791

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 543

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-13_03:

https://www.rcsb.org/pdb/explore/explor … ureId=1MUH

http://www.uniprot.org/uniprot/Q46731

https://img-fotki.yandex.ru/get/476474/158289418.4bf/0_18b2e5_88bdfb44_XL.png

https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

>ENA|AAA73393|AAA73393.1 Escherichia coli protein #1
ATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTCGGCG
GCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAA
TATTCTGGTAAATCAATAACCATCTCATCAGAGGGTAGTGAAGCCATGCAGGAAGGCGCT
TACCGATTTTACCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATG
CAAACAGTCAAGTTGGCTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCT
TTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGATAAA
TCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTA
GGATTACTGCATCAGGAGTGGTGGATGCGCCCGGATGACCCTGCCGATGCGGATGAAAAG
GAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATG
AGCAACGTGATTGCGGTCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAGG
CTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGAGTCT
GGGTTGTATCTGATCGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGC
ATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAACGTAAAAATCGACCAGCCCGCAAG
GCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAAC
GCGGTGCTGGCCGAGGAGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTG
CTGACCGGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTATACC
CATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGG
CAACGCATGGAGGAGCCGGATAATCTGGAGCGGATGGTCTCGATCCTCTCGTTTGTTGCG
GTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCTGCCGCAAGCACTCAGGGCGCAAGGG
CTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGAT
GAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGT
AGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGA
ACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGTTGGGAAGCCCTGCAAAGTAAACTG
GATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCTGA

Результат:

https://img-fotki.yandex.ru/get/477137/158289418.4bf/0_18b2e3_85e33925_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/515846/158289418.4bf/0_18b2e4_e62008ea_XL.png
Оригинал: https://img-fotki.yandex.ru/get/515846/ … a_orig.png

792

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 544

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-13_04:

https://www.rcsb.org/pdb/explore/explor … ureId=1CKB

https://img-fotki.yandex.ru/get/877700/158289418.4bf/0_18b2e6_d6b2fe38_XL.png

http://www.uniprot.org/uniprot/Q64010

https://img-fotki.yandex.ru/get/752268/158289418.4bf/0_18b2e7_14713dc7_XL.png

https://www.ebi.ac.uk/ena/data/view/AAB … play=fasta

>ENA|AAB30755|AAB30755.1 Mus sp. c-Crk
ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGCCGCCTGAGCCGG
CAGGAGGCGGTGGCGCTATTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
AGCACCAGCCCCGGGGACTATGTGCTTAGCGTCTCCGAAAACTCGCGCGTCTCCCACTAC
ATCATCAACAGCAGCGGCCCGCGCCCTCCAGTGCCTCCGTCGCCCGCTCAGCCTCCGCCG
GGAGTGAGTCCCTCCAGGCTCCGAATAGGAGATCAAGAATTTGATTCATTGCCTGCTTTA
CTGGAATTCTACAAAATACACTATTTGGACACTACAACATTGATAGAACCAGTGGCCAGA
TCAAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCAGAGTATGTGCGGGCCCTG
TTTGACTTTAATGGGAATGATGAAGAAGATCTTCCCTTTAAGAAAGGAGACATCCTGAGA
ATCCGGGATAAGCCTGAAGAGCAGTGGTGGAATGCAGAGGACAGCGAAGGAAAGAGGGGG
ATGATTCCTGTCCCTTACGTGGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATTTATGCC
AGGGTTATCCAGAAGCGAGTCCCTAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
GAGGACTTCAGCTGA

Результат:

https://img-fotki.yandex.ru/get/877959/158289418.4bf/0_18b2e8_ec0c2143_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/361712/158289418.4bf/0_18b2e9_eaa3e1bc_XL.png
Оригинал: https://img-fotki.yandex.ru/get/361712/ … c_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/480022/158289418.4bf/0_18b2ea_b4dbedad_orig.png

Сравним данные РСА и Пикотех?

https://img-fotki.yandex.ru/get/477464/158289418.4bf/0_18b2eb_2564350c_orig.png

793

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 545

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-13_05

https://www.rcsb.org/pdb/explore/explor … ureId=2MVG

http://www.uniprot.org/uniprot/P0CL68

https://img-fotki.yandex.ru/get/475949/158289418.4bf/0_18b305_8ff917e1_XL.png

https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

>ENA|AAC66244|AAC66244.1 Borrelia burgdorferi B31 decorin-binding protein B
ATGAAAATTGGAAAGCTAAATTCAATAGTTATAGCCTTGTTTTTTAAACTATTGGTCGCA
TGTAGTATTGGATTAGTAGAAAGAACAAATGCAGCTCTTGAATCGTCCTCTAAGGATTTA
AAAAACAAAATTTTAAAAATAAAAAAAGAAGCCACGGGAAAAGGTGTACTTTTTGAAGCT
TTTACAGGTCTTAAAACCGGTTCCAAGGTAACAAGTGGTGGACTAGCCTTAAGAGAAGCA
AAAGTACAAGCCATTGTTGAAACAGGAAAGTTCCTTAAGATAATAGAAGAAGAAGCTTTA
AAGCTTAAAGAAACTGGAAACAGTGGTCAATTCTTGGCTATGTTTGACTTAATGCTTGAG
GTTGTAGAATCGCTAGAAGACGTTGGAATAATAGGCTTAAAAGCCCGTGTTTTAGAGGAA
TCTAAAAATAATCCTATAAACACAGCTGAAAGATTGCTTGCGGCTAAAGCTCAAATAGAA
AATCAACTTAAAGTGGTTAAGGAAAAACAAAATATTGAAAATGGTGGAGAGAAAAAAAAT
AATAAAAGCAAAAAAAAGAAATAA

Результат:

https://img-fotki.yandex.ru/get/476282/158289418.4bf/0_18b303_5085b4d3_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/477095/158289418.4bf/0_18b304_ecc64037_XL.png
Оригинал: https://img-fotki.yandex.ru/get/477095/ … 7_orig.png

https://img-fotki.yandex.ru/get/509402/158289418.4bf/0_18b306_5d10efe1_orig.png
На отдельных белках корреляция данных РСА с данными Пикотех незаметна.

794

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 546

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-13_06:

https://www.rcsb.org/pdb/results/result … d=65B56BE6

https://www.rcsb.org/pdb/explore/explor … ureId=2WUZ

http://www.uniprot.org/uniprot/P0CL68

https://www.ebi.ac.uk/ena/data/view/AAP … play=fasta

>ENA|AAP33131|AAP33131.1 Trypanosoma cruzi lanosterol 14-alpha-demethylase
ATGTTCATTGAAGCCATTGTATTGGCCCTTACGGCTCTCATCCTGTACTCGGTGTACTCT
GTAAAGTCATTTAACACAACCCGTCCTACTGACCCACCGGTTTACCCCGTTACGGTGCCG
TTTCTGGGACACATTGTGCAGTTTGGCAAGAACCCGCTTGAGTTTATGCAGCGATGCAAA
CGTGATCTCAAGTCGGGTGTTTTCACCATCAGCATTGGGGGACAGCGCGTGACGATCGTG
GGCGATCCCCACGAACACAGTCGTTTTTTCTCGCCTCGCAATGAGATTCTTTCTCCACGT
GAGGTGTACACCATTATGACACCGGTTTTTGGGGAGGGCGTTGCCTACGCTGCGCCATAC
CCAAGGATGAGGGAGCAGCTGAACTTTCTTGCGGAGGAGTTGACCATTGCGAAGTTTCAG
AACTTTGTCCCTGCAATCCAGCATGAGGTCCGCAAGTTTATGGCTGAGAATTGGAAAGAA
GATGAGGGGGTAATTAACCTCCTGGAGGACTGCGGTGCCATGATCATCAACACGGCATGC
CAGTGTCTTTTTGGCGAGGATCTTCGCAAGCGCCTAAATGCCCGACATTTTGCACAGCTT
TTGTCTAAGATGGAAAGCAGCCTGATCCCCGCAGCTGTATTTATGCCATGGTTGCTGCGT
TTGCCCCTTCCCCAATCGGCTCGTTGCCGTGAGGCCCGTGCGGAACTCCAGAAAATTTTG
GGCGAAATTATTGTTGCTCGTGAGAAGGAGGAGGCGAGCAAAGATAACAACACCTCCGAT
CTTTTGGGTGGACTTCTTAAGGCTGTGTACCGGGACGGCACCCGTATGTCGCTTCATGAG
GTGTGCGGTATGATTGTGGCCGCTATGTTTGCAGGCCAGCACACTTCGACGATCACCACC
AGTTGGTCCATGCTGCATCTGATGCATCCAAAGAACAAGAAGTGGTTGGACAAGTTGCAC
AAGGAGATTGACGAATTCCCTGCACAATTAAACTATGACAATGTCATGGATGAAATGCCA
TTTGCCGAACGCTGCGTTCGTGAATCCATTCGCCGTGATCCCCCACTCCTGATGGTCATG
CGCATGGTAAAGGCGGAGGTCAAGGTTGGTTCATATGTTGTTCCCAAGGGTGACATTATC
GCCTGTTCGCCGTTACTCTCACACCACGACGAGGAGGCCTTTCCCAACCCACGTTTGTGG
GATCCGGAGCGTGATGAAAAGGTTGATGGTGCCTTTATTGGCTTCGGTGCGGGTGTGCAC
AAATGCATTGGGCAGAAATTTGCCCTTTTGCAAGTCAAAACCATACTTGCCACCGCCTTC
CGTGAATACGACTTCCAGTTGCTGCGGGACGAGGTTCCAGATCCTGACTACCACACGATG
GTCGTTGGCCCCACGCTCAATCAGTGTCTTGTGAAGTACACCCGCAAGAAGAAATTGCCC
TCGTGA

Результат:

https://img-fotki.yandex.ru/get/874801/158289418.4bf/0_18b307_a015c614_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/874801/158289418.4bf/0_18b308_8c755090_XL.png
Оригинал: https://img-fotki.yandex.ru/get/874801/ … 0_orig.png

https://img-fotki.yandex.ru/get/478076/158289418.4bf/0_18b30a_3c42940c_orig.png

795

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 94 547

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-01-13_07:

https://www.rcsb.org/pdb/explore/explor … ureId=1VDB

http://www.uniprot.org/uniprot/Q5FBS0

https://www.ebi.ac.uk/ena/data/view/BAD … play=fasta

>ENA|BAD89531|BAD89531.1 Bombyx mori (domestic silkworm) fibroin-modulator-binding protein-1
ATGGGTGATTTAAGTCAAGCAGATAGTTCTTGGAAGAAAATGGTTATAGCTAAAACAAAC
AATGAGTGGAAATCATCTGTCGGTGAAGATGCGAATGCAGCTAGTAACACTACACACTTT
AGATTAAGTGATGAATGCATACAATACGATAACATTAAAAAAGAAATTGAGGAAATTGAT
GAACAAGAGACACTCAATACCGTCGAGCCGGTCGATATGATACAAGAAATGGATCCACTA
TCATTGTTGGAGCCTAAAGCGCGTAGACGAAGGAAAGGCTCAGGACCAAAGAGTGAAACA
TCAGAAGAGAGAGCCGCACGGCTAGCCAAGATGTCTGCATATGCAGCACAGAGGCTGGCA
AATGAGTCACCGGAACAGCGCGCCACTAGACTGAAGCGTATGTCCGAATATGCAGCTAAA
AGACTTTCATCAGAGACGAGAGAACAGAGAGCGATTAGGTTGGCAAGAATGTCTGCATAT
GCAGCCCGTCGACTTGCTAATGAGACCCCAGCACAAAGGCAAGCTAGACTATTGAGGATG
TCGGCATATGCTGCGAAAAGGCAGGCTAGCAAGAAGTCTCTTAGTACAGTGAACGATAGC
TTGAATTACAGTATTATGCCGAATCAAAGTAGAGCAACTAATCATCCATTCACTTAA

Результат:

https://img-fotki.yandex.ru/get/767452/158289418.4bf/0_18b340_7ab3bb12_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/749077/158289418.4bf/0_18b341_2c3bc08a_XL.png
Оригинал: https://img-fotki.yandex.ru/get/749077/ … a_orig.png

https://img-fotki.yandex.ru/get/370224/158289418.4bf/0_18b342_d7609e5d_orig.png

Кушелев: Казалось бы плохое совпадение данных Пикотех и PDB. Но ...

https://img-fotki.yandex.ru/get/749077/158289418.4bf/0_18b343_646f5d23_XL.png

мы видим, что данные PDB не совпадают и с данными PDB другого года. Они время от времени меняются. А это значит, что исследователи сами считают, что данные, которые они заменили, были неправильными. Поэтому вопрос о том, что данные в PDB не могут являться эталоном, даже не стоит. Вопрос звучит так: "Какова реальная погрешность данных в PDB в настоящее время?"

И не факт, что эта погрешность стала меньше по сравнению с данными прошлых лет wink

796

Re: Online service PROTEIN PICOTECHNOLOGY

Александр Юрьевич,
напишите пожалуйста по возможности для приведённых примеров
резюме диаграмм PDB    и      резюме диаграмм Пикотех -

Я имею в виду  посты 791-795.

Что показывает PDB  и что показывает Пикотех.

Где РСА ошибся, почему и как это видно.

Как ошибку РСА можно идентифицировать на диаграммах PDB  и Пикотех и почему -
прямо по порядковым номерам аминокислотных остатков в белковой молекуле.

797

Re: Online service PROTEIN PICOTECHNOLOGY

Online service PROTEIN PICOTECHNOLOGY

Татьяна Рясина пишет:

Александр Юрьевич,
напишите пожалуйста по возможности для приведённых примеров
резюме диаграмм PDB    и      резюме диаграмм Пикотех -

Я имею в виду  посты 791-795.

Что показывает PDB  и что показывает Пикотех.

Где РСА ошибся, почему и как это видно.

Как ошибку РСА можно идентифицировать на диаграммах PDB  и Пикотех и почему -
прямо по порядковым номерам аминокислотных остатков в белковой молекуле.

Самое наглядное будет в том случае, если в лаборатории Курчатовского вырастят два кристалла полилизина. Один по коду n*(AAA), а второй по коду n*(AAG). Там и без рентгена будет видно, что структуры разные, т.к. у них будет разная плотность и другие параметры. Поэтому я и пытаюсь связаться с лабораторией из Курчатовского. Но пока удалось пообщаться только с секретарями.

798

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 650

Online service PROTEIN PICOTECHNOLOGY

https://blast.ncbi.nlm.nih.gov/Blast.cgi

Ищем: pfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpfpf

Заказ 2018-02-04_001:

https://www.ncbi.nlm.nih.gov/nuccore/646327331

KFQ56829

>KFQ56829
cctaaccccaaacccaccccatatcccgctcccagccccaaacccaccccatatcccgct
cccaaccccaaacccacccgatatcccgctcctaaccccaaacccatcccatatcccgct
cccagccccaaacccatcccatatcccactcctaaccccaaacccatcccatatcccgct
cccagccccaaacccatcccatatcccactcctaaccccaaacccatcccatatcccgct
cccagccccaaacccatcccatatcccactcctaaccccaaacccatcccatatcccgct
cccagccccaaacccatcccatatcccactcct

Результат:

https://img-fotki.yandex.ru/get/517076/158289418.4c5/0_18cd7e_de8cd339_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/1023575/158289418.4c5/0_18cd7f_970e158c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/1023575 … c_orig.png

799

Re: Online service PROTEIN PICOTECHNOLOGY

Формы, механизмы, энергия наномира. Сообщение 95 663

Рекорды сверхдлинных спиралей белковых молекул

Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-05_01:

https://www.ncbi.nlm.nih.gov/nuccore/568179845

>CRL29754
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgccttttgagatgccttttgagatgccttttgagatgccttttgagatgccttttgag
atgcctttccccccctcacacttctttcaaaacattcttctactgcctttgcctattctt
tatccctcctatttcatttatcattctctcactttcttaccttacatcgaaaatgggaag
agactgggtccgtcaaccggaggaaaaatcgacatgggaacagtctcaacttggatggtc
ttccacttttccatccacaattactgggacaatgtcaagcaagaagcacgtctcacccta
tcttatgtccgcttgacggacgaagggattttctactgcatctgtaccatgacacctcac
cagcggacctcgcggttccaggccgacttcgaccaacatggagacatccggacctcacgt
attctattggaccccccaatgattgtttgggctaatggcctaccgtggttccctgtttac
aaagctttttccgtcctctgtggaagttggaatgcggtatcctatctagtcggtcgcaaa
tatcggtcaagtatctccgagttctaccttggtgcagccttagccccgcccgaagcagtg
caggcgagccaagaagattccctcacctcttcatactttcttccttgcatccctttttga

Результат:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda0_db7bf68b_XL.png

Развернуто:

https://img-fotki.yandex.ru/get/482931/158289418.4c6/0_18cda1_ef3a7b7c_XL.png
Оригинал: https://img-fotki.yandex.ru/get/482931/ … c_orig.png

800

Re: Online service PROTEIN PICOTECHNOLOGY

Заказ 2018-02-05_02:

https://www.ncbi.nlm.nih.gov/nuccore/XM … port=fasta

>XM_003326181.2 Puccinia graminis f. sp. tritici CRL 75-36-700-3 hypothetical protein (PGTG_08059), mRNA
TTCCATTCCACTCAACCATTCGGACACACCCACCACTGCACACACAATCCACTTTCATTCCATTAGCCCG
ACTTTCGCCATGCGCTCGTTTATACTCATTGCCATCTCCCTTGCTCTCCTGCAGAGCTCGTCAGCCTTAC
CGCTTGACAAGAGGGCCGACACCCAGGGCACCGGGAAAGGCGACGCCGACACCCGCTCGTACATGAGCTG
TGCCGACCAGACAGGCGCCTTGAACCTCAACTTGCTGGGCACCACCCACTGCAGCAACGGGCACAATATT
CCTCGGCCTCATCCTGACCCTCGGCCTTATCCCGACCCTCACCCACACCCCCAGCCATGGCCACTTCCTG
ACCCTCGGCCACACCCCCAACCATGGCCACTGCCTGACCCTCGGCCACACCCCCAGCCATGGCCATTGCC
TGACCCTCGTCCACACCCCCAGCCTTGGCCACTTCCTGACCCACGGCCACACCCCCAGCCATGGCCACTT
CCTCGCCCTCACCCAATCGTTCCCAATGACTGGCCCCACCGTCACTTCCCATACCCTCGACCATTTCCCG
GCCCTACCCCTGATATCATTATTCCGGACAGACCCGACCGACGAATCCCCTACAACCCTTACGGACCGGT
CATTCCTTATCCCCACCCTCAGCCACACCCCGGCCCAGGGCCCCTTCCTCGCCCTCACCCAATCGTTCCC
GATGACTTGCCTCACCGTCACTTCCCATACCCTCGACCATTCCCCGGCCCTACCCCTGATATCATTATTC
CGGACAGACCCGACCGACGAATCCCCTACAGCCCTCACGGACCGGTCATTCCCTACCCGGATGTCACGCC
AATTCCCATCCCGGATAATATTAGCCCAGACTTCCCAGGTCACCGATACCCTAACATTCCTGACTGGAAC
GTCCCCGGTCACCATGCTCCTTACGGGCCTTATCCTCAGGTCGACGATGACGGCATCCCCGGACAAGGTG
TGATCGGCCAACAGTCATCATCCACTGGATACGACCGAGCCGACAGTGCGAGCAGTCTCAACACTGGCGG
ATCCTTCAACAACGGGAACCTGATCTCTGGCGCGGGAGCAGCCGGGTTCAACGGCATCAACACCTTCGGG
GCCAATGGCTTCAGCTCGGGAGGCTCAGTTTACGGCGCTAACGGCATTGCGGGAATCCGCGGTGGCGGTC
TCTCAGCTTCGCAATCCTCTTCCAGCCACGAGAGCAACGCCCGAACCTCATCGACCACCGCGGCTAGTGG
CTACGGACCAGCGGGCGGCGTTGCAGTCTCTCAATCCGCTTCCAACGAAGCAAGCTCCAACCAAGCCTCA
TCCTCCACTTTGATCGCCAAGAACAAGGACAACCAAGTTAAGGACAACAAGGCTTAG

Результат:

https://img-fotki.yandex.ru/get/965297/158289418.4c6/0_18cda2_7248298d_orig.png

Развернуто:

https://img-fotki.yandex.ru/get/370846/158289418.4c6/0_18cda3_ed103d63_XL.png
Оригинал: https://img-fotki.yandex.ru/get/370846/ … 3_orig.png

https://img-fotki.yandex.ru/get/749077/158289418.4c6/0_18cda4_1b535927_orig.png
Звучит периодическая мелодия (12 нот в цикле).