.ru/.

С уважением, 
Руководитель Курчатовского комплекса НБИКС-технологий
В.А. Демин
***
http://nanoworld.org.ru/topic/1904/

Проверка таблицы композиционного генетического кода

Научная новизна заключается в возможности определения вторичной, а иногда и третичной структуры белка по кодирующей его нуклеотидной последовательности.

Определение структуры белка по нуклеотидной последовательности дополняет возможности рентгеноструктурного анализа. Позволяет определять структуры белков по табличной функции, что примерно в миллиард раз быстрее традиционных способов определения вторичной структуры.

1. Подготовка экспериментальных образцов.
Образец 1: Полилизин, полученный по коду n*(AAA)
Образец 2: Полилизин, полученный по коду n*(AAG)
2. Сравнение свойств растворов
3. Выращивание кристаллов из полилизинов двух типов.
4. Сравнение параметров кристаллов "Полилизан-AAA" и "Полилизин-AAG"
5. Рентгеноструктурный анализ "Полилизана-AAA" и "Полилизина-AAG"

Ожидается различие свойств  растворов "Полилизана-AAA" и "Полилизина-AAG".
Ожидается различие свойств кристаллов  "Полилизана-AAA" и "Полилизина-AAG", в частности, их плотности.
РСА может  показать, что "Полилизана-AAA" состоит из пи-спиралей, а "Полилизина-AAG" состоит из альфа-спиралей.

https://img-fotki.yandex.ru/get/510105/158289418.4c1/0_18b914_5fe6e8f5_orig.png

Метод исследования: Монокристаллическая рентгеновская дифракция (XRD)

Станция "Белок"

Запрашиваемые параметры "В процессе определения"

https://img-fotki.yandex.ru/get/246231/158289418.4c1/0_18b915_23f89a11_orig.png

***

https://img-fotki.yandex.ru/get/914565/158289418.4c1/0_18b916_970a5a27_orig.png

2

Re: Проверка таблицы композиционного генетического кода

Ждём с интересом. Слава науке!

3

Re: Проверка таблицы композиционного генетического кода

Формы, механизмы, энергия наномира. Сообщение 95 638

Проверка таблицы композиционного генетического кода

Корейские физики тоже создали "Демона Кушелева"

Skype, 2018-02-04:

[13:04:41] Главный : Почитай статью: https://m.hightech.fm/2018/01/22/information-engine
[13:14:42] Кушелев Александр Юрьевич: Благодарю! Читаю...
[13:25:21] Кушелев Александр Юрьевич: Да, корейцы на верном пути, но приоритета у них нет. Я показал модельный эксперимент, который объясняет механизм добычи тепловой энергии хаотического движения молекул в живой природе ещё в 89-ом выпуске рассылки "Новости лаборатории Наномир": https://subscribe.ru/archive/science.ne … 34626.html
Теперь независимые исследователи из Кореи подтвердили ещё одно моё научное открытие. Кстати, я уже усовершенствовал модель:

http://img-fotki.yandex.ru/get/10/nanoworld.3/0_5ffa_43150486_L.jpg
Подробнее: http://nanoworld.narod.ru/137.htm
Более того, пока корейцы пытаются создавать молекулы-преобразователи, я уже несколько лет назад нашёл в живой природе готовые такие "информационные двигатели". К ним относятся молекулы глюкозы, белка окситоцина, большинство РНК, АТФ и др. Так что можно смело предлагать тому же Курчатовскому внедрять "информационный двигатель", который в моей рассылке называется "Демон Кушелева" в биотехнологию и генную инженерию. В данный момент проект "Пикотехнология белков" находится на рассмотрении в Курчатовском уже две недели. Интересно, сколько времени они обычно рассматривают проекты?
Это здесь: http://nanoworld.org.ru/topic/1904/

4

Re: Проверка таблицы композиционного генетического кода

Формы, механизмы, энергия наномира. Сообщение 95 663

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-05_01:

https://www.ncbi.nlm.nih.gov/nuccore/568179845

>CRL29754
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgcctttccccccctcacacttctttcaaaacattcttctactgcctttgcctattctt
tatccctcctatttcatttatcattctctcactttcttaccttacatcgaaaatgggaag
agactgggtccgtcaaccggaggaaaaatcgacatgggaacagtctcaacttggatggtc
ttccacttttccatccacaattactgggacaatgtcaagcaagaagcacgtctcacccta
tcttatgtccgcttgacggacgaagggattttctactgcatctgtaccatgacacctcac
cagcggacctcgcggttccaggccgacttcgaccaacatggagacatccggacctcacgt
attctattggaccccccaatgattgtttgggctaatggcctaccgtggttccctgtttac
aaagctttttccgtcctctgtggaagttggaatgcggtatcctatctagtcggtcgcaaa
tatcggtcaagtatctccgagttctaccttggtgcagccttagccccgcccgaagcagtg
caggcgagccaagaagattccctcacctcttcatactttcttccttgcatccctttttga

Результат:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda0_db7bf68b_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda1_ef3a7b7c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/482931/ … c_orig.png

5

Re: Проверка таблицы композиционного генетического кода

Формы, механизмы, энергия наномира. Сообщение 96  395

Проверка таблицы композиционного генетического кода

Кушелев: Здравствуйте, Вячеслав Александрович!

Мы договорились со станцией "Белок" о том, что Вы пришлете идентификаторы белков, структуры которых Вы планируете определять методом РСА.

Я готов определить их структуры с помощью новой технологии и прислать Вам результаты через 1 рабочий день. У Вас будет возможность сравнить результаты новой технологии с результатами РСА после того, как Вы определите структуры белков. А результаты сравнения уже интересно было бы обсудить. Если Вы посчитаете новую технологию эффективной, то сможете предложить Вашим заказчикам дополнительные услуги за наш счёт.

Жду от Вас идентификаторы белков.

С уважением,
Ваш Александр Кушелев,
рук. лаб. Наномир.

8-926-5101703
8-903-2003424
8-916-8265031
Skype: kushelev2009

6

Re: Проверка таблицы композиционного генетического кода

Формы, механизмы, энергия наномира. Сообщение 96 952

Проверка таблицы композиционного генетического кода

http://www.nrcki.ru/files/pdf/1481190718.pdf

Юлия Алексеевна Дьякова, ученый секре-
тарь ФНИЦ «Кристаллография и фотоника» РАН,
кандидат физико-математических наук:
— В настоящее время одна из важных областей
для человечества — развитие медицины и меди-
цинских технологий, поиск новых лекарств, в том
числе более эффективных антибиотиков, спо-
собных бороться с мутировавшими бактериями,
а также противовирусных лекарств. Одна из клю-
чевых проблем человечества — это и поиск проти-
вораковых препаратов.
Сейчас все вопросы, связанные с поиском новых
лекарств, замыкаются на изучении структуры
белка. Самым надежным для определения струк-
туры макромолекул признан метод рентгенострук-
турного анализа, когда мы выращиваем белковый
кристалл, просвечиваем его рентгеновским излу-
чением и решаем структуру. Но получить белко-
вый кристалл, подобрать условия для его образо-
вания очень непросто. И от нас тут вообще ничего
не зависит — речь идет о механическом переборе
сотен тысяч условий, когда лишь в одном из них
может выпасть кристалл. Этот этап непредсказу-
ем и может затянуться на многие годы.
Кристалл не может возникать из ничего, из хаоса,
который вдруг резко перешел к порядку. Мы пред-
положили, что уже на самой ранней стадии кри-
сталлизации могут образовываться некие упорядо-
ченные комплексы молекул, служащие элементар-
ными «кирпичами» для роста будущего кристалла.

Читать дальше: http://www.nrcki.ru/files/pdf/1481190718.pdf

7

Re: Проверка таблицы композиционного генетического кода

Формы, механизмы, энергия наномира. Сообщение 96 956

Проверка таблицы композиционного генетического кода

Кушелев: Здравствуйте!

Это код книги "Пикотехнология белков": ISBN 978-3-659-92862-8

Хочу обратить Ваше внимание:

Для нашей технологии нужна именно нуклеотидная кодирующая последовательность белка. В аминокислотной последовательности нет информации о вторичной и третичной структуре.

Жду от Вас нуклеотидные кодирующие последовательности интересующих Вас белков или их идентификаторы в базах нуклеотидных последовательностей.

С уважением,
Ваш Александр Кушелев

+7-926-5101703
+7-903-2003424
+7-916-8265031
Skype: kushelev2009

8

Re: Проверка таблицы композиционного генетического кода

".....Кристалл не может возникать из ничего, из хаоса,
который вдруг резко перешел к порядку. ...."
VVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVVV
и теперь вспомним немного химии и ..:
Присмотримся к сути химической реакции. Чтобы примерно представить себе масштаб, о котором идёт речь, возьмём для примера реакцию нитрата серебра с сульфидом натрия. В результате неё молекулы обмениваются составными частями, образуя сульфид серебра, который сразу же выпадает в осадок. В нашем примере мы бросим в литр воды по тысячной миллиграмма каждого из исходных веществ. При этом практически всё серебро прореагирует с сульфидом, да ещё и почти мгновенно.

Удовлетворившись этим не особенно впечатляющим результатом, посмотрим на произошедшее с точки зрения математики. Сколько молекул каждого из исходных веществ в нашей литровой реакции? Это несложно рассчитать, но на случай, если на уроках химии вы списывали домашние задания по литературе, мы сделаем это за вас.

В нашем мысленном эксперименте нитрат серебра реагирует с сульфидом натрия. Но помимо них в реакции есть и третье вещество — вода. Расчёт показывает: на каждую молекулу нитрата серебра приходится десять миллиардов молекул воды — и только две молекулы сульфида натрия. Выходит, реакция между серебром и сульфидом — это почти то же самое, что поиск человеком своей «второй половинки» среди всего населения планеты.

Чем можно объяснить такую феноменальную способность молекул находить друг друга, кроме как волшебством или божественным провидением? Есть одна сила, которую мы привыкли игнорировать: случайность. Между серебром и сульфидом нет какого-то особого притяжения. Они не знают о существовании друг друга, пока не врежутся друг в друга — случайным образом. Только в этот момент внезапно оказывается, что они составляют прекрасную пару.

Но перед тем, как найти свою пару — сульфид — серебро может за доли секунды врезаться в миллиарды молекул воды, никак с ней не реагирующих. Человеческий мозг не создан для операций с такими скоростями.

Наше изумление связано именно с тем, что мы не можем представить себе скорости процессов, происходящих в микромире. В результате этого мы склонны видеть «неслучайность» там, где её нет. Точно так же мы не можем осознать обратное: скажем, что такое три с половиной миллиарда лет с момента зарождения жизни, в течение которых протекала эволюция.

9

Re: Проверка таблицы композиционного генетического кода

http://nanoworld.org.ru/post/103064/#p103064

Кушелев: ЗдОрово! Но все (по крайней мере я) ждут от бога пикотехнологии быструю версию. Каков божественный прогноз?

10

Re: Проверка таблицы композиционного генетического кода

Формы, механизмы, энергия наномира - 98 029

Putin's Ruby Emdrive / Рубиновый Сармат / Satan-Ruby

Human Genome Protein Structure

Online service PROTEIN PICOTECHNOLOGY

Предложение для Курчатовского института.

Проверка таблицы композиционного генетического кода

Skype, 2018-04-24:

[23.04.2018 17:55:57] Кушелев Александр Юрьевич: Привет! Когда едем в Курчатовский?
[23.04.2018 18:06:58] Менеджер D: я сказал, что ты позвонишь завтра и проговоришь какие последовательности нужны. Набери её скажи, что вы договаривались с Менеджером D вернуться к этому разговору через неделю, поэтому я звоню
[23.04.2018 20:00:23] Кушелев Александр Юрьевич: ОК
[9:57:16] Кушелев Александр Юрьевич: Только что звонил в Курчатовский. Она сказала, что сейчас находится в командировке. Приедет на следующей неделе и займётся кодами.
[10:09:35] Менеджер D: Вот же, а ты уточнил дату?
[10:11:57] Кушелев Александр Юрьевич: Следующая неделя начинается с Пн. Вот я и позвоню в Пн. Если рано, она уточнит дату smile
[10:12:06] Менеджер D: хорошо
[10:12:06] Кушелев Александр Юрьевич: Зачем человека перенапрягать?
[10:12:28] Кушелев Александр Юрьевич: Я так понял, что они там все замотанные какие-то
[10:12:55] Менеджер D: Так там же Путин был
[10:15:40] Кушелев Александр Юрьевич: А...
[10:17:29] Кушелев Александр Юрьевич: Надо будет их спросить, не спрашивал ли Владимир Владимирович, как продвигается проверка Пикотехнологии? Ведь в декабре 2017 года я им послал письмо, где темой письма было: "Копия письма президенту РФ".

А вот и копия этого письма от 14 декабря 2017 года, зарегистрированного под номером ПГ 463:

Формы, механизмы, энергия наномира. Сообщение 93 581

Предложение для Курчатовского института.

Уважаемый президент России, Владимир Владимирович!
В лаборатории Наномир создана высокая технология двойного назначения "Пикотехнология белков", которая может многократно увеличить бюджет России. Она создана на базе научного открытия. Открыт композиционный генетический код, по которому не только выбираются аминокислоты при сборке белков, но и задаются их углы поворотов. Эта технология работает примерно в миллиард раз  быстрее рентгеноструктурного анализа, за который заказчики ежедневно платят примерно миллион евро. Новая технология проверена тремя независимыми методами:
1. Корреляция с рентгеноструктурным анализом.
2. Замыкание дисульфидных мостиков, определенных химическими методами
3. Обнаружение сверхдлинных спиралей белковых молекул.
Окончательную проверку новой технологии может сделать Курчатовский институт, в котором есть специализированная лаборатория рентгеноструктурного анализа.
Предложение для Курчатовского ин-та: http://nanoworld.org.ru/topic/1872/
Примите к сведению!
С уважением,
Александр Кушелев,
Руководитель лаборатории Наномир.