661

Re: Формы, механизмы, энергия наномира - 95

Формы, механизмы, энергия наномира. Сообщение 95 631

Готовится 645-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

645 Зачем "Большая галерея" в пирамиде?
В пирамидах обнаружены признаки ХЯСР
Как превратить АЭС в синтезатор драгметаллов.
Диэлектрический магнетрон и супермагнетрон
Корейские физики тоже создали "Демона Кушелева"
Создана новая версия Пикотех 2D, в которой реализован композиционный код-7

https://img-fotki.yandex.ru/get/9749/158289418.4c5/0_18ca98_21ece54b_XL.jpg

https://img-fotki.yandex.ru/get/769132/158289418.4c4/0_18ca14_f9225652_XL.jpg

https://img-fotki.yandex.ru/get/478076/158289418.4c4/0_18ca18_ca1a3f_XL.jpg

http://nanoworld.org.ru/data/05/20021007/011.jpg

http://img-fotki.yandex.ru/get/10/nanoworld.3/0_5ffa_43150486_L.jpg

https://img-fotki.yandex.ru/get/478621/158289418.4c5/0_18cd7d_47f32c94_XL.png

662

Re: Формы, механизмы, энергия наномира - 95

Врут они всё. Ruby Emdrive пытаются включить smile

663

Re: Формы, механизмы, энергия наномира - 95

Формы, механизмы, энергия наномира. Сообщение 95 663

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-05_01:

https://www.ncbi.nlm.nih.gov/nuccore/568179845

>CRL29754
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgcctttccccccctcacacttctttcaaaacattcttctactgcctttgcctattctt
tatccctcctatttcatttatcattctctcactttcttaccttacatcgaaaatgggaag
agactgggtccgtcaaccggaggaaaaatcgacatgggaacagtctcaacttggatggtc
ttccacttttccatccacaattactgggacaatgtcaagcaagaagcacgtctcacccta
tcttatgtccgcttgacggacgaagggattttctactgcatctgtaccatgacacctcac
cagcggacctcgcggttccaggccgacttcgaccaacatggagacatccggacctcacgt
attctattggaccccccaatgattgtttgggctaatggcctaccgtggttccctgtttac
aaagctttttccgtcctctgtggaagttggaatgcggtatcctatctagtcggtcgcaaa
tatcggtcaagtatctccgagttctaccttggtgcagccttagccccgcccgaagcagtg
caggcgagccaagaagattccctcacctcttcatactttcttccttgcatccctttttga

Результат:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda0_db7bf68b_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda1_ef3a7b7c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/482931/ … c_orig.png

664

Re: Формы, механизмы, энергия наномира - 95

Заказ 2018-02-05_02:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_003326181.2 Puccinia graminis f. sp. tritici CRL 75-36-700-3 hypothetical protein (PGTG_08059), mRNA
TTCCATTCCACTCAACCATTCGGACACACCCACCACTGCACACACAATCCACTTTCATTCCATTAGCCCG
ACTTTCGCCATGCGCTCGTTTATACTCATTGCCATCTCCCTTGCTCTCCTGCAGAGCTCGTCAGCCTTAC
CGCTTGACAAGAGGGCCGACACCCAGGGCACCGGGAAAGGCGACGCCGACACCCGCTCGTACATGAGCTG
TGCCGACCAGACAGGCGCCTTGAACCTCAACTTGCTGGGCACCACCCACTGCAGCAACGGGCACAATATT
CCTCGGCCTCATCCTGACCCTCGGCCTTATCCCGACCCTCACCCACACCCCCAGCCATGGCCACTTCCTG
ACCCTCGGCCACACCCCCAACCATGGCCACTGCCTGACCCTCGGCCACACCCCCAGCCATGGCCATTGCC
TGACCCTCGTCCACACCCCCAGCCTTGGCCACTTCCTGACCCACGGCCACACCCCCAGCCATGGCCACTT
CCTCGCCCTCACCCAATCGTTCCCAATGACTGGCCCCACCGTCACTTCCCATACCCTCGACCATTTCCCG
GCCCTACCCCTGATATCATTATTCCGGACAGACCCGACCGACGAATCCCCTACAACCCTTACGGACCGGT
CATTCCTTATCCCCACCCTCAGCCACACCCCGGCCCAGGGCCCCTTCCTCGCCCTCACCCAATCGTTCCC
GATGACTTGCCTCACCGTCACTTCCCATACCCTCGACCATTCCCCGGCCCTACCCCTGATATCATTATTC
CGGACAGACCCGACCGACGAATCCCCTACAGCCCTCACGGACCGGTCATTCCCTACCCGGATGTCACGCC
AATTCCCATCCCGGATAATATTAGCCCAGACTTCCCAGGTCACCGATACCCTAACATTCCTGACTGGAAC
GTCCCCGGTCACCATGCTCCTTACGGGCCTTATCCTCAGGTCGACGATGACGGCATCCCCGGACAAGGTG
TGATCGGCCAACAGTCATCATCCACTGGATACGACCGAGCCGACAGTGCGAGCAGTCTCAACACTGGCGG
ATCCTTCAACAACGGGAACCTGATCTCTGGCGCGGGAGCAGCCGGGTTCAACGGCATCAACACCTTCGGG
GCCAATGGCTTCAGCTCGGGAGGCTCAGTTTACGGCGCTAACGGCATTGCGGGAATCCGCGGTGGCGGTC
TCTCAGCTTCGCAATCCTCTTCCAGCCACGAGAGCAACGCCCGAACCTCATCGACCACCGCGGCTAGTGG
CTACGGACCAGCGGGCGGCGTTGCAGTCTCTCAATCCGCTTCCAACGAAGCAAGCTCCAACCAAGCCTCA
TCCTCCACTTTGATCGCCAAGAACAAGGACAACCAAGTTAAGGACAACAAGGCTTAG

Результат:

https://img-fotki.yandex.ru/get/965297/158289418.4c6/0_18cda2_7248298d_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/370846/158289418.4c6/0_18cda3_ed103d63_XL.png
Оригинал: https://img-fotki.yandex.ru/get/370846/ … 3_orig.png

https://img-fotki.yandex.ru/get/749077/158289418.4c6/0_18cda4_1b535927_orig.png
Звучит периодическая мелодия (12 нот в цикле).

665

Re: Формы, механизмы, энергия наномира - 95

Кушелев: Почему-то сайты с кодами белков стали недоступны...

https://www.ncbi.nlm.nih.gov/protein/OF … DV9BW7P014

https://www.ncbi.nlm.nih.gov/protein/KF … DV9BW7P014

https://www.ncbi.nlm.nih.gov/protein/CR … DV9BW7P014

Может быть завтра заработают?

666

Re: Формы, механизмы, энергия наномира - 95

https://www.ncbi.nlm.nih.gov/protein/OL … F62A3UZ015

https://www.ncbi.nlm.nih.gov/protein/DA … F62A3UZ015

https://www.ncbi.nlm.nih.gov/protein/CC … F62A3UZ015

https://www.ncbi.nlm.nih.gov/protein/OL … F62A3UZ015

https://www.ncbi.nlm.nih.gov/protein/OX … F62A3UZ015

Проверьте, может быть у кого-нибудь откроется?

667

Re: Формы, механизмы, энергия наномира - 95

https://www.youtube.com/watch?v=ZG9gMIL … 3210812110

Александр Кушелев: Настоящие инопланетные механизмы здесь: http://nanoworld.org.ru/topic/1707/

Vo Van: Александр Кушелев, это таки Вы или клон? Кто обещал лет 10 назад халявные лампочки? И где хотя бы одна из них?

Александр Кушелев: Я никому ничего не обещал. Я говорил, что при наличии нормального финансирования можно создать микроволновую энергетику и транспорт быстро. В России это никому не нужно, поэтому китайцы обогнали Россию и США, испытали Emdrive на орбите. Но в лаборатории Наномир есть Ruby Emdrive, который в миллионы раз сильнее: http://nanoworld.org.ru/topic/1707/

668

Re: Формы, механизмы, энергия наномира - 95

https://www.youtube.com/watch?v=-fo5TBi … 1577387769

Олег Валерьевич: Александр Кушелев, ну вот на счет невозможности спасения экипажа у меня большие сомнения... Можно было и совместно наблюдателей отправить с иностранными спасателями, что бы проконтролировать, чтоб не лезли куда не следует

Александр Кушелев: А Вы-то что не помогли спасать? Вы же, как я понял, не иностранец, и позиционируете себя знатоком. Вы бы рассказали, как бы Вы спасали людей из затонувшей подводной лодки. Глядишь, в следующий раз и спасли бы кого-нибудь с помощью Ваших мудрых советов...
Вот, кстати, фильм с дополнительной информацией: https://www.youtube.com/watch?v=8KG-nuI35MQ

669

Re: Формы, механизмы, энергия наномира - 95

Формы, механизмы, энергия наномира. Сообщение 95 669

Online service PROTEIN PICOTECHNOLOGY

Kushelev пишет:

Кушелев: Почему-то сайты с кодами белков стали недоступны...

https://www.ncbi.nlm.nih.gov/protein/OF … DV9BW7P014

https://www.ncbi.nlm.nih.gov/protein/KF … DV9BW7P014

https://www.ncbi.nlm.nih.gov/protein/CR … DV9BW7P014

Может быть завтра заработают?

Заказ 2018-02-05_03:

https://www.ncbi.nlm.nih.gov/nuccore/1082617081

OFZ46708

atgaagaaaaaaaagtttctctatcttctgatcgtctttttgtctttagggtgcatctat
tcagcacccagtcacgctgatgaatttgcaagttttgaaccgacatctgatctaaagaac
tctttggccatcaatgtcaacgaaaacgaattgcaaatccagtatggcgtttacagcgaa
attgaattatctctctacgataacgatggtgttattagttccaatgtatcctggtcaata
gatgctgaaagctttgttccccagggaatggagctcgaagacaccgttgccgacaaggca
ctcatctttggtacaccgcagtttaccgagtcatggtgctttgtaattagagcatcaatt
gcagaaaaaaatgtaactacctcaagagagctatgtattgtggccgaagatgatgaaaac
ataactcatcctcgctttaaatctgatcgctatatgtccgatgctgtcatcaatcgaaac
tataccgatcatattttagtagatacagacattccctctttcacttttagaggaagtgtt
atcgcctccggccttccagaaaatttatcaatattagttagtgagcaatttaaaactttc
agcattgtaggaaaacctcgtttggaagaacttggaacttacatgttcattctttctctt
ggtgacgagctaactggaaatgaaatttttaaacaatttcaaatttcagtagtaaaacca
gaagaaacggagactgtgaattgcccaggtggctactattacgatacaaacttagggtac
tgtgtacaaaatagttcttctcgttgtccagatggaacctactacgaaccttctgttaat
caatgtgttcaatatcctagtccaccgccaactataatttgtcgcccgggttaccacttt
gaccactttttgggccaatgtgttttaaactctcatcctcgatgcccactaaattataag
tgggatgcttttgaaaatcgttgtgtgcgcatgccacatacttgttcatttggggagtac
tattcttgggatcgtcaagaatgtctccctatctggtcaacaacttgctcctatggttat
cactatgactattatttgcagcgctgtgttgcaaactacagatcctgcgcttacggttat
tactgggactactccagaggtatctgtgttcgcaaccaaagattatgtggatacgatgag
cactgggatcctgtatttgatagatgcgtacgcaattatcaacattgctctcccggatat
gagtgggatcgttaccttgaacgatgtgttcgtcaaaatcgtgaacgcctttgtgctcct
ggttggcactggagttatgaatatgatcgatgtgtagaagatcggcggcccgcaccacgt
ccaaggccagaaccaaatccacatccacaacctcggccaatgcctgctccaatgccacaa
cctgagcctatgccatggccaatgcctgctccaatgccacaacctgagcctatgccatgg
ccaatgcctgatccgcaaccacaaccgcgtccaatgccagctccaatgccgcaacctgaa
cctatgccgtggccaatgcctgatccgcaaccacagcctcggccaatgccagctccaatg
ccgcaacctgaacctatgccgtggccaatgcctgatccgcaaccacagcctcggccaatg
ccagctcctcaaccgcaacctgagcctatgccgtggccaatgcctgatccacaaccacag
cctcggccgatgccagctccaatgccgcaacctgaacctatgccgtggccaatgcctgat
ccacaaccacaaccgcgtccaatgccagctccaacgccgcaacctgaacctatgccgtgg
ccaatgcctgatccacaaccacaaccgcgtccaatgccagctcctcagccgcaacctgag
cctatgccgtggccaatgcctgatccgcaaccacaaccgcgtccaatgccagctcctcag
ccgcaacctgagcctatgccgtggccaatgcctgatccacaaccacaacctcggccaatg
ccagtacctcagccgcaacctgagcctatgccgtggccaatgcctgatccacaaccacag
cctcggccaatgccagctcctcagccgcaacctgagcctatgccgtggccaatgccacaa
ccggatccaaatccgcatccacagccacgtccaatgcctggcccagatccaatgccagat
cccaggccaactccagttcctggcccaatgccaaggcctcgcacataa

Результат:

https://img-fotki.yandex.ru/get/373752/158289418.4c6/0_18cdb3_96d04087_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/483372/158289418.4c6/0_18cdb4_50ee6f0f_XL.png
Оригинал: https://img-fotki.yandex.ru/get/483372/ … f_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/967052/158289418.4c6/0_18cdb5_5ca395a3_orig.png
Синими "кирпичиками" изображены пи-спирали.

670

Re: Формы, механизмы, энергия наномира - 95

Kushelev пишет:

Кушелев: Почему-то сайты с кодами белков стали недоступны...

https://www.ncbi.nlm.nih.gov/protein/OF … DV9BW7P014

https://www.ncbi.nlm.nih.gov/protein/KF … DV9BW7P014

https://www.ncbi.nlm.nih.gov/protein/CR … DV9BW7P014

Может быть завтра заработают?

Сегодня всё работает.